1H, 13C and 15N assignment of the GNA1946 outer membrane lipoprotein from Neisseria meningitidis.

Abstract

GNA1946 (Genome-derived Neisseria Antigen 1946) is a highly conserved exposed outer membrane lipoprotein from Neisseria meningitidis bacteria of 287 amino acid length (31 kDa). Although the structure of NMB1946 has been solved recently by X-Ray crystallography, understanding the behaviour of GNA1946 in aqueuos solution is highly relevant for the discovery of the antigenic determinants of the protein that will possibly lead to a more efficient vaccine development against virulent serogroup B strain of N. meningitidis. Here we report almost complete (1)H, (13)C and (15)N resonance assignments of GNA1946 (residues 10-287) in aqueous buffer solution.

Full text

Page 1

ARTICLE
1H,13C and15N assignment of the GNA1946 outer membrane
lipoprotein from Neisseria meningitidis
A. Neumoin•A. Leonchiks•P. Petit•
L. Vuillard•M. Pizza•M. Soriani•
R. Boelens•A. M. J. J. Bonvin
Received: 16 August 2010/Accepted: 13 December 2010/Published online: 28 December 2010
? The Author(s) 2010. This article is published with open access at Springerlink.com
Abstract
1946) is a highly conserved exposed outer membrane
lipoprotein from Neisseria meningitidis bacteria of 287
amino acid length (31 kDa). Although the structure of
NMB1946 has been solved recently by X-Ray crystallog-
raphy, understanding the behaviour of GNA1946 in aque-
uos solution is highly relevant for the discovery of the
antigenic determinants of the protein that will possibly lead
to a more efficient vaccine development against virulent
serogroup B strain of N.meningitidis. Here we report
almost complete1H,13C and15N resonance assignments of
GNA1946 (residues 10–287) in aqueous buffer solution.
GNA1946 (Genome-derived Neisseria Antigen
Keywords
NMR ? Antigen
Pathogenic bacteria ? Meningitis ? Liporotein ?
Biological context
Neisseria meningitidis is an encapsulated, Gram-negative
bacterium that colonizes the upper respiratory tract of
humans. During invasive infection, the bacterium enters
the bloodstream, where it multiplies to high density and
causes a form of sepsis characterized by the dramatic dis-
ruption of the endothelium and microvasculature. From the
bloodstream the bacterium can cross the blood–brain bar-
rier and cause meningitis, which mostly affects infants,
children, and adolescents who do not have bactericidal
antibodies to the infecting strain. Although conjugate
vaccines against serogroups A, C, Y, and W-135 were
proven to be safe and effective in eliminating the disease,
the poor immunogenicity of the serogroup B capsular
polysaccharide and its cross-reactivity toward human tis-
sues have stressed the need to develop a universal vaccine
covering all meningococcal strains (Giuliani et al. 2006). A
few years ago we determined the sequence of the genome
of a meningococcus B strain (MC58) and used it to dis-
cover novel protective antigens (Pizza et al. 2000). Among
them we identified GNA1946, a highly conserved lipo-
protein sharing homology with periplasmic ABC methio-
nine transporters (Pizza et al. 2000; Jacobsson et al. 2006;
Peng et al. 2008). Yang and colleagues have recently
solved the crystallographic structure of GNA1946 and
postulated a high affinity binding to
hypothesizing a role as an initial receptor of the ABC
transporter family (Yang et al. 2009). In this study, we
report the1H,13C and15N chemical shift assignments of
GNA1946 in aqueous solution.
L-methionine,
Methods and experiments
Cloning, expression and purification of GNA1946
antigen
GNA1946 was amplified from a NMB genomic DNA
library using the following primers NMB1946_BamHI_S;
A. Neumoin ? R. Boelens ? A. M. J. J. Bonvin (&)
Bijvoet Center for Biomolecular Research, Science Faculty,
Utrecht University, Padualaan 8, 3584 CH Utrecht,
The Netherlands
e-mail: a.m.j.j.bonvin@uu.nl
A. Leonchiks
ASLA Biotech, Riga, Latvia
P. Petit ? L. Vuillard
BioXtal, Marseille, France
M. Pizza ? M. Soriani
Novartis, Siena, Italy
123
Biomol NMR Assign (2011) 5:135–138
DOI 10.1007/s12104-010-9285-y

Page 2

(ACTGGGATCCATGAAAACCTTCTTCAAAACCC) and
NMB1946_XhoI_AS (ACTGCTCGAGTTATTTGGCTGC
GCCTTCATTCC) and subsequently subcloned into pGEX-
6P-1 vector using BamHI and XhoI as restriction sites.
Uniformly13C,15N-labelled protein was expressed in Esch-
erichia coli C43(DE3) strain (Lucigen) in M9 medium
containing 0.1%15N-ammonium chloride, 0.2%13C-glucose
(Cambridge Isotope Laboratories) and 50 lg/ml ampicillin
(Sigma). Protein expression was induced with 1 mM IPTG
(isopropyl b-D-thiogalactosidase). After 16 h incubation at
293 K cells were centrifuged and the cell pellet was resus-
pended in GST buffer at pH 8.0 and lysed by sonication. The
recombinant protein was purified using a column containing
Glutathione Sepharose 4 Fast Flow (GE Healthcare) pre-
equilibrated with GST buffer. Sample purity was monitored
by SDS–PAGE. Thermolysin (Sigma) was used to remove
the GST tag from the recombinant protein. After enzymatic
reaction, the proteins were separated by gel filtration on a
column packed with Superdex 200 (GE Healthcare). The
protein-rich fractions were pooled and then subjected to a
final purification step on Gluatahione Sepharose 4 Fast Flow
column to remove the residual GST and uncleaved fused-
protein. Finally GNA1946 was dialyzed three times against
100 volumes of 200 mM NaCl, 0.05% NaN3, 20 mM
sodium phosphate buffer, pH 7.0, concentrated to 0.5 mM,
supplied with 5% D2O and used directly for the NMR
measurements.
NMR spectroscopy
All spectra were recorded at 298 K on a Bruker Avance
900 MHzspectrometer equipped
Sequence-specific resonance assignment was accomplished
based on a combination of triple-resonance experiments as
well as
assignment was performed based on the set of HNCO/
HN(CA)CO and HNCA/HN(CO)CA experiments (Yama-
zaki et al. 1994). Additionally, CBCANH and CBCA(CO)NH
withacryoprobe.
15N- and
13C-HSQC-NOESY spectra. Backbone
Fig. 1
900 MHz1H frequency at a temperature of 298 K
1H,15N-HSQC spectrum of 0.5 mM GNA1946 in 20 mM sodium phosphate buffer, 200 mM NaCl, pH 7.0. The spectrum was recorded at
136A. Neumoin et al.
123

Page 3

spectra (Shan et al. 1996) were evaluated whenever pos-
sible to confirm the assignments made and derive infor-
mation on Cb chemical shifts. Side-chain resonance
assignments were accomplished with HCCH-TOCSY
experiments (Kay et al. 1993). Finally, chemical shifts
were obtained by picking peaks in a 13.3 ms constant-time
1H,13C-HSQC spectrum (Vuister and Bax 1992). The
aromatic ring systems of Phe, Tyr, His, and Trp residues
were picked in a 8.8 ms constant time1H,13C-HSQC and
correlated with b-carbons via the HBCBCGCDHD exper-
iment (Yamazaki et al. 1993). All chemical shift values
were finally derived from the position of peaks in the
1H,15N-HSQC and the constant time1H,13C-HSQC spectra.
All experiments employed pulsed-field gradients (Keeler
et al. 1994). Data were processed with TOPSPIN 2.1
(Bruker) and analyzed with the CCPNMR Analysis 2.1
software (Vranken et al. 2005).
Assignment and data deposition
The GNA1946 protein in aqueous buffer gives a well-
resolved1H,15N-HSQC spectrum which is a clear indication
of a well-folded protein. Moreover the sample is highly
stable and displays no degradation over a half a year period
as demonstrated by an identical pattern in the1H,15N-HSQC
spectrum. The presence in the initial spectrum of several
less intense but very sharp peaks suggests, however,
minor degradation upon initial sample preparation. The
1H,15N-HSQC of GNA1946 is shown in Fig. 1. The overall
backbone assignments have been completed to approxi-
mately 96% forthe non-prolyl1HN-15Nresonances,98% for
the13Caand 95% for the13C0resonances that could be
detected in the spectra. The N-termini residues M1 to S9
have not been assigned because of line broadening most
likely due to solvent exchange and/or conformational
exchange. Of the remaining 278 residues, more than 95% of
the backbone resonances and more than 87% of the side
chainsresonanceswereunambiguouslyidentified,including
the assignment of 85% of the1H side chain resonances.
Chemical shifts were deposited in the BioMagResBank
(http://www.bmrb.wisc.edu) under the accession number
BMRB 17250. The secondary structure of GNA1946 was
evaluated by calculating the backbone torsion angles using
TALOS ? program (Shen et al. 2009). As shown in Fig. 2,
TALOS ? restraints were obtained for 143 residues and
suggestthepresence of15a-helices(residues54–60,63–68,
86–91, 103–112, 136–138, 152–164, 179–182, 198–200,
202–207, 216–221, 225–228, 246–248, 251–258, 261–271
and 279–282) and 10 b-strands (residues 44–49, 73–78,
96–99, 115–119, 126–129, 143–147, 191–194, 209–213,
233–235 and 239–243) that are in well correspondence with
the available X-ray structure (Yang et al. 2009).
Acknowledgments
Framework Programme of the European Community, FP6-STREP
project ‘‘BacAbs’’, grant number LSHB-CT-2006-037325.
This work was supported by the Sixth Research
Open Access
Creative Commons Attribution Noncommercial License which per-
mits any noncommercial use, distribution, and reproduction in any
medium, provided the original author(s) and source are credited.
This article is distributed under the terms of the
References
Giuliani MM, Adu-Bobie J et al (2006) A universal vaccine for
serogroup B meningococcus. Proc Natl Acad Sci USA 103(29):
10834–10839
Jacobsson S, Thulin S, Molling P, Unemo M, Comanducci M,
Rappuoli R, Olcen P (2006) Sequence constancies and variations
in genes encoding three new meningococcal vaccine candidate
antigens. Vaccine 24(12):2161–2168
Fig. 2 GNA1946 secondary structure evaluation using TALOS?
(Shen et al. 2009) and comparison with the published crystal structure
(PDB entry 3IR1 Yang et al. 2009). The residues in the regions
predicted to adopt a-helical and b-strand secondary structures are
marked by ‘‘H’’ and ‘‘B’’, respectively
1H,13C and15N assignment of the GNA1946137
123

Page 4

Kay L, Xu GY, Singer AU, Muhandiram DR, Forman-Kay JD (1993)
A gradient-enhanced HCCH-TOCSY experiment for recording
side-chain 1H and 13C correlations in H2O samples of proteins.
J Magn Reson Ser B 101:333–337
Keeler J, Clowes RT, Davis AL, Laue ED (1994) Pulsed-field
gradients: theory and practice. Methods Enzymol 239:145–207
Peng J, Yang L et al (2008) Characterization of ST-4821 complex, a
unique Neisseria meningitidis clone. Genomics 91(1):78–87
Pizza M, Scarlato V et al (2000) Identification of vaccine candidates
against serogroup B meningococcus by whole-genome sequenc-
ing. Science 287(5459):1816–1820
Shan X, Gardner KH, Muhandiram DR, Rao NS, Arrowsmith CH,
Kay LE (1996) Assignment of N-15, C-13(alpha), C-13(beta),
and HN resonances in an N-15, C-13, H-2 labeled 64 kDa trp
repressor-operator complex using triple-resonance NMR spec-
troscopy and H-2-decoupling. J Am Chem Soc 118(28):
6570–6579
Shen Y, Delaglio F, Cornilescu G, Bax A (2009) TALOS? : a hybrid
method for predicting protein backbone torsion angles from
NMR chemical shifts. J Biomol NMR 44:213–223
Vranken WF, Boucher W et al (2005) The CCPN data model for
NMR spectroscopy: development of a software pipeline. Proteins
59(4):687–696
Vuister GW, Bax A (1992) Resolution enhancement and spectral
editing of uniformly 13C-enriched proteins by homonuclear
broadband 13C decoupling. J Magn Reson 98:428–435
Yamazaki T, Forman-Kay JD, Kay LE (1993) 2-dimensional NMR
experiments for correlating C-13-beta and H-1-delta/epsilon
chemical-shifts of aromatic residues in C-13-labeled proteins via
scalar couplings. J Am Chem Soc 115(23):11054–11055
Yamazaki T, Lee W, Arrowsmith CH, Muhandiram DR, Kay LE
(1994) A suite of triple-resonance NMR experiments for the
backbone assignment of N-15, C-13, H2- labeled proteins with
high sensitivity. J Am Chem Soc 116(26):11655–11666
Yang X, Wu Z, Wang X, Yang C, Xu H, Shen Y (2009) Crystal
structure of lipoprotein GNA1946 from Neisseria meningitidis.
J Struct Biol 168(3):437–443
138A. Neumoin et al.
123