Insertion sequence elements in Cupriavidus metallidurans CH34: distribution and role in adaptation.

Abstract

Cupriavidus metallidurans CH34 is a β-proteobacterium well equipped to cope with harsh environmental conditions such as heavy metal pollution. The strain carries two megaplasmids specialized in the response to heavy metals and a considerable number of genomic islands, transposons and insertion sequence (IS) elements. The latter were characterized in detail in this study, which revealed nine new IS elements totaling to 21 distinct IS elements from 10 different IS families and reaching a total of 57 intact IS copies in CH34. Analysis of all fully sequenced bacterial genomes revealed that relatives of these IS elements were mostly found in the Burkholderiaceae family (β-proteobacteria) to which C. metallidurans belongs. Three IS elements were 100% conserved in other bacteria suggesting recent interaction and horizontal transfer between these strains. In addition, a number of these IS elements were associated with genomic islands, gene inactivation or rearrangements that alter the autotrophic growth capacities of CH34. The latter rearrangements gave the first molecular evidence for the mutator phenotype that is characteristic for various C. metallidurans strains. Furthermore, differential expression of some IS elements (or adjacent genes in the same strand orientation) was found under heavy metal stress, an environmental stress to which C. metallidurans CH34 is well adapted. These observations indicate that these IS elements play an active role in C. metallidurans CH34 lifestyle, including its metabolic potential and adaptation under selective pressure.

Full text

Page 1

Insertion sequence elements in Cupriavidus metallidurans CH34:
Distribution and role in adaptation
Kristel Mijnendonckxa,b, Ann Provoosta, Pieter Monsieursa, Natalie Leysa, Max Mergeaya,
Jacques Mahillonb, Rob Van Houdta,⇑
aUnit of Microbiology, Belgian Nuclear Research Centre (SCK?CEN), B-2400 Mol, Belgium
bLaboratory of Food and Environmental Microbiology, Université catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium
a r t i c l ei n f o
Article history:
Received 27 October 2010
Accepted 20 December 2010
Available online 24 December 2010
Keywords:
Insertion sequence
Autotrophy
Mutator
Heavy metal
Burkholderiaceae
a b s t r a c t
Cupriavidus metallidurans CH34 is a b-proteobacterium well equipped to cope with harsh
environmental conditions such as heavy metal pollution. The strain carries two megaplas-
mids specialized in the response to heavy metals and a considerable number of genomic
islands, transposons and insertion sequence (IS) elements. The latter were characterized
in detail in this study, which revealed nine new IS elements totaling to 21 distinct IS ele-
ments from 10 different IS families and reaching a total of 57 intact IS copies in CH34. Anal-
ysis of all fully sequenced bacterial genomes revealed that relatives of these IS elements
were mostly found in the Burkholderiaceae family (b-proteobacteria) to which C. metallidu-
rans belongs. Three IS elements were 100% conserved in other bacteria suggesting recent
interaction and horizontal transfer between these strains. In addition, a number of these
IS elements were associated with genomic islands, gene inactivation or rearrangements
that alter the autotrophic growth capacities of CH34. The latter rearrangements gave the
first molecular evidence for the mutator phenotype that is characteristic for various C.
metallidurans strains. Furthermore, differential expression of some IS elements (or adjacent
genes in the same strand orientation) was found under heavy metal stress, an environmen-
tal stress to which C. metallidurans CH34 is well adapted. These observations indicate that
these IS elements play an active role in C. metallidurans CH34 lifestyle, including its meta-
bolic potential and adaptation under selective pressure.
? 2010 Elsevier Inc. All rights reserved.
1. Introduction
After the isolation of Cupriavidus metallidurans CH34
(formerly Ralstonia metallidurans) from metallurgical sedi-
ments in Belgium (Mergeay et al., 1985), the strain at-
tracted attention mainly because of two interesting
features. First, the strain exhibited resistance to a wide
range of different heavy metals mediated by efflux, com-
plexation, and reduction (Janssen et al., 2010; Mergeay
et al., 2003; Monchy et al., 2007). In addition, it showed
great adaptive potential. The latter became clear through
its ability to accept and express foreign genes (Lejeune
et al., 1983), for instance by capturing new broad host
range plasmids by exogenous plasmid isolation (Top
et al., 1994; Van der Auwera et al., 2009) especially those
expressing their accessory genes for the degradation of
xenobiotics (Diels et al., 1993), or through its successful
role as host for functional metagenomics (Craig et al.,
2009, 2010). Recently, CH34 is also being used as a model
to study the impact of challenging environments related to
space exploration on microbial behavior (Leys et al., 2009).
0147-619X/$ - see front matter ? 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.plasmid.2010.12.006
⇑Corresponding author.
E-mail addresses: kristel.mijnendonckx@sckcen.be (K. Mijnendonckx),
ann.provoost@sckcen.be(A.Provoost),
(P. Monsieurs), natalie.leys@sckcen.be (N. Leys), max.mergeay@sckcen.be
(M. Mergeay), jacques.mahillon@uclouvain.be (J. Mahillon), rob.van.
houdt@sckcen.be (R. Van Houdt).
pieter.monsieurs@sckcen.be
Plasmid 65 (2011) 193–203
Contents lists available at ScienceDirect
Plasmid
journal homepage: www.elsevier.com/locate/yplas

Page 2

All species from the closely related genera Cupriavidus and
Ralstonia carry two chromosomes and in addition often one
or more large plasmids (Fricke et al., 2009). These plasmids
have often specific traits linked to their ecological niche.
For C. metallidurans CH34, the two megaplasmids pMOL28
and pMOL30 contain most of the heavy metal resistance
determinants (Mergeay et al., 2009; Monchy et al., 2007).
Another interesting feature of many C. metallidurans
strains is that they display a mutator phenotype, also
termed temperature-induced mortality and mutagenesis
or TIMM (Brim et al., 1999; Diels and Mergeay, 1990;
Taghavi et al., 1997; van der Lelie et al., 1992). In a temper-
ature window between 36 (with maximal viable counts)
and 38 ?C (resulting in complete mortality) cells survived
with a frequency of 10?4? 10?5compared to viable count
at 30 ?C and showed different mutations like deficiency in
autotrophy or requirement for lysine (Lejeune et al., 1983;
Mergeay et al., 1987; van der Lelie et al., 1992).
Although some insertion sequence (IS) elements have
already been described in C. metallidurans CH34, a detailed
and comprehensive survey of the IS elements, their role in
the metabolism of C. metallidurans CH34, and their occur-
rence in other bacteria has until now not been performed.
These small elements (typically less than 3 kb) carry one or
more open reading frames (ORFs) encoding for products
essential for their mobility and generally no other func-
tions are encoded. IS elements are flanked by short in-
verted repeat (IR) sequences and generate short directly
repeated (DR) sequences of the target DNA at the point
of insertion, which are 2–14 bp in size and specific for a
certain element (Mahillon and Chandler, 1998). IS ele-
ments have been implicated in the evolution of the host
as they contribute to diverse genomic rearrangements
(Bentley et al., 2008; Bickhart et al., 2009). Furthermore,
transposition could lead to altered gene expression, which
could be advantageous for the survival or the expression of
newly acquired genetic traits under certain conditions
(Hubner and Hendrickson, 1997; Lin et al., 2007). IS ele-
ments are therefore seen as a significant force in the adap-
tive and evolutionary response of their host, conferring
genome plasticity that allows rapid adaptation to new
environments (Mira et al., 2002; Schneider and Lenski,
2004).
In this study, all IS elements in C. metallidurans CH34
were characterized and classified. All fully sequenced bac-
terial genomes were scrutinized for the occurrence of these
IS elements. Finally, transposition and induction of these IS
elements in different conditions were scrutinized as well
as genetic rearrangements and gene activation.
2. Methods
2.1. Media, strains, plasmids, and culture conditions
C. metallidurans CH34 and its derivatives were cultured
in Tris salt mineral medium (MM284) supplemented with
0.2% (w/v) gluconate as described previously (Mergeay
et al., 1985). Liquid cultures were grown at 30 ?C on a ro-
tary shaker at 150 rpm. Plasmid pGBG1 was a kind gift of
Dominique Schneider (Schneider et al., 2000) and was
propagated in Escherichia coli DH5a. Plasmid pGBG1 was
introduced in C. metallidurans CH34 by electroporation as
described by Choi et al. (2006). Selection was done on
chloramphenicol (1000 lg/ml). IS elements from C. metalli-
durans CH34 were trapped in pGBG1 by selection on tetra-
cycline (20 lg/ml).
2.2. Molecular analysis
Standard techniques were used for isolation of chromo-
somal DNA, electroporation, PCR and agarose gel electro-
phoresis. The oligonucleotides used in this study were
synthesized by Eurogentec (Seraing, Belgium) and are
listed in Supplementary Table 3. Detection of a part of
the integrase module of CMGI-3 was done by PCR amplifi-
cation of a 490 bp DNA fragment with primers PCFand PCR
(starting material was CH34 genomic DNA). IS1071-
mediated excision was detected by PCR amplification of a
3450 bp junction fragment generated by this event (prim-
ers PFand PRused on CH34 genomic DNA) (Fig. 5). C. metal-
lidurans clones carrying a tetracycline-resistant pGBG1
were analyzed by PCR with primers pGBG1_11 and
pGBG1_12 and fragments were subsequently sequenced
(Macrogen, Amsterdam, The Netherlands).
2.3. Analysis of IS elements and survey with IScan
Previously, the full genome (four replicons) of C. metal-
lidurans CH34 was manually annotated via the MaGe plat-
form (Janssen et al., 2010; Vallenet et al., 2006) and
deposited in the NCBI database (http://www.ncbi.nlm.nih.
gov/genbank/) under the GenBank Accession Numbers
NC_007971 (for pMOL30), NC_007972 (for pMOL28),
NC_007973 (for chromosome 1), and NC_007974 (for chro-
mosome 2). All C. metallidurans CH34 project data are
freelyavailablethrough
scope.cns.fr/agc/microscope/home/index.php).
Analysis of the IS elements (terminal inverted repeats,
direct targets repeats, potential DDE catalytic motifs, fam-
ily classification) was done via ISFinder (Siguier et al.,
2006), the PALINDROME algorithm of the EMBOSS package
(Rice et al., 2000), BLASTP and BLASTN (http://blast.
ncbi.nlm.nih.gov/Blast.cgi), and manual curation. The IScan
tool (Wagner et al., 2007) was used to search for IS
elements, related to the 21 distinct elements identified in
C. metallidurans CH34 (Table 1), in 970 curated bacterial
genomes available from GenBank. Only those BlastP hits
to IS ORFs were retained with an E-value of 1e-20 and at
least a 35% amino acid identity between IS ORFs and a
BlastP hit measured over at least 50% of the smallest pro-
tein. For the other parameters, the default settings of the
IScan tool were used.
MaGe(https://www.geno-
2.4. Microarray data mining
Different data sets from transcriptomic analyses using
microarrays were specifically scrutinized for IS-related
gene expression. These data sets are available through
theGeneExpression Omnibus
www.ncbi.nlm.nih.gov/geo/) under Accession Numbers
GSE7272, GSE14049 and GSE23876.
repository (http://
194
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203

Page 3

3. Results and discussion
3.1. Identification and distribution of IS in CH34 genome
Fifty-seven intact IS elements were found in CH34, rep-
resenting identical copies of 21 distinct IS elements (Ta-
ble 1). These copies were dispersed over the four
replicons with most of the elements located on chromo-
some 1 (30 copies) (Figs. 1 and 2). ISRme3 and IS1088 were
most abundant with 10 and 9 copies, respectively. Four
elements (ISRme9, ISRme10, ISRme18, and ISRme19) were
only found on the two plasmids (Fig. 1, Table 1). The active
center of the transposase, represented by three conserved
acidic amino acids, D, D, and E, constituting the DDE motif,
was identified in each element (Supplementary Table 1)
and all IS elements were placed into 10 families. The IS3,
IS30, and IS5 family were most abundant with 18, 13,
and 5 copies, respectively (Fig. 3). The IS3 and IS5 family
are in fact the most abundant families among bacterial
genomes (together with IS1 and IS481) (Touchon and
Rocha, 2007; Wagner et al., 2007).
3.2. IS dispersion in sequenced prokaryotic genomes
Touchon and Rocha, (2007) showed that in general
genome size was the only significant predictor of IS abun-
dance in prokaryotic genomes. Nevertheless, for the four
sequenced Cupriavidus strains the number of genes anno-
tated as related to transposable elements fluctuated
strongly. Cupriavidus taiwanensis LMG19424 carried 222
transposase-related genes, followed by C. metallidurans
CH34 with 145. Both contained a markedly higher num-
ber than C. euthrophus H16 (52) and Cupriavidus pinatu-
bonensis JMP134 (25). This results in a density per Mb
of 34.3 for LMG19424 and 21.0 for CH34 compared to
7.0 and 3.4 for H16 and JMP134, respectively. For
JMP134, as well as for CH34, a significant number of these
genes related to transposable elements, 93.2% and 55.5%
respectively, are located on MGEs (plasmids or integrated
genomic islands) or remnants hereof. Therefore, horizon-
tal acquisition and spread could (have) be(en) mediated
by these MGEs.
IScan (Wagner et al., 2007) was applied to scrutinize
970 completely sequenced bacterial genomes for the
presence of insertion sequences related to the IS elements
of CH34 (Fig. 4). Most relatives were observed in the b-
proteobacteria class and Burkholderiacea family to which
the Cupriavidus genus belongs. Interestingly, 100% con-
served equivalents were found for ISRme3 in the genomes
of Ralstonia pickettii 12D (two copies) and R. pickettii 12 J
(one copy), for ISRme8 in Burkholderia vietnamiensis G4
[equivalent to ISBvi1 (De Palmenaer et al., 2008)], for
ISRme17 in Delftia acidovorans SPH-1 and Comamonas test-
osteroni KF-1 (only partial IS). These 100% conserved ele-
ments suggest recent interaction and horizontal transfer
between these strains. Not only genetic relatedness, but
also co-inhabitation significantly enhances the probability
of gene acquisition by horizontal gene transfer (Mathee
et al., 2008). In this respect, all strains were isolated from
anthropogenic and polluted environments. C. metallidu-
rans CH34 was isolated from sediments of a decantation
basin of a zinc factory (Mergeay et al., 1985), R. pickettii
12 J and 12D were isolated from copper-contaminated
lake sediments (Yang et al., 2010), B. vietnamiensis G4
was isolated from an industrial waste treatment facility
for its trichloroethene oxidizing ability (Nelson et al.,
1987), D. acidovorans SPH-1 and C. testosteroni KF-1 were
isolated from a sewage treatment plant and are part of a
defined three-member bacterial community which com-
pletely mineralizes linear alkylbenzenesulfonate surfac-
tants (Schleheck et al., 2004). Moreover, ISRme17 is part
of a much larger gene cluster of 12 kb carrying genes
involvedin methioninebiosynthesisandphosphite
Table 1
Distribution of IS elements in C. metallidurans CH34.
IS elementFamily (sub-) Length (bp)CHR1CHR2pMOL28pMOL30
ISRme4
ISRme9
ISRme20
IS1090
ISRme11
ISRme12
ISRme17
IS1087B
ISRme3
ISRme15
IS1086
IS1088
ISRme10
ISRme8
ISRme5
ISRme1
ISRme6
ISRme7
ISRme19
IS1071
ISRme18
IS21
IS21
IS21
IS256
IS3(IS150)
IS3(IS150)
IS3(IS150)
IS3 (IS2)
IS3(IS3)
IS3(IS51)
IS30
IS30
IS30
IS4
IS481
IS5(IS427)
IS5(IS427)
IS6
IS66
Tn3
Tn3
2469
2688
1977
1343
1231
1454
1678
1330
1288
1325
1106
1103
1063
1455
1041
1331
913
840
2227
3204
ND
2
1
1
4
2
1
1
2
35
1
1
6
2
1
1
3
1
1
1
3
2
1
2
1
1
2
1
31a
1
ND: not determined.
aCopy inactivated by Tn6049.
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203
195

Page 4

metabolism, which is almost 100% conserved among C.
metallidurans CH34, D. acidovorans SPH-1 and C. testoste-
roni KF-1. This indicates recent horizontal gene transfer
of a much larger gene cluster.
3.3. Genetic rearrangements through IS elements
The three intact copies of IS1071 are located in genomic
island CMGI-3 (Van Houdt et al., 2009), which carries
Fig. 1. Distribution of the 57 copies representing 21 distinct IS elements in C. metallidurans CH34. Circular representation of the four replicons with the
distribution of the different IS elements (colored triangles). Genomic islands are indicated in black solid bars.
196
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203

Page 5

genes involved in carbon dioxide fixation and hydrogeno-
trophy. Temperature-induced mortality and mutagenesis
at 37 ?C frequently yielded C. metallidurans CH34 mutants
unable to grow autotrophically. Next to gene inactivation
due to mutations, loss of the genes involved in autotrophy
could be mediated either by excision of the whole genomic
island CMGI-3 (Tn4371 family) or by excision mediated by
two IS1071 copies flanking the complete region (Fig. 5).
Eight different TIMM mutants deficient in autotrophic
growth were analyzed using PCR assays that allowed
detection of a part of the integrase module of CMGI-3
and of the junction generated by IS1071-mediated excision
(Fig. 5). For all mutant strains and wild-type CH34 the
integrase module of CMGI-3 was detected. For all mutant
strains but not for wild-type CH34, a 3450 bp junction
fragment was detected (Supplementary Fig. 1). These re-
sults indicated loss through IS1071-mediated excision in
all cases rather than excision of the whole CMGI-3 ele-
ment. This is the third observation that IS1071-mediated
rearrangements alter the metabolic potential of the host
as previously described for Comamonas sp. strain JS46
(Providenti et al., 2006) and C. pinatubonensis JMP134
(Clement et al., 2001). These rearrangements with IS1071
provide the first molecular explanation of the observations
associated with TIMM. It may be hypothesized that the
control on the stability of some transposable elements
would be relieved under stress (e.g. near-lethal growth
temperature), allowing increased transposition events,
excessive recombination and genome destabilization. It
will be of interest to examine if (other) IS elements or
transposons would be involved in other events elicited
by the mutator phenotype of C. metallidurans.
3.4. Transposition of IS elements
For a number of the identified IS elements transposition
has been reported previously and was confirmed in this
study. Transposition of IS1086 and ISRme1 was detected
in CH34 by positive selection on sucrose and tetracycline
by inactivation of the sacB gene on vector pJV240 (Dong
et al., 1992) and the k CI repressor controlling expression
tetA on vector pGBG1 (Schneider et al., 2000), respectively.
Excision of IS1086 was observed in the rearranged deriva-
tive of pMOL28 obtained after exposure to 37 ?C (Taghavi
et al., 1997). IS1087 was identified in a spontaneous zinc
resistant mutant of strain AE126, which is a derivative of
CH34 normally sensitive to zinc as it only carries plasmid
pMOL28 and not plasmid pMOL30 (associated with resis-
tance to zinc) (Collard et al., 1993; Grass et al., 2000;
Tibazarwa et al., 2000). The increased level of zinc resis-
tance was due to insertion of IS1087 in cnrY, which encodes
an anti-sigma factor, resulting in constitutive expression of
the the cnr cobalt and nickel resistance determinant and in
increased (nonspecific) Zn efflux (Collard et al., 1993; Grass
et al., 2000; Tibazarwa et al., 2000). IS1088 and IS1090
were identified by introducing the czr (cadmium zinc resis-
tance) operon of Pseudomonas aeruginosa CMG103 in C.
metallidurans AE104, which lacks both plasmids pMOL28
and pMOL30. Expression of the P. aeruginosa CMG103 czr
0
1
2
3
4
5
6
7
8
9
10
11
ISRme3
IS1088IS1090
ISRme1
ISRme5
IS1071IS1086
IS1087
ISRme4 ISRme7ISRme8
ISRme11ISRme15
ISRme6
ISRme9
ISRme10 ISRme12
ISRme17 ISRme18
ISRme19
ISRme20
Number of copies
Fig. 2. Copy number of the IS elements in C. metallidurans CH34. The stacked bars represent the number of copies of each IS element over the four replicons:
chromosome 1 (light gray), chromosome 2 (white), plasmid pMOL28 (dark gray) and plasmid pMOL30 (black).
0
2
4
6
8
10
12
14
16
18
20
IS3
IS30
IS5
Tn3
IS21
IS256
IS481
IS4
IS6
IS66
Number of copies
Fig. 3. Distribution of the 10 IS families in C. metallidurans CH34. The
stacked bars represent the distribution of the IS families over the four
replicons: chromosome 1 (light gray), chromosome 2 (white), plasmid
pMOL28 (dark gray) and plasmid pMOL30 (black).
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203
197

Page 6

operon was low in C. metallidurans AE104, resulting in a
low resistance to Zn (0.8 mM). However, mutants with in-
creased resistance to Zn (up to 1.5 mM) that carried IS1088
or IS1090 in the promoter region of czr were readily ob-
served (at frequency of ca. 10?4transposition event/cell/
generation) (Talat, 2000).
In an attempt to monitor the transposition of other IS
elements, pGBG1-mediated IS trapping was performed
again (Schneider et al., 2000). This identified again the
transposition of IS1086 (data not shown). In addition, anal-
ysis of four different silver resistant mutants from C. metal-
lidurans CH34 indicated the transposition of IS1086 and
IS1087B in the agr locus. This locus encodes a RND efflux
system with its associated two-component regulatory sys-
tem. However, since this RND could not be classified to the
HAE-RND family (hydrophobic and amphiphilic com-
pounds efflux) nor to the HME-RND family (heavy metal ef-
flux) the involvement of this locus in the increased silver
resistance still needs to be determined (K. Mijnendonckx,
unpublished results).
3.5. Induction of IS elements
C. metallidurans CH34 carries a high number of metal
resistance genes and is specifically adapted to survive eco-
logical niches strongly dominated by heavy metal pollu-
Fig. 4. Dispersion of CH34 IS elements in sequenced bacterial genomes. Schematic representation of insertion sequences related to the IS elements of CH34
in all completely sequenced bacterial genomes. The number corresponds to the number of IS elements related to a particular IS element of CH34 (X-axis,
grouped by IS family) in a certain bacterial family (Y-axis, grouped by bacterial class). The color code grades the total number of IS in a particular bacterial
family divided by the number of sequenced species herein. (For interpretation of the references to color in this figure legend, the reader is referred to the
web version of this article).
198
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203

Page 7

tion (Janssen et al., 2010). As model organism it has been
used to study microbial heavy metal responses and as a re-
sult multiple microarray data sets are publicly available
through the Gene Expression Omnibus repository under
Accession Numbers GSE7272, GSE14049 and GSE23876.
These data sets were mined for differential expression of
the identified IS-bound transposases after exposure to dif-
ferent heavy metals (Ag+, As3+, Au3+, Cd2+, Co2+, Cr6+, Cs+,
Cu2+, Hg2+, Mn2+, Ni2+, Pb2+, Se4+, Sr2+, Tl+, and Zn2+). Ten
(out of 21) IS elements showed differential expression to
one or more metals (Table 2). Since IS mRNAs are generally
quite unstable, regulation of transposition is tightly regu-
lated and endogenous promoters driving transposase
expression are often inefficient (Nagy and Chandler,
2004), induction of neighboring genes up- or downstream
of IS elements on the corresponding DNA strand was
examined. Gene Rmet_6069 on plasmid pMOL30 is inacti-
vated by ISRme15 and is also induced by Pb2+(2.1-fold).
Differential expression could therefore putatively be dri-
ven by the promoter of Rmet_6069 via read-trough tran-
scription. Also Rmet_6072, upstream of ISRme3, was
induced by Pb2+(2.6-fold) and As3+(2.5-fold) (possible
read-trough). For ISRme7 no in-frame stop codon was ob-
served, therefore, the two ISRme7 copies generated trans-
posases of 792 and 1026 aa residues. An oligonucleotide
probe specific to the ISRme7 copy with the transposase of
1026 aa residues did not show any differential expression
after exposure to Cd2+. This indicates that the observed
ISRme7 expression could putatively be driven by the pro-
moter of Rmet_6461 (directly upstream of the other
ISRme7 copy) via read-trough transcription. Unfortunately,
no probe for Rmet_6461 was available. Also partial IS ele-
ments on pMOL30 (see Section 3.6) were affected.
Rmet_5965 and Rmet_5964 were induced by Cd2+, Cu2+
(only Rmet_5965), Ni2+, and Zn2+. Whereas the partial IS
elements (Rmet_5951–Rmet_5952
Rmet_6152) were induced by Cd2+.
These microarrays were performed to identify metal
responsive gene clusters in C. metallidurans CH34 after
exposure to non-lethal concentrations. The observed
expression response of IS-related genes to heavy metals
could therefore be biased due to the used concentration
(well below the minimal inhibitory concentration) or the
metal challenge time of 30 min. It would be interesting
to examine the response of IS-related genes to a metal con-
centration approaching (or above) the minimal inhibitory
concentration. Nevertheless, these results indicate that
exposure to heavy metals could affect expression of trans-
posase genes. Increased expression of certain IS elements
after exposure to metals has already been described.
IS1246 in Pseudomonas putida KT2440 was induced by
Zn2+, Ni2+and Cd2+(Haritha et al., 2009) and insA (IS1) in
E. coli by Zn2+, Co2+and Cd2+(Brocklehurst and Morby,
2000). Also other physical and chemical stresses can
elicit increased expression or transposition frequencies.
Examples are elevated temperature (Ohtsubo et al., 2005;
and Rmet_6153–
Conjugative
module
Accessory
genes
IS1071
Plasmid/phage/GI
maintenance genes
Integrase
module
IS1071
cbb
hyp - hox
IS1071
PCFPCR
PF
PR
CO fixation
2
hydrogenotrophy
9,797 bp15,771 bp17,606 bp 39,509 bp14,369 bp
Fig. 5. Schematic representation of the genomic island CMGI-3 and the copies of IS1071 therein. The different modules of the Tn4371-family island are
represented as boxes. The IS1071 transposase genes and corresponding transcription orientation are shown as large arrows. Primers (small arrows) are
indicated below. The island carries genes involved in CO2fixation (Calvin–Benson–Bassham (CBB) cycle) and hydrogenotrophy (hydrogenase pleiotropic
and hydrogen oxidation genes). The scheme is not drawn to scale.
Table 2
Transcriptomic analysis (via microarrays) of the IS elements in C. metallidurans CH34 under different heavy metal challengesa.
As3+
Cd2+
Co2+
Cr6+
Cs+
Cu2+
Hg2+
Ni2+
Pb2+
Se4+
Sr2+
Zn2+
IS1090
IS1087B
ISRme3
ISRme15
IS1086
IS1088
ISRme8
ISRme5
ISRme7
ISRme19
2.3
0.6c
0.5c
0.5c
1.8b
1.8c
0.6c
1.7c
2.1b
0.5
0.50.5 0.50.50.4
1.7
0.50.60.60.5 0.6 0.4
2.1
2.1 1.8
aOnly metals and IS elements are shown for which at least one oligonucleotide probe showed differential expression with a
fold change <0.6 or >1.7 and an adjusted p-value <0.05.
bFor IS elements with two ORFs it is indicated if the probe was for the catalytic region.
cFor IS elements with two ORFs it is indicated if the probe was for the DNA binding region.
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203
199

Page 8

Tachdjian and Kelly, 2006), irradiation (Eichenbaum and
Livneh, 1998), magnetic fields (Del Re et al., 2003), and
availability of oxygen and nutrients (Tachdjian and Kelly,
2006; Twiss et al., 2005). But also conjugative interactions
can induce transposition (Christie-Oleza et al., 2009). The
C. metallidurans CH34 IS elements affected by heavy metals
belong to different IS families, which could indicate that
common factors are involved. Another interesting observa-
tion is the differential expression of partial IS elements.
One of these fragments belongs to the Tn3 family and is
very similar to ISRme18 but carries a frameshift mutation
in the transposase resulted in two ORFs (Rmet_5951 and
Rmet_5952). A partial IS (comprising Rmet_6153 and
Rmet_6152) is closely related to ISRme15 but has an inter-
nal deletion (30part of orfA and 50part of orfB). Both partial
IS elements were induced by Cd2+while the intact but very
similar ISRme15 and ISRme18 were not induced. This could
be an artifact due to altered mRNA stability or the trun-
cated fragment could actually play a regulatory role, how-
ever, the biological relevance remains to be determined.
3.6. Gene inactivation by IS elements and inactivated IS
elements
At least 32 IS are inserted inside an ORF, thereby inacti-
vating the gene and concurrent gene product. One of the
ISRme3 elements (Rmet_5679/Rmet_5680) inserted in the
gene encoding the pump of a heavy metal tricomponent ef-
flux system (nimBAC). Three insertions were in other IS ele-
ments. An IS5 family element was inactivated by an IS3
family (IS407 sub-family) element, which in turn was inac-
tivated by insertion of ISRme5 (see Section 3.7.4 and Sup-
plementaryText1).ISRme3
inactivated an IS3 family (IS407 sub-family) element. Ele-
ment ISRme19 and ISRme4 (Rmet_0483) inactivated a
site-specific recombinase. Inactivated IS elements were
also identified. An IS1071 copy on pMOL28 was inactivated
by Tn6049 and at least eight fragmented IS elements were
found on pMOL30. Two partial IS elements in pMOL30,
Rmet_5951/Rmet_5952 and Rmet_6153/Rmet_6152, were
similar to ISRme18 and ISRme15, respectively (see Sec-
tion 3.5). Also noteworthy, an IS66 family element was
inactivated by the recently described RIT element com-
posed out of three tyrosine-based site-specific recombi-
nase in tandem (Van Houdt et al., 2009).
(Rmet_3942/Rmet_3943)
3.7. Characterization of IS elements in CH34
In this section, the identified IS elements and their ORFs
will be described according to their (dis)similarities to the
relevant IS family characteristics. The nucleotide se-
quences of the terminal inverted repeats of the IS elements
are shown in Table 3. In addition, some features are high-
lighted below and a full description can be found in sup-
plementary data (see Supplementary Text 2).
3.7.1. ISRme1 and ISRme6 (IS5 family)
ISRme1 carries one ORF, which shares 93% and 91% pro-
tein identity with an IS from C. taiwanensis RALTA and C.
pinatubonensis JMP134, respectively. ISRme6 contains two
ORFs, which do not partially overlap like for most of the
IS427 subgroup members. However, a potential ?1 frame-
shift window (50-GAAAAACTGG-30) was observed at posi-
tion 435, possibly generating an ORF of 271 aa with 76%
protein identity to the fused ORF of ISJP4. The latter ele-
ment was identified in C. pinatubonensis JMP134 where it
inactivates the gene encoding for the transcriptional
regulator TfdT of the chlorocatechol-degradative operon
(Leveau and van der Meer, 1996). ISRme6 was also found
in a cluster of genes for the degradation of aromatic com-
pounds located on genomic island CMGI-2. It disrupts a
glutathione-S-transferase gene often found along with
genesforthedegradation
(Lloyd-Jones and Lau, 1997).
ofaromaticcompounds
3.7.2. ISRme3, ISRme11, ISRme12, ISRme15, ISRme17, IS1087B
(IS3 family)
The 1288 bp ISRme3 element is with 10 copies the most
abundant in CH34. A potential frameshift window (A7
type) was identified in the element, which could reconsti-
tute an orfAB transposase. However, such a fusion protein
was never found in the current database of CH34 proteins
identified under different growth conditions by shotgun
proteome analysis (B. Leroy, pers. comm.). One of the
ISRme3 copies is inserted at the extremity of the genomic
island CMGI-30b, which holds genes involved in the re-
sponse to copper and silver (Mergeay et al., 2009).
Element IS1087 was identified in a spontaneous zinc
resistant mutant of a derivative CH34 strain lacking
pMOL30 (see Section 3.4) (Tibazarwa et al., 2000). DNA se-
quence analysis of the two IS1087 copies present in CH34
revealed a sequence slightly different from IS1087 (Acces-
sion Number AJ243722). This element, with a length of
1330 bp, was denoted IS1087B. IS1087B carries two consec-
utive and partially overlapping ORFs in the relative transla-
tional reading frames 0 and ?1 (a general feature for IS3
members).
3.7.3. ISRme4, ISRme9 and ISRme20 (IS21 family)
ISRme4, ISRme9 and ISRme20 bear the characteristic 50-
CA-30end (Table 3) and have internal repeats in the L and R
end (Supplementary Table 3). ISRme9, located on plasmid
pMOL28, showed the highest similarity (around 70% pro-
tein identity) with IS408 and ISBmu3 from B. multivorans
ATCC17616. These elements, along with other IS identified
in B. multivorans ATCC17616, showed an increased trans-
position frequency under a high-temperature condition of
42 ?C (Ohtsubo et al., 2005).
3.7.4. ISRme5 (IS481 family)
The four copies of this element display transposases
with different lengths since no transposase in-frame stop
codons were observed within the IS. Two copies were lo-
cated in genomic island CMGI-2, which is involved in
hydrogenotrophy and the metabolism of aromatic com-
pounds (Van Houdt et al., 2009), in a region with multiple
transposases and fragments hereof (Fig. 6). Putatively,
ISRme5 assisted integration of the hyp/hox (hydrogenase
pleiotropic and hydrogen oxidation) cluster involved in
hydrogenotrophy in CMGI-2 (see Supplementary Text 1
for complete description of events). This genomic region
illustrates that a first insertion event could attract further
200
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203

Page 9

successive insertion events leading to a region rich in
MGEs and possibly prone to attract advantageous features
carried by the MGEs. The closest relative in a bacterial gen-
ome was found in Brachymonas petroleovorans (65% protein
identity), a recently isolated b-proteobacterium that grows
on cyclohexane (Brzostowicz et al., 2005). However, appar-
ently a 100% identical DNA sequence could be found on
two different DNA scaffolds from the black cottonwood
Table 3
Nucleotide sequences of the terminal inverted repeats of the IS elements in C. metallidurans CH34.
IS elementLeft (LE) and right (RE) IS ends
ISRme4
TGTTGATTTGCACTGAATCCTGACCCACCCACGGCAGGTATTTGCATCGA
TGTTGATTTGCACCGAATCCTGACCCACGATTTGCATCGAAAATTGACCC
TGCGTATTTCGGGGCGCGTGATCAGCGATTTCGGGGGAACGTGATCACCT
TGCGGATTTCGGTGAAGGTGATCAGCGGTTTCGGCGAACGTGATCAGGGA
TGACCCAGCGGCAGCACATTGGATTTGACCCACCCGGGTAGGATGGGCCC
TGACCCTGGGTCAGCGTCAGTTGCTGGCCATCGGTTTCGCCTGACCCAGG
GGGACTGTCGGAGATTTCGTGTTTAAGGCATAACATGCTCCCAAGGAGAA
GGGGGTGTCAGAATTTCCGTGTTCAAGGCGGGTTGAGAATCACACGGATG
TGGACCGGCCAGCCTTTCGTAGACATCTTCGAGCCATAATTTGTGGCAAC
TGGACCGGCCAGAGTTTCATAGACACTCACGAGCCGTTTAGCGCGTAGCG
TGAACTGCACCCCAAAGGTTGGACACCCGTTCAACCTTTGGGGTGTTTTT
TGAACTGACCCCAAGAAGTTGGACAGTTAAGGCGGTAGGCTAAGCCATAG
TGTTGATTTCCACGCAGAACTGACCCGCCGGGGATGCGGACAAAAACTTG
TGTTGATTTCCACCCAGAAGTGACCCACTAGCCCCCGGTGGGGGTGCGGA
TGGAGCGGCCCCTTGAATCTCAGGACACCCGGCACCTCTTACAATAAGAG
TGGAGTTGACCCTGTAACTCAGGACACCCGAACACCGTTAAGTTGATGAT
TGAGCTTGCCCCCGCAAAACGAATCCCTTGCTGAGGTTAAACTGAAGCAA
TGACCTTGCCCCTGTTCCACGAATCCCATAACCGAGGGAATTAGGCAGCC
TGAATCGCCCCGGGTTTTGCGGAGGCTCTCACTCTTGAGAGAATGCGAGC
TGAATCGCCCCGGTTTTCGCGGAGGCTGTTTGGTTAAAGTAAAACGGCCT
GGCGGCCTCAAATCTGAAGTGCAACACCTTGCCATTCGGTAAGGTGTGGT
GGCGGTTTCAAGTGCGAAGCGCAACACCCCTTGGTTATTGAACAGGAAGC
GGCGGCCTCAATTCCGAAGTGCAACACCGAGAATTGAGGCCAAGATGACC
GGCGGTTTCAAGTCCAAGTGCAACAAAAACTCAATGCACTAAATCCGGCT
GCGGTCTCTAGAATGAAGTGCAACACCCTGATGTTAGGGTGTTGGGATGG
GCGGTTTCAAGTCTGAGATGCAACACCAGTTCGTAATTTGTTGATCTCTT
CAATACTGTTCAGATAGTATTTTTAAAGCCATAATCCTCATCCATCGAAG
AAATACTGTTCAGATACGAAGCACCGGCACTGGCTGATGCCGCAAATGGA
TGTCGTGTCCCTGATGATTGGTTAATTGGTTCACGCCGTGGTTTACTCTT
TGTCGTGTCCCGGCTGATTGGTAACACGTCTGTTGAACAGTTCGGGGTGT
CAGGCTGCTGAAATACCGGCAGCGAACGTCAGCGCGACGACTTGCTGAAT
CAGGCTGCTGAAGTACTAGCCGCATAAAAGCGAAGCTTCCCTCTGCAAGG
GAGGCCAGTTCAAAAACCCCTGAGGCGGCTGTTTACTTTCTCGGTAAGCT
GAGGCCAGTTCAAAAAGGCTGCTCCGTACGCCTGAAGATGTTCCAGCAGA
GGTTCTGTCGCGCTAAGGGTGCCGGGGTGAGATTTCAGCAGACATTGCCC
GGTTCTGTCGCGATAAGGCCGGTTGGTCGAAGCCGGTGGGCTGGAGTGCG
GTAAGCGCCCGGTGAACCCGTCTTGAAGGGAAGCAGGAGAGCAAGGAGCA
GTAAGCGCCCGGTGAACCCGTCTCGACGGGGCTACGCAGGAAGGACGGAA
GGGGTCTCCTCGTTTTCAGTGCAATAAGTGACGGTACGCAAAGCTAGCAC
GGGGTCTCCTCGTTTTCAGTGCAATAAGTGACGGTACGAAAAGCTAGCAC
ND
ISRme9
ISRme20
IS1090
ISRme11
ISRme12
ISRme17
IS1087B
ISRme3
ISRme15
IS1086
IS1088
ISRme10
ISRme8
ISRme5
ISRme1
ISRme6
ISRme7
ISRme19
IS1071
ISRme18
LE (top) and RE (bottom) ends of each IS element with the characteristics of the IS family indicated in bold. ND: not
determined.
ISRme5
ISRme5
hyp/hox cluster
TACT
TACT
CCTAAT
CCTAAT
12801301
1302 1303
1304
1279
1278
2,155 bp 15,391 bp 2,260 bp
Fig. 6. Schematic representation of a region of the genomic island CMGI-2 carrying two ISRme5 elements. Genes (Rmet locus tags) and corresponding
transcription orientation are shown as large arrows. Genes highlighted in similar gray shade belong to the same IS element. Black triangles represent the
inverted repeats of ISRme5, gray the IRs of an inactivated IS element. Target sequences that were duplicated are indicated. The region carries genes involved
in hydrogenotrophy. The scheme is not drawn to scale.
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203
201

Page 10

tree, Populus trichocarpa (Tuskan et al., 2006) (NCBI Gen-
ome Biology BLAST). Scaffold 2473 and 3410 aligned
respectively with bp 46–1041 and bp 1–453 from ISRme5.
Since contamination of prokaryotic IS elements in eukary-
otic sequences has been described (Astua-Monge et al.,
2002; Binns, 1993), PCR was performed on genomic DNA
of Populus trichocarpa. Although, a fragment of approxi-
mately 1 kb could be amplified, sequence analysis indi-
cated no similarity to ISRme5 (data not shown).
3.7.5. ISRme7 (IS6 family)
The two copies mismatch 4 bp and no transposase in-
frame stop codons were observed within the IS, generating
transposases with different lengths of 792 and 1026 aa,
respectively. The elements flank the putative genomic is-
land CMGI-11, which contains an operon encoding pro-
teins involved in fimbriae biosynthesis (Van Houdt et al.,
2009).
3.7.6. ISRme18 and IS1071
Element IS1071 was originally identified in transposon
Tn5271 from Alcaligenes sp. BR60 (later C. testosteroni
BR60), which carried genes involved in chlorobenzoate
catabolism (Nakatsu et al., 1991; Sota et al., 2006). Four
copies of this element were identified in CH34, three intact
elements on chromosome 1 in CMGI-3 and one copy on
pMOL28 inactivated by insertion of Tn6049 (Mergeay
et al., 2009; Van Houdt et al., 2009). Compared to IS1071
from C. testosteroni BR60 the element in CH34 carries an
insertion of 3 bp between position 554 and 555, generating
one additional amino acid. Many IS1071 sequences have
been identified next to genes involved in the degradation
of xenobiotics on conjugative plasmids from environmen-
tal bacteria such as Pseudomonas spp. (Martinez et al.,
2001), Comamonas spp. (Boon et al., 2001; Junker and Cook,
1997; Providenti et al., 2006), D. acidovorans (Boon et al.,
2001; Sota et al., 2003), and C. pinatubonensis JMP134
(Clement et al., 2001). Our IScan analysis also revealed
IS1071 sequences in Acidovorax spp. and Burkholderia spp.
Element ISRme18, which is located on pMOL28, was also
identified as a member of the Tn3 family, although the
IRs could not be recognized and therefore ISRme18 could
be an inactive copy. A fragmented IS element similar to
ISRme18 (approximately 90% on DNA sequence) was iden-
tified on pMOL30 (Rmet_5952 and Rmet_5951). Similar
elements were identified in Burkholderia spp. (>60% protein
identity) and in Polaromonas sp. JS666 (54% protein iden-
tity), which is capable of degrading chlorinated ethenes
(Mattes et al., 2008).
4. Conclusions
This study revealed nine new IS elements in C. metalli-
durans CH34. In total, 57 intact IS copies from 21 distinct
IS elements were characterized and classified into 10
different families. A number of these IS elements were
associated with genomic islands, gene inactivation and
rearrangements that alter the autotrophic growth capaci-
ties. The latter provide the first molecular explanation of
the observations associated with TIMM in C. metallidurans.
In addition, differential expression of IS-related genes was
found under heavy metal stress, an environmental stress to
which C. metallidurans CH34 is well adapted. Therefore,
these observations indicate that IS elements play an active
role in C. metallidurans CH34, its metabolic potential and
adaptation under selective pressure.
Acknowledgements
Thanks to Ariane Toussaint, who first suggested to us
that IS could be linked to the mutator phenotype of C.
metallidurans CH34. Thanks to Albert Bossus for isolating
silver resistant C. metallidurans CH34 mutants. Thanks to
Wout Boerjan for kindly providing genomic DNA of Populus
trichocarpa. This work was supported by the European
Space Agency (ESA-PRODEX) and the Belgian Science Pol-
icy (Belspo) through the COMICS project (C90356). Kristel
Mijnendonckx is a PhD student at the Laboratory of Food
and Environmental Microbiology (Université catholique
de Louvain, Belgium), and at the Unit of Microbiology
(SCK?CEN, Belgium). KM is financed through the COMICS
project and an AWM PhD grant from SCK?CEN.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found,intheonline
j.plasmid.2010.12.006.
version, at doi:10.1016/
References
Astua-Monge, G. et al., 2002. Evidence for a prokaryotic insertion-
sequence contamination in eukaryotic sequences registered in
different databases. Theor. Appl. Genet. 104, 48–53.
Bentley, S.D. et al., 2008. Genome of the actinomycete plant pathogen
Clavibacter michiganensis subsp. sepedonicus suggests recent niche
adaptation. J. Bacteriol. 190, 2150–2160.
Bickhart, D.M. et al., 2009. Insertion Sequence content reflects genome
plasticity in strains of the root nodule actinobacterium Frankia. BMC
Genomics. 10, 468.
Binns, M., 1993. Contamination of DNA database sequence entries with
Escherichia coli insertion sequences. Nucleic Acids Res. 21, 779.
Boon, N. et al., 2001. Genetic diversity among 3-chloroaniline- and
aniline-degrading strains of the Comamonadaceae. Appl. Environ.
Microbiol. 67, 1107–1115.
Brim, H. et al., 1999. Amplified rDNA restriction analysis and further
genotypic characterisation of metal-resistant soil bacteria and related
facultative hydrogenotrophs. Syst. Appl. Microbiol. 22, 258–268.
Brocklehurst, K.R., Morby, A.P., 2000. Metal-ion tolerance in Escherichia
coli: analysis of transcriptional profiles by gene-array technology.
Microbiology 146, 2277–2282.
Brzostowicz, P.C. et al., 2005. Proposed involvement of a soluble methane
monooxygenase homologue in the cyclohexane-dependent growth of
a new Brachymonas species. Environ. Microbiol. 7, 179–190.
Choi, K.H. et al., 2006. A 10-min method for preparation of highly
electrocompetent Pseudomonas aeruginosa cells: application for DNA
fragment transferbetween
transformation. J. Microbiol. Methods 64, 391–397.
Christie-Oleza, J.A.et al.,2009.
transposition of ISPst9 in Pseudomonas stutzeri AN10. J. Bacteriol.
191, 1239–1247.
Clement, P. et al., 2001. Molecular characterization of a deletion/
duplication rearrangement in tfd genes from Ralstonia eutropha
JMP134 (pJP4) that improves growth on 3-chlorobenzoic acid but
abolishes growth on 2,4-dichlorophenoxyacetic acid. Microbiology
147, 2141–2148.
Collard, J.M. et al., 1993. A new type of Alcaligenes eutrophus CH34 zinc
resistance generated by mutations affecting regulation of the cnr
cobalt-nickel resistance system. J. Bacteriol. 175, 779–784.
chromosomes andplasmid
Conjugative interactioninduces
202
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203

Page 11

Craig, J.W. et al., 2009. Natural products from environmental DNA hosted
in Ralstonia metallidurans. ACS Chem. Biol. 4, 23–28.
Craig,J.W. etal., 2010.Expanding
metagenomics through parallel
cosmid environmental DNA libraries in diverse proteobacteria. Appl.
Environ. Microbiol. 76, 1633–1641.
DePalmenaer,D.etal.,2008.IS4familygoesgenomic.BMCEvol.Biol.8,18.
Del Re, B. et al., 2003. Extremely low frequency magnetic fields affect
transposition activity in Escherichia coli. Radiat. Environ. Biophys. 42,
113–118.
Diels, L., Mergeay, M., 1990. DNA probe-mediated detection of resistant
bacteria from soils highly polluted by heavy metals. Appl. Environ.
Microbiol. 56, 1485–1491.
Diels, L. et al., 1993. Use of DNA probes and plasmid capture in a search
for new interesting environmental genes. Sci. Total Environ. 140,
471–478.
Dong, Q. et al., 1992. Cloning and sequencing of IS1086, an Alcaligenes
eutrophus insertion element related to IS30 and IS4351. J. Bacteriol.
174, 8133–8138.
Eichenbaum, Z., Livneh, Z., 1998. UV light induces IS10 transposition in
Escherichia coli. Genetics 149, 1173–1181.
Fricke, W.F. et al., 2009. The genome organization of Ralstonia eutropha
strain H16 and related species of the Burkholderiaceae. J. Microbiol.
Biotechnol. 16, 124–135.
Grass, G. et al., 2000. Regulation of the cnr cobalt and nickel resistance
determinant from Ralstonia sp. strain CH34. J. Bacteriol. 182, 1390–
1398.
Haritha, A. et al., 2009. MrdH, a novel metal resistance determinant of
Pseudomonas putida KT2440, is flanked by metal-inducible mobile
genetic elements. J. Bacteriol. 191, 5976–5987.
Hubner, A., Hendrickson, W., 1997. A fusion promoter created by a new
insertionsequence, IS1490,
trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia
AC1100. J. Bacteriol. 179, 2717–2723.
Janssen, P.J. et al., 2010. The complete genome sequence of Cupriavidus
metallidurans strain CH34, a master survivalist in harsh and
anthropogenic environments. PLoS One 5, e10433.
Junker, F., Cook, A.M., 1997. Conjugative plasmids and the degradation of
arylsulfonates in Comamonas testosteroni. Appl. Environ. Microbiol.
63, 2403–2410.
Lejeune, P. et al., 1983. Chromosome transfer and R-prime plasmid
formationmediated byplasmid
Alcaligenes eutrophus CH34 and Pseudomonas fluorescens 6.2. J.
Bacteriol. 155, 1015–1026.
Leveau, J.H., van der Meer, J.R., 1996. The tfdR gene product can
successfully take over the role of the insertion element-inactivated
TfdT protein as a transcriptional activator of the tfdCDEF gene cluster,
which encodes chlorocatechol degradation in Ralstonia eutropha
JMP134(pJP4). J. Bacteriol. 178, 6824–6832.
Leys, N. et al., 2009. The response of Cupriavidus metallidurans CH34 to
spaceflightinthe international
Leeuwenhoek 96, 227–245.
Lin, H. et al., 2007. Characterization of the variants, flanking genes, and
promoter activity of the Leifsonia xyli subsp. cynodontis insertion
sequence IS1237. J. Bacteriol. 189, 3217–3227.
Lloyd-Jones, G., Lau, P.C., 1997. Glutathione S-transferase-encoding gene
as a potential probe for environmental bacterial isolates capable of
degrading polycyclicaromatic
Microbiol. 63, 3286–3290.
Mahillon, J., Chandler, M., 1998. Insertion sequences. Microbiol. Mol. Biol.
Rev. 62, 725–774.
Martinez, B. et al., 2001. Complete nucleotide sequence and organization
of the atrazine catabolic plasmid pADP-1 from Pseudomonas sp. strain
ADP. J. Bacteriol. 183, 5684–5697.
Mathee, K. et al., 2008. Dynamics of Pseudomonas aeruginosa genome
evolution. Proc. Natl. Acad. Sci. USA 105, 3100–3105.
Mattes, T.E. et al., 2008. The genome of Polaromonas sp. strain JS666:
insights into the evolution of a hydrocarbon- and xenobiotic-
degrading bacterium, and features of relevance to biotechnology.
Appl. Environ. Microbiol. 74, 6405–6416.
Mergeay, M. et al., 1985. Alcaligenes eutrophus CH34 is a facultative
chemolithotroph with plasmid-bound resistance to heavy metals. J.
Bacteriol. 162, 328–334.
Mergeay, M. et al., 1987. High-level spontaneous mutagenesis revealed by
survival at nonoptimal temperature in Alcaligenes eutrophus CH34.
Arch. Int. Physiol. Biochim. 95, B36.
Mergeay, M. et al., 2003. Ralstonia metallidurans, a bacterium specifically
adapted to toxic metals: towards a catalogue of metal-responsive
genes. FEMS Microbiol. Rev. 27, 385–410.
small-molecule
screening
functional
ofbroad-host-range
activatestranscriptionof 2,4,5-
pULB113 (RP4-mini-Mu)in
spacestation. AntonieVan
hydrocarbons.Appl. Environ.
Mergeay, M. et al., 2009. Megaplasmids in Cupriavidus genus and metal
resistance. In: Schwartz, E. (Ed.), Microbial Megaplasmids, vol. 11.
Springer, Berlin.
Mira, A. et al., 2002. Microbial genome evolution: sources of variability.
Curr. Opin. Microbiol. 5, 506–512.
Monchy, S. et al., 2007. Plasmids pMOL28 and pMOL30 of Cupriavidus
metallidurans are specialized in the maximal viable response to heavy
metals. J. Bacteriol. 189, 7417–7425.
Nagy, Z., Chandler, M., 2004. Regulation of transposition in bacteria. Res.
Microbiol. 155, 387–398.
Nakatsu, C. et al., 1991. Chlorobenzoate catabolic transposon Tn5271 is a
composite class I element with flanking class II insertion sequences.
Proc. Natl. Acad. Sci. USA 88, 8312–8316.
Nelson, M.J. et al., 1987. Biodegradation of trichloroethylene and
involvement of an aromatic biodegradative pathway. Appl. Environ.
Microbiol. 53, 949–954.
Ohtsubo, Y. et al., 2005. High-temperature-induced transposition of
insertion elements in Burkholderia multivorans ATCC 17616. Appl.
Environ. Microbiol. 71, 1822–1828.
Providenti, M.A. et al., 2006. The locus coding for the 3-nitrobenzoate
dioxygenase of Comamonas sp. strain JS46 is flanked by IS1071
elements and is subject to deletion and inversion events. Appl.
Environ. Microbiol 72, 2651–2660.
Rice, P. et al., 2000. EMBOSS: the European Molecular Biology Open
Software Suite. Trends Genet. 16, 276–277.
Schleheck, D. et al., 2004. Mineralization of individual congeners of linear
alkylbenzenesulfonate by defined pairs of heterotrophic bacteria.
Appl. Environ. Microbiol. 70, 4053–4063.
Schneider, D., Lenski, R.E., 2004. Dynamics of insertion sequence elements
during experimental evolution of bacteria. Res. Microbiol. 155, 319–
327.
Schneider, D. et al., 2000. A broad-host-range plasmid for isolating mobile
genetic elements in Gram-negative bacteria. Plasmid 44, 201–207.
Siguier, P. et al., 2006. ISfinder: the reference centre for bacterial insertion
sequences. Nucleic Acids Res. 34, D32–D36.
Sota, M. et al., 2003. Structure of haloacetate-catabolic IncP-1b plasmid
pUO1 and genetic mobility of its residing haloacetate-catabolic
transposon. J. Bacteriol. 185, 6741–6745.
Sota, M. et al., 2006. Functional analysis of unique class II insertion
sequence IS1071. Appl. Environ. Microbiol. 72, 291–297.
Tachdjian, S., Kelly, R.M., 2006. Dynamic metabolic adjustments and
genome plasticity are implicated in the heat shock response of the
extremely thermoacidophilic archaeon Sulfolobus solfataricus. J.
Bacteriol. 188, 4553–4559.
Taghavi, S. et al., 1997. Genetic and physical maps of the Alcaligenes
eutrophus CH34 megaplasmid pMOL28 and its derivative pMOL50
obtained after temperature-induced mutagenesis and mortality.
Plasmid 37, 22–34.
Talat, M.-e.-, 2000. Genetic mechanism of heavy metal resistance of
Pseudomonas aeruginosa CMG103. University of Karachi, Karachi.
Tibazarwa, C. et al., 2000. Regulation of the cnr cobalt and nickel
resistance determinant of Ralstonia eutropha (Alcaligenes eutrophus)
CH34. J. Bacteriol. 182, 1399–1409.
Top, E. et al., 1994. Exogenous isolation of mobilizing plasmids from
polluted soils and sludges. Appl. Environ. Microbiol. 60, 831–839.
Touchon, M., Rocha, E.P., 2007. Causes of insertion sequences abundance
in prokaryotic genomes. Mol. Biol. Evol. 24, 969–981.
Tuskan, G.A. et al., 2006. The genome of black cottonwood, Populus
trichocarpa (Torr & Gray). Science 313, 1596–1604.
Twiss, E. et al., 2005. Transposition is modulated by a diverse set of host
factors in Escherichia coli and is stimulated by nutritional stress. Mol.
Microbiol. 57, 1593–1607.
Vallenet, D. et al., 2006. MaGe: a microbial genome annotation system
supported by synteny results. Nucleic Acids Res. 34, 53–65.
Van der Auwera, G.A. et al., 2009. Plasmids captured in C. metallidurans
CH34: defining the PromA family of broad-host-range plasmids.
Antonie Van Leeuwenhoek 96, 193–204.
van der Lelie, D. et al., 1992. Stress and survival in Alcaligenes eutrophus
CH34: effects of temperature and genetic rearrangements. In:
Gauthier, M.J. (Ed.), Gene Transfers and Environment. Springer-
Verlag, Heidelberg.
Van Houdt, R. et al., 2009. New mobile genetic elements in Cupriavidus
metallidurans CH34, their possible roles and occurrence in other
bacteria. Antonie Van Leeuwenhoek 96, 205–226.
Wagner, A. et al., 2007. A survey of bacterial insertion sequences using
IScan. Nucleic Acids Res. 35, 5284–5293.
Yang, F. et al., 2010. Biosequestration via cooperative binding of copper by
Ralstonia pickettii. Environ. Technol. 31, 1045–1060.
K. Mijnendonckx et al./Plasmid 65 (2011) 193–203
203