Toxic response caused by a misfolding variant of the mitochondrial protein short-chain acyl-CoA dehydrogenase.

Abstract

Variations in the gene ACADS, encoding the mitochondrial protein short-chain acyl CoA-dehydrogenase (SCAD), have been observed in individuals with clinical symptoms. The phenotype of SCAD deficiency (SCADD) is very heterogeneous, ranging from asymptomatic to severe, without a clear genotype-phenotype correlation, which suggests a multifactorial disorder. The pathophysiological relevance of the genetic variations in the SCAD gene is therefore disputed, and has not yet been elucidated, which is an important step in the investigation of SCADD etiology.
To determine whether the disease-associated misfolding variant of SCAD protein, p.Arg107Cys, disturbs mitochondrial function.
We have developed a cell model system, stably expressing either the SCAD wild-type protein or the misfolding SCAD variant protein, p.Arg107Cys (c.319 C > T). The model system was used for investigation of SCAD with respect to expression, degree of misfolding, and enzymatic SCAD activity. Furthermore, cell proliferation and expression of selected stress response genes were investigated as well as proteomic analysis of mitochondria-enriched extracts in order to study the consequences of p.Arg107Cys protein expression using a global approach.
We found that expression of the p.Arg107Cys variant SCAD protein gives rise to inactive misfolded protein species, eliciting a mild toxic response manifested though a decreased proliferation rate and oxidative stress, as shown by an increased demand for the mitochondrial antioxidant SOD2. In addition, we found markers of apoptotic activity in the p.Arg107Cys expressing cells, which points to a possible pathophysiological role of this variant protein.

Full text

Page 1

ORIGINAL ARTICLE
Toxic response caused by a misfolding variant
of the mitochondrial protein short-chain
acyl-CoA dehydrogenase
Stinne P. Schmidt & Thomas J. Corydon & Christina B. Pedersen & Søren Vang &
Johan Palmfeldt & Vibeke Stenbroen & Ronald J. A. Wanders & Jos P. N. Ruiter &
Niels Gregersen
Received: 12 September 2010 /Revised: 21 November 2010 /Accepted: 24 November 2010 /Published online: 18 December 2010
# The Author(s) 2010. This article is published with open access at Springerlink.com
Abstract
Background Variations in the gene ACADS, encoding the
mitochondrial protein short-chain acyl CoA-dehydrogenase
(SCAD), have been observed in individuals with clinical
symptoms. The phenotype of SCAD deficiency (SCADD) is
very heterogeneous, ranging from asymptomatic to severe,
without a clear genotype–phenotype correlation, which
suggests a multifactorial disorder. The pathophysiological
relevance of the genetic variations in the SCAD gene is
therefore disputed, and has not yet been elucidated, which is
an important step in the investigation of SCADD etiology.
Aim To determine whether the disease-associated misfold-
ing variant of SCAD protein, p.Arg107Cys, disturbs
mitochondrial function.
Methods We have developed a cell model system, stably
expressing either the SCAD wild-type protein or the misfold-
ing SCAD variant protein, p.Arg107Cys (c.319 C>T). The
model system was used for investigation of SCAD with
respect to expression, degree of misfolding, and enzymatic
SCAD activity. Furthermore, cell proliferation and expression
of selected stress response genes were investigated as well as
proteomic analysis of mitochondria-enriched extracts in order
to study the consequences of p.Arg107Cys protein expression
using a global approach.
Conclusions We found that expression of the p.Arg107Cys
variant SCAD protein gives rise to inactive misfolded
protein species, eliciting a mild toxic response manifested
though a decreased proliferation rate and oxidative stress,
as shown by an increased demand for the mitochondrial
antioxidant SOD2. In addition, we found markers of
apoptotic activity in the p.Arg107Cys expressing cells,
which points to a possible pathophysiological role of this
variant protein.
Abbreviations
SCAD
Wt
Ut
CLSM
MFN
BAX
Short-chain acyl-CoA dehydrogenase
Wild-type
Untransduced cells
Confocal laser scanning microscopy
Mitofusin
BCL2-associated X protein
Communicated by: Ertan Mayatepek
Competing interest: None declared.
Electronic supplementary material The online version of this article
(doi:10.1007/s10545-010-9255-7) contains supplementary material,
which is available to authorized users.
S. P. Schmidt (*):C. B. Pedersen:S. Vang:J. Palmfeldt:
V. Stenbroen:N. Gregersen
Research Unit for Molecular Medicine, Aarhus University
Hospital, Skejby,
Brendstrupgaardsvej,
8200 Aarhus N, Denmark
e-mail: stinne@ki.au.dk
T. J. Corydon
Department of Human Genetics, Aarhus University,
Aarhus N, Denmark
R. J. A. Wanders:J. P. N. Ruiter
Lab. Genetic Metabolic Diseases, Department of Clinical
Chemistry and Pediatrics, Academic Medical Center,
University of Amsterdam,
Amsterdam, The Netherlands
Present Address:
C. B. Pedersen:S. Vang
Department of Molecular Medicine, Aarhus University Hospital,
Skejby,
Brendstrupgaardsvej 100,
8200 Aarhus N, Denmark
J Inherit Metab Dis (2011) 34:465–475
DOI 10.1007/s10545-010-9255-7

Page 2

VDAC
SOD2
HO-1
Hsp
mtHsp
SCADD
CNS
EMA
PRDX6
iTRAQ
Voltage dependent anion channel
Superoxide dismutase 2
Heme oxygenase 1
Heat shock protein
Mitochondrial heat shock protein
SCAD deficiency
Central nervous system
Ethyl malonic acid
Peroxiredoxin 6
Isobaric tag for relative and absolute
quantitation
Sodium dodecyl sulfate–polyacrylamide
gel electrophoresis
SDS-PAGE
Introduction
Short-chain acyl-CoA dehydrogenase (SCAD) is the initi-
ating enzyme in the mitochondrial β-oxidation of short-
chain fatty acids (Ikeda et al 1985). Like the majority of
mitochondrial proteins, SCAD is translated in the cytosol
and subsequently transferred to the mitochondria, where it
is folded to its native structure with the aid of the
mitochondrial chaperonin Hsp60/Hsp10 (Pedersen et al
2003; Corydon et al 2005). SCAD is a flavoenzyme and
functions in its active conformation as a homotetramer in
complex with the cofactor FAD (flavine adenine dinucleo-
tide). Variations in the SCAD gene, ACADS (MIM
*606885), have been found to be associated with elevated
urinary excretions of ethylmalonic acid (EMA) derived
from detoxification of the accumulated substrate of SCAD,
butyryl-CoA (Hegre et al. 1959), as well as clinical
symptoms, known as SCAD deficiency (SCADD)
(Pedersen et al 2008; Waisbren et al 2008). However, the
pathophysiological relevance of ACADS variations must be
further elucidated, based on the heterogeneity of clinical
symptoms associated with ACADS variations, and the lack
of a clear genotype–phenotype correlation with outcomes
ranging from very severe to asymptomatic (van Maldegem
et al 2006; Jethva and Ficicioglu 2008; Pedersen et al 2008;
Waisbren et al 2008).
Disease-associated variations of the SCAD protein have
been shown to be unstable and the process of folding
impaired (Corydon et al 1998; Pedersen et al 2003, 2008).
Protein misfolding is involved in a variety of diseases, and
the research in this field is large and still expanding due to
the fact that a number of major neurodegenerative disor-
ders, e.g., Alzheimer’s disease, Parkinson’s disease, and
Huntington’s disease, are members of the group of protein
conformational diseases (Kopito and Ron 2000; Stefani and
Dobson 2003). Accumulated misfolded proteins have been
shown to exert a toxic cellular effect leading to oxidative
stress (Behl et al 1994; Hsu et al 2000; Gregersen et al
2006; Lin and Beal 2006; Gregersen and Bross 2010) and
cell death (Nakamura and Lipton 2009), but the main
pathogenic factors of misfolded proteins have not yet been
elucidated.
In order to investigate putative factors involved in the
pathology of disease associated with a misfolding variation
in the ACADS gene, we have studied the variant SCAD
protein p.Arg107Cys (c.319 C>T). This variation has
previously been shown to compromise protein folding in
isolated mouse mitochondria (Kragh et al 2007; Pedersen et
al 2008) and lack of activity in patient fibroblasts (Tein et al
1999). It is primarily observed in the Ashkenazi Jewish
population, with heterogeneous clinical symptoms, though
predominantly defined by neuromuscular symptoms (Tein
et al 2008; Waisbren et al 2008).
When transiently overexpressed in human astrocytes, we
have previously shown that SCAD p.Arg107Cys protein
elicits a toxic response by disturbing normal mitochondrial
function, visualized through a disruption of the normal
dynamic equilibrium of fission and fusion of the mitochon-
drial reticulum, accompanied by oxidative stress (Schmidt
et al 2010).
In the present study, we have further investigated the
SCAD variant protein p.Arg107Cys using a cell model
system stably expressing either the wild-type SCAD protein
or the p.Arg107Cys variant protein. In order to elucidate
whether this disease-associated variant of SCAD could be
involved in the pathophysiology of SCADD, we measured
the ACADS gene expression, SCAD protein folding/
misfolding, SCAD enzyme activity, cell proliferation, and
expression of selected stress response genes, in addition to
a global approach using quantitative nanoLC-MS/MS
proteomic analysis. We report the cellular consequences of
stable overexpression of the disease-associated p.
Arg107Cys variant of SCAD, including a decreased
proliferation rate, increased levels of antioxidants, as well
as markers of apoptosis. Taken together, these results show
that this misfolded protein is capable of disturbing
mitochondrial function.
Materials and methods
Cell culturing
The virus packaging cell lines GP+E86 (Mus musculus,
ATCC # CRL-9642), PG13 (Mus musculus, ATCC # CRL-
10686) and the host cell line A172 (Homo sapiens, ATCC #
CRL-1620), were cultivated in Dulbecco’s Modified
Eagle’s Medium (DMEM) (Gibco-BRL, Life Technologies)
supplemented with 10 % (v/v) fetal calf serum (Biological
466J Inherit Metab Dis (2011) 34:465–475

Page 3

Industries), 0.29 mg/ml glutamine, 100 units/ml penicillin
(Leo Pharmaceutical), and 0.1 mg/ml streptomycin (Leo
Pharmaceutica). The cell lines were incubated at 37°C, or
40°C for heat shock experiments, at 5% (v/v) CO2.
Transduction
SCAD Wt or the variant c.319 C<T (p.Arg107Cys) cDNA
was cloned into the retroviral vector pBabe-puro
(Morgenstern and Land 1990). An ecotropic packaging cell
line, GP+E86 (ATCC, CRL-9642) was seeded with 2/3 x
106cells in a 25-cm2culture flask (TPP). After 24 h, the
cells were transfected with the pBabe-puro constructs by
calcium phosphate co-precipitation. Briefly, 15 μg plasmid
DNA was diluted in buffer A (0.15 M NaCl, 1 mM EDTA,
0.01 M tris-HCl, pH 7.5) and 0.25 M CaCl (Total volume
of 280 μl). The mixture was carefully added to 280 μl T×
buffer (0.05 M Hepes pH 7.1, 0.25 M NaCl, 1.5 mM
Na2HPO4/Na2PO4), and the precipitate was allowed to form
for 30 min at room temperature. The GP+E86 cells were
administered with 5 ml new DMEM medium and added to
the 560 μl transfection mixture. After 4 h of transfection at
37°C, the cells were administered with 5 ml new DMEM
medium.Twenty-fourhours later, the mediumwas exchanged
with 2 ml fresh medium, which was harvested 24 h later,
supplemented with polybrene, 8 μg/ml (Sigma), and sterile-
filtered through a 0.45-μm filter (Millipore, MA, USA). The
virus-enriched medium was used in the transduction of an
amphotropic packaging cell line, PG13, by centrifugation of
plates 30 min at 32°C at 1,000g, and incubated at 37°C
overnight. The A172 cells were transduced as above, now
using virus-enriched PG13 medium, diluted 102, 103, and
104times to ensure a low viral titer, and consequently a low
copy number integrated. After a selection period of 14 days,
using conditioned medium with 2 μg/ml puromycin, clones
were picked from the plates with the least colonies, and
transferred to isolated 6-well culture plates for amplification.
mRNA expression levels
RNAwas isolatedusing the PerfectPureRNA culturedcellkit
(5Prime). cDNAwas synthesized from 1 μg RNA using “1st-
strand” cDNA Synthesis Kit (Clontech, Palo Alto, CA, USA)
accordingtomanufacturer’sinstructions.mRNAtranscription
levels were measured in triplicates using the TaqMan®Gene
expression assay on an ABI PRISM®7000 Sequence
Detection System (Applied Biosystems, Foster City, CA,
USA). Sequences of the forward primer, reverse primer, and
probes used in each assay were: SCAD; 5′CGCCCCTCAC
CAAGCT3′, 5′GGCCAGGGCCATGTCT3′, and 5′CAGGT
CATCCAGTTCAAG3′.
GGCTTGCAAAACTTTCAGATGGA3′, 5′GGCATCTG
TAACTCTGTCTTTCTTTTCA3′, and 5′TCCCACCA
Hsp60(HSPD1);5′
ACCTTCAGCAC3′. HO-1 (HMOX1); 5′CCAGCGGGC
CAGCAA3′, 5′GGGAGCGGGTGTTGAGT 3′, and 5′
CAAAGTGCAAGATTCTG 3′. β-actin (ACTB
#4310881E), Hps70 (HSPA1A, #Hs00271244_s1), and
SOD2 (#Hs00167309_m1) geneexpression assays were
manufactured by Applied Biosystems. The probe used in
the β-actin assay was conjugated to a VIC™ fluorescent
label at the 5′ end, while probes of the remaining assays
were conjugated to a 6-FAM™ dye. All probes contained a
non-fluorescent quencher at the 3′ end.
The measurements were performed on cell cultivations
performed in triplicates at 3 separate days (i.e. nine
cultivations and mRNA expression studies performed for
each clone). Statistical analysis was performed with an
analysis of variance test (ANOVA), with a stochastic level
for each observation.
Western blotting
SDS-PAGE: Cell pellets were incubated 30 min in
lysisbuffer on ice [50 mM Tris-HCl, pH 7.8. 5 mM EDTA,
pH 8.0, 1 mM DTT, 10 μg/ml Aprotinin (Sigma-Aldrich),
1 mg/ml trypsin inhibitor (Bie & Berntsen), tablet of
protease inhibitors (Roche) in 10 ml, and 0.5% Triton X-
100], followed by three times freeze/thaw and 40 sec of
sonication (Branson, Ultrasonic cleaner). The lysate was
separated into Triton X-100 soluble and insoluble fractions by
15 min of centrifugation at 10,000g, 4°C. Ten μg of the
soluble protein fraction, as well as equal volume of the
insoluble fraction, was subjected to SDS-PAGE gel electro-
phoresis on 12.5% Tris-HCl Criterion pre-cast gels (Bio-Rad).
Proteins were blotted onto a PVDF membrane (Immobilon-
P™, Millipore, 0.45 μm) by semi-dry electro-blotting (2117
Multiphor II, Pharmacia) at 220 mA for 45 min. Native-
PAGE: As with SDS-PAGE, except the lysis-buffer contains
250 mM sucrose. Then, 15 μg total protein lysate was loaded
on a 4–15% Tris-HCl Criterion pre-cast gel (Bio-Rad). In the
blotting procedure, 0.1% v/v SDS was added to the transfer
buffer, and blotting was carried out at 110 mA for 90 min.
The PVDF membranes were incubated 1 h in 5% non-fat
skim milk (Difco), and further 24 h with polyclonal rabbit
anti-SCAD antibodies (Ikeda et al 1985), following 1 h
with secondary goat anti-rabbit-HRP antibodies (Dako). For
detection of protein, ECL plus Western Blotting Detection
System (Amersham Biosciences) was used, according to
manufacturer’s recommendations, and visualized by Phos-
phor Imaging (STORM 840, Molecular Dynamics). Statis-
tical analysis was performed using a t test.
Immunolocalization
Cells were incubated 30 min at 37°C with 100 nM
MitoTracker®Red CMXRos probe (Molecular Probes) at
J Inherit Metab Dis (2011) 34:465–475 467

Page 4

30% confluence in 10-cm2slideflasks (Nunc, Roskilde,
Denmark), followed by fixation in 1.5 ml 4% (w/v)
paraformaldehyde (Merck). Slides were incubated with
primary polyclonal anti-SCAD antibodies (Ikeda et al
1985) for 1 h, and subsequently 1 h with secondary Alexa
488-labeled goat anti-rabbit IgG antibodies (Molecular
Probes). Cells were treated for 20 min with 1 mg/ml RNase
A (Roche), and nuclear labeling was carried out using
1 μM TO-PRO-3 iodide (Molecular Probes). A drop of
SlowFade®Golden antifade reagent (Molecular Probes)
was added before imaging by confocal laser scanning
microscopy, using a Leica TCS SL microscope. Imaging
was done by using a 488-nm line of a multiline argon laser
(detection of Alexa-488), the 543-nm line of a green
helium-neon laser (detection of MitoTracker Red
CMXRos), and the 633-nm line of a red helium–neon laser
(detection of TO-PRO-3).
Activity measurements
Cell pellets were homogenized and sonicated in PBS plus
50 μmol/l flavin adenine dinucleotide (FAD). The protein
concentration was adjusted to 2 mg/ml, and 10 μl was
incubated at 37°C in medium, containing 200 mmol/l Tris-
HCl (pH 8.0), 50 μmol/l FAD, 400 μmol/l ferricenium
hexafluorophosphate, 25 μmol/l butyryl-CoA, and
200 μmol/l isovaleryl-CoA (to eliminate unspecific con-
version of butyryl-CoA by the isovaleryl-CoA dehydroge-
nase enzyme). The reaction was terminated by adding HCl
to a final concentration at 200 mmol/l. After centrifugation,
the supernatant was neutralized with 2 mol/l KOH and
600 mmol/l morpholinoethane sulfonic acid (MES), and
acyl-CoA esters were resolved by HPLC followed by
calculation of reaction rates from the amount of crotonyl-
CoA and 3-hydroxybutyryl-CoA formed (Bok et al 2003).
By performing parallel reactions, supplemented with anti-
SCAD antibodies, the calculations were corrected for
unspecific 3-hydroxybutyryl-CoA production. All measure-
ments were performed in triplicates, and expressed as nmol
per minute per milligram total protein. Statistical analysis
was performed using a t-test.
Mitochondrial enrichments
Each cell line was cultivated in triplicates, and pelleted into
three pools of the clones Wt 1–3, three pools of the p.
Arg107Cys expressing clones 1–3, as well as three pools of
untransfected cells. Cell pellets (each corresponding to cells
from three 150-cm2culture flask (TPP)) were resuspended
in 11 ml hypotonic RSB buffer (10 mM NaCl, 1.5 mM
MgCl2) and cells were allowed to swell for 15 min before
disruption of the cellular membrane with 20 strokes in an
ice-cold 15-ml Dounce homogenizer, using pestle B.
Immediately after, 8 ml 2.5 x MS-buffer (210 mM
mannitol, 70 mM sucrose, 5 mM Tris-HCl (pH 7.5),
1 mM EDTA (pH 7.5)) were added to attain an isotonic
solution. After addition of 10 ml 1 × MS-buffer, mitochon-
drial enrichments were performed using differential centri-
fugation (10 min, 750g, repeated twice, supernatant
centrifuged 15 min, 10,000g). All steps performed at 4°C
or on ice.
Proteomic analyses
For large-scale relative quantification of proteins in samples
enriched for mitochondria, iTRAQ (isobaric tag for relative
and absolute quantitation) was applied. The analyses and
data treatment were performed as previously described
(Palmfeldt et al 2009) applying nano-liquid chromatogra-
phy (Easy nLC; Proxeon, Odense, Denmark) separation
coupled to tandem mass spectrometry (MS/MS) detection
(LTQ Orbitrap; Thermo Fisher Scientific, Waltham, USA).
The analyses were performed in triplicate starting with
material from three separate cultivations. In each iTRAQ
analysis, the relative amounts between the three samples;
Wt, p.Arg107Cys, and untransduced, were determined for
each protein. The samples were analyzed in duplicate on
nanoLC-MS/MS and data from the two analyses were
merged, giving increased robustness to the quantification.
Proteins were reported to have statistically altered levels
when they passed two criteria (1) two-tailed student t test
(p<0.05, n=3) and (2) a threshold test, based on 2 × global
standard error, requiring at least 11.6% altered level.
Proliferation study
Samples of 250,000 cells of each clone were seeded into
25-cm2culture flask (TPP). Cell numbers were evaluated
using the Nucleocounter, Chemometec, according to man-
ufacturers’ recommendations. Measurements performed on
37°C cell cultivations were performed once for each clone,
and statistical analyses were performed using a t test.
Measurements performed on 40°C cell cultivations were
performed in triplicates (i.e. three cultivations for each
clone), and statistical analyses were performed with an
analysis of variance test (ANOVA), with a stochastic level
for each observation.
Results
Considering the neuromuscular symptoms of patients with
variations in the ACADS gene, we have chosen to study the
effects of p.Arg107Cys SCAD protein in human astrocytes.
The astrocyte cell type is the only cell type in the central
nervous system (CNS) which harbors the enzymes of the
468J Inherit Metab Dis (2011) 34:465–475

Page 5

mitochondrial β-oxidation, and is thus the expected CNS cell
type to be affected by the proposed accumulations of
misfolded SCAD proteins (Auestad et al 1991; Ebert et al
2003). A human cell line stably expressing the SCAD wild-
type (Wt) or the variant p.Arg107Cys protein was developed
by retroviral transduction of the astrocytic cell line A172
(American Type Culture Collection # CRL-1620). A172 cells
have the advantage of a downregulated ACADS expression
and therefore do not express SCAD protein endogenously. In
order to minimize SCAD overexpression of the transduced
A172 cells, a low viral titer was utilized in the transduction
experiments to diminish the number of cells receiving more
than one copy of the ACADS cDNA. To circumvent differ-
ences between Wt and p.Arg107Cys expressing cells to be
caused by different integration sites, several transduced
clones of each cDNA type were established.
SCAD mRNA expression levels were quantified in all
clones, relative to β-actin. To be able to compare the
phenotypic outcome, three Wt clones (Wt 1–3) and three p.
Arg107Cys clones (p.Arg107Cys 1–3) from each transduc-
tion experiment were selected based on comparable SCAD
mRNA transcription levels (Fig. 1a; t test performed on
mean values, p=0.83). In addition, we evaluated the SCAD
protein products from the six selected clones by SDS-
PAGE followed by western blotting of cellular lysates,
using anti-SCAD antibody (Fig. 1b). Quantitative SCAD-
protein analysis of monomeric SCAD protein amounts in
three independent cell cultures of each clone revealed that
the three p.Arg107Cys expressing clones (black bars)
contain approximately half the amount of steady state level
SCAD protein, compared with the Wt (white bars, t test
performed on mean values, p<0.01). Subsequently, mito-
chondrial concentrations of SCAD protein were visualized
by confocal laser scanning microscopy (CLSM), using the
mitochondrial-targeted probe MitoTracker Red CMXRos
and anti-SCAD antibody, showing a decreased amount of
SCAD protein in the p.Arg107Cys expressing cells com-
pared with Wt expressing cells. Correct localization of the
introduced SCAD protein in the mitochondria was con-
firmed by merging anti-SCAD image (green color) with
MitoTracker (red), rendering a yellow color when colocal-
ized. Fig. 2 shows an example of one Wt and one p.
Arg107Cys expressing clone.
Native-PAGE analysis was subsequently used to inves-
tigate whether the SCAD proteins were properly folded to
the native tetrameric form (Fig. 3a). The blot shows an
intense band corresponding to Wt tetrameric SCAD (lanes
1–3), whereas the corresponding band of the variant protein
is weak (lanes 4–6), close to the level of the untransduced
cells (Ut, lane 7). We next analyzed the Wt and the p.
Arg107Cys expressing clones, as well as the untransduced
cell line for SCAD enzyme activity (Fig. 3b). The enzyme
activity of the SCAD Wt transduced cells was increased as
expected, but the enzyme activity of the p.Arg107Cys
transduced cells was close to the background levels of the
untransduced cells (Ut). This is in accordance with the
lowered SCAD-protein tetramer levels detected by the
immunoblot analysis (Fig. 3a).
To examine whether these misfolded inactive protein
variants elicit an effect on the cells, a proliferation study
Fig. 1 SCAD mRNA and protein expression levels. a Quantitative
PCR performed on cDNA from three selected Wt clones (white
circles) and three p.Arg107Cys clones (black circles). The SCAD
transcription is represented relative to β-actin and normalized to the
Wt-1 clone. Error bars reflect the standard deviations of three
measurements on the same cDNA pool of each clone. A t test on
the mean values of each clone revealed no difference in the SCAD
mRNA expression-levels between the Wt and p.Arg107Cys express-
ing cells (p=0.83). The vertical bar represents the mean value of the
three clones. b SDS-PAGE and western blot of the selected clones.
The schematic diagram is depicting the mean and standard deviation
of three independent cell-culture flasks, by quantitation of the blot,
and normalized to the Wt-1 clone. Error bars reflect standard
deviations of triplicate cell cultivations of each clone (to be seen on
the western blot). A t test performed on the mean values of each clone
showed a statistically significant difference in the SCAD protein-
levels between Wt and p.Arg107Cys expressing cells (*p=0.0016).
No SCAD bands were detected by western blotting of untransduced
cells (data not shown)
J Inherit Metab Dis (2011) 34:465–475469

Page 6

was performed (Fig. 4). Preliminarily, 250,000 cells of each
clone were seeded in 25-cm2culture flasks, resulting in
approximately 25% confluence, and the number of cells
was evaluated after 3 and 7 days, respectively. At 37°C, the
mean cell number of the three Wt clones (white marks) was
found to be consistently higher than the p.Arg107Cys
expressing clones (black marks), which points to an
inhibited growth of the p.Arg107Cys expressing cell lines,
compared with the Wt-expressing cells (Fig. 4a). Protein
unfolding and misfolding is known to be exacerbated at
higher temperatures. In order to test possible differences in
how the cells respond to stress, the proliferation study was
repeated in triplicate in cells grown at 40°C (Fig. 4b). At
40°C, proliferation was inhibited in both cell lines,
compared with 37°C. Importantly, all six clones revealed
a complete stop in cell division after 3 days of heat stress,
following a reduction in cell number up to day 7, indicating
cell death. As with the proliferation curves at 37°C, the
proliferation curves of cells grown at 40°C show a
significantly slower proliferation rate in the p.Arg107Cys
expressing clones compared with the SCAD Wt expressing
clones. The difference between the Wt and the p.
Arg107Cys expressing clones was nevertheless not en-
hanced by heat stress (differences at day 3, p=0.025 and
p=0.013, and at day 7 ,p=0.021 and p=0.031 at 37 and
40°C, respectively). To further study the effect of heat
stress, one Wt-expressing clone as well as one p.
Arg107Cys expressing clone were subjected to growth at
40°C, and harvested at eight time points over a period of
45 h. This preliminary study was carried out to find
Fig. 2 SCAD colocalizes with
the mitochondria. Confocal laser
scanning microscopy of a Wt
and a p.Arg107Cys expressing
clone after immunolabeling with
anti-SCAD antibody (green
color) and MitoTracker Red
CMXRos (red color). The
image is a representative
example of one of each clone,
confirming colocalization of the
exogenic SCAD protein with the
mitochondria
Fig. 3 Tetramerization and activity measurements. a Native-PAGE of
Wt and p.Arg107Cys expressing clones, as well as of untransduced
cells (Ut). The blot shows an impaired tetramerization ability of the p.
Arg107Cys proteins. tSCAD tetrameric SCAD, *unspecific protein
signals witnessing of equal protein loading. b SCAD enzyme activity
measurements, expressed in nmol/min/mg total protein. Error bars
reflect the standard deviation of three activity measurements on the
same protein lysate. A t test on the mean values show a significant
difference in SCAD activity between Wt and p.Arg107Cys expressing
cells (*p=0.006)
470J Inherit Metab Dis (2011) 34:465–475

Page 7

“appropriate stress-conditions” for further studies, in order
to investigate differences in stress responses between the
Wt and the p.Arg107Cys expressing cells. The “appropriate
stress-conditions” were selected as the 40°C stress durance,
in which cells were not inhibited in normal cellular
transcription/translation events, but a condition affecting
the cellular homeostasis enough to reveal presumed differ-
ences in the two types of cells. To measure misfolding
stress as well as oxidative stress responses, the cells were
analyzed for mRNA transcription levels of the inducible
chaperone Hsp70 (HSPA1A, cytosolic), the chaperone
Hsp60 (HSPD1, mitochondrial), as well as for the anti-
oxidants heme oxygenase 1, HO-1 (HMOX1, cytosolic),
and superoxide dismutase 2, SOD2/MnSOD (SOD2,
mitochondrial). We found an indication of increased
antioxidant levels in the p.Arg107Cys expressing clone
after 24 h at 37°C, a finding which was enhanced at 40°C
(data not shown). This response was not further increased at
prolonged growth at 40°C. We therefore chose the stress-
conditions of 24 h at 40°C in the following study. To
confirm the result, we subjected the three selected Wt
clones and the three p.Arg107Cys clones to 24 h of heat
stress at 40°C, and analyzed the mRNA levels of Hsp70,
Hsp60, HO-1, and SOD2. The analyses were performed in
triplicate, and repeated on 3 separate days (n=9) (Fig. 5).
The mRNA transcription levels of the two chaperones
Hsp70 (Fig. 5a) and Hsp60 (Fig. 5b) were not different in
the Wt- and the p.Arg107Cys-expressing cell lines (p=
0.30 and p=0.60, respectively). When analyzing the
transcription level of the antioxidant HO-1 (Fig. 5c),
expression levels of two clones were higher in the p.
Arg107Cys clones compared with the Wt clones, though
no significant difference between Wt and p.Arg107Cys
clones was detected (p=0.21). The expression of the
mitochondrial antioxidant SOD2 (Fig. 5d), showed a statis-
tically significant increase in the p.Arg107Cys expressing
clones (p=0.04), compared with Wt cells after 24 h at 40°C.
To study the consequences of expressing the mitochon-
drial misfolded protein by a more global approach, we
performed a proteomic study on mitochondria-enriched
fractions from the transduced cells, cultivated at 37°C,
using a nanoLC-MS/MS analysis on iTRAQ-labeled pep-
tides (Palmfeldt et al 2009). This method enables relative
quantitative data of differentially expressed proteins in the
cell lines. The analysis was performed in triplicate using
mitochondria-enriched extracts from a pool of the three Wt
expressing clones, a pool of the three p.Arg107Cys
expressing clones, and a pool of three cell cultures of
untransduced A172 cells (Ut). Identified proteins were
compared between the Wt-expressing clones and the Ut
cells, between the p.Arg107Cys-expressing clones and the
Ut cells, as well as between the p.Arg107Cys-expressing
and the Wt-expressing clones. For proteins significantly
different up- or down-regulated for the three comparisons,
see Supplementary Tables 1–3. The expression ratio of
SCAD as well as a selection of proteins associated with
mitochondrial misfolding stress is schematically depicted in
Fig. 6. The SCAD protein was found to be expressed
tenfold higher in the Wt cells compared with the Ut cells,
and about five times higher than the p.Arg107Cys protein
(Fig. 6a). In addition, the proapoptotic protein BAX was
found to be present in higher amounts in the p.Arg107Cys-
expressing cells than in the two other cell types (Fig. 6b), as
well as the mitochondrial outer membrane pores VDAC1
and VDAC2 (Fig. 6c, d). Among other interesting proteins,
we found the mitochondrial fusion protein, mitofusin 1
(MFN1), as well as a member of the antioxidant system,
peroxiredoxin 6 (PRDX6), to be increased in the p.
Arg107Cys-expressing cells when compared with the Ut
cells (Fig. 6e, f). In addition, we found two proteins
Fig. 4 Inhibited cell proliferation of the p.Arg107Cys expressing cells.
250,000 cells were seeded at day 0, and the cell number was evaluated
at day 3 and day 7. At both 37 and 40°C, the p.Arg107Cys expressing
clones were proliferating significantly slower than the Wt expressing
clones (37°C, *day 3: p=0.025; day 7 p=0.021, evaluated by t test),
(40°C, *day 3: p=0.013; day 7: p=0.031, evaluated by an ANOVA test
with a stochastic level for each observation). Error bars on the 40°C
proliferation study reflect standard deviations of triplicate cell culti-
vations of each clone
J Inherit Metab Dis (2011) 34:465–475471

Page 8

influencing the mitochondrial respiration, BCS1L and
SURF1, to be reduced in the transduced cells (Wt and p.
Arg107Cys) compared with the Ut cells (Fig. 6g, h).
Discussion
In the present study, we have investigated the effect of
expressing a disease-associated variant of SCAD, by stably
expressing the wild-type (Wt) and the p.Arg107Cys
protein in astrocytic cells. This system has the advantage
of an identical genetic background compared to patient
cells (except for different ACADS integration sites),
giving the possibility to study the primary effects of the
variant SCAD protein. This may help in elucidating if
ACADS variations are capable of disturbing normal
mitochondrial functions, thus having a potential patho-
physiological role.
Fig. 5 Increased expression of
antioxidants in cells expressing
the p.Arg107Cys variant pro-
tein. Cells cultivated at 40°C for
24 h, and evaluated for mRNA
transcription levels on selected
stress response genes a
HSPA1A (Hsp70), b HSPD1
(Hsp60), c HMOX1 (HO-1), d
SOD2 (Sod2). Results are pre-
sented relative to beta-actin, and
normalized to Wt-1. p values
were calculated by an ANOVA
test with a stochastic level for
each observation (Hsp70 p=
0.60, Hsp60 p=0.30, HO-1 p=
0.21, SOD2 p=0.04). Error bars
reflect standard deviations of the
mean values of triplicate cell
cultivations performed three
times (the day-to-day variation
of triplicate measurements).
Vertical bar reflects the mean
value of the three Wt or p.
Arg107Cys expressing clones
Fig. 6 Selected differentially expressed proteins, identified by mass
spectrometry of iTRAQ labeled peptides. Differences in protein
amounts are depicted as fold-changes, relative to the value of
untransduced cells (=1). Error bars reflect the standard deviation of
three independent experiments. *p<0.05, with differences exceeding 2
× global standard error (2 × 0.058=0.116). AUt untransduced cells, Wt
wild-type
472 J Inherit Metab Dis (2011) 34:465–475

Page 9

When analyzing the expression of the introduced SCAD
proteins (Wt and p.Arg107Cys) in the astrocyte cell model
system, a discrepancy was observed between the ACADS
transcription (Fig. 1a) and the SCAD protein levels
(Fig. 1b). Despite approximately equal ACADS gene
transcription, the p.Arg107Cys protein level was about half
the amount of the Wt protein level, indicating an enhanced
turnover of the variant protein. Part of the misfolded variant
protein may also exist in an insoluble aggregated form, and
further studies are needed to determine whether the variant
proteins are located as insoluble aggregates or possibly as
other types of soluble oligomers or disordered aggregates
(Stefani and Dobson 2003; McKenzie et al 2007).
By CLSM, we confirmed that the p.Arg107Cys protein
has a normal mitochondrial localization (Fig. 2). Previous
studies using transient transfection of astrocytes with a
plasmid encoding the p.Arg107Cys-SCAD protein has
shown that presence of misfolded p.Arg107Cys SCAD
protein can lead to a disturbance of the dynamic mitochon-
drial reticulum. This disturbance was represented by a dot-
like mitochondrial pool, resulting from fission of the
mitochondrial network (Schmidt et al 2010). In the present
study, no clear and complete mitochondrial fission was
observed, yet the p.Arg107Cys expression showed a
tendency to provoke mitochondrial fission (Fig. 2).
Normally, SCAD functions as a homotetramer, and to
further evaluate the folding abilities of the remaining
undegraded p.Arg107Cys variant protein, we investigated
the tetramerization ability as well as SCAD enzyme activity
in the three selected Wt and p.Arg107Cys clones (Fig. 3).
These investigations demonstrated that the variant p.
Arg107Cys proteins are expressed in the astrocytic cell
model system, but appear to be unable to form catalytically
active tetramers. This points to a severe misfolding of these
proteins, a tendency which has not previously been reported
in a human cell model system.
We discovered that cells carrying the SCAD p.
Arg107Cys misfolding variant displayed impairment in cell
proliferation, indicating a complication of normal physiol-
ogy and cell cycle (Fig. 4). In order to investigate factors
contributing to the decreased proliferation-rates, stress
response markers were measured following exposure to
40°C for 24 h. The cytosolic inducible chaperone Hsp70
(Hsp70-1/Hsp72) is induced by various protein unfolding
stressors and acts in recognizing unfolded/damaged pro-
teins with subsequent aid in the refolding process (Hartl
1996). Hsp70 mRNA was induced by the heat stress
(approximately 3-fold compared with 37°C, data not
shown) but no significant difference (p=0.60) was observed
between Wt and the variant cell lines (Fig. 5a), indicating
that the p.Arg107Cys protein did not induce cytosolic
unfolded protein stress responses. The folding of complex
and aggregation-prone mitochondrial proteins, like SCAD,
is assisted by the chaperonin system Hsp60/Hsp10 (Houry
et al 1999; Corydon et al 2005). Furthermore, misfolded
SCAD proteins have previously shown to interact with the
Hsp60 chaperone for a longer time than Wt SCAD proteins
(Pedersen et al 2003). However, no significant change in
Hsp60 was observed between Wt and p.Arg107Cys
expressing cells either (p=0.30) (Fig. 5b). These results
indicate sufficient basal levels of these chaperones for p.
Arg107Cys protein processing and delivery to the degra-
dation systems, though the results do not add to information
about the interaction period between the misfolded SCAD
protein and Hsp60.
To test whether the misfolded proteins could participate
in the development of oxidative stress, we also tested the
gene expression of two markers of oxidative stress, heme
oxygenase-1 (HO-1) and superoxide dismutase 2 (SOD2).
HO-1 is induced by oxidative stressors (Bauer and Bauer
2002), and is present in only limited amounts under normal
unstressed conditions. The SOD2 antioxidant (manganese
superoxide dismutase/MnSOD) catalyzes the conversion of
superoxide radicals to hydrogen peroxide in the mitochon-
dria, and is also induced by mitochondrial oxidative stress
(Fridovich 1997). Despite the fact that the monomeric p.
Arg107Cys protein is present in amounts which are only
half as compared with the Wt protein, the SOD2 expression
was significantly changed in the p.Arg107Cys-expressing
clones (p<0.05). This indicates a state of oxidative stress in
cells expressing the variant SCAD proteins.
By performing a quantitative proteomic study of the cell
lines, we found several interesting mitochondrial proteins to
be differentially expressed. Wt SCAD protein was found to
be five times more abundant than the p.Arg107Cys protein
(Fig. 6), though the immunoblots in Fig. 1b showed only
twice as high Wt protein. This is presumably due to the fact
that the immunoblot was performed on whole cell lysates,
whereas the proteomic study was performed on
mitochondria-enriched extracts. If the variant SCAD pro-
teins are more prone to aggregate the Wt SCAD, this
tendency could be enhanced in the preparation of the
mitochondrial extracts.
Nevertheless, the proteomic study showed a statistically
significant increased amount of the proapoptotic protein
BAX in the p.Arg107Cys-expressing cells, compared with
both the untransduced cells and the SCAD Wt-expressing
cells. Accumulated mitochondrial BAX indicates initiation
of apoptosis, as BAX mediates opening of the voltage
dependent anion channel (VDAC) of the mitochondrial
outer membrane (Shimizu et al 1999). Opening of VDAC
releases cytochrome c and other proapoptotic factors to the
cytosol, leading to activation of the caspases in the
apoptotic pathway. Interestingly, we found both VDAC1
and VDAC2 up-regulated in the p.Arg107Cys-expressing
cells. Whether this finding is linked to the indications of
J Inherit Metab Dis (2011) 34:465–475473

Page 10

apoptosis remains to be investigated. An indication of
oxidative stress in the p.Arg107Cys-expressing cells was
shown by the presence of increased amounts of the
antioxidant peroxiredoxin 6 (PRDX6), compared with the
untransduced cells. Peroxiredoxin 6 has been reported to be
induced under oxidative stress, and is capable of reducing
phospholipid hydroperoxides, and is therefore proposed to
be involved in the repair of oxidatively damaged mem-
branes (Chowdhury et al 2009). The increased amount of
SOD2 mRNA expression found in the p.Arg107Cys-
expressing cells after 24 h at 40°C was not found in the
proteomic study performed at 37°C. We did see a subtle
increase of SOD2 at mRNA level at 37°C (data not shown),
but small concentration changes are not as evident when
investigating proteins as with transcripts.
A member of the mitochondrial fission/fusion machinery
(reviewed Youle and Karbowski 2005), MFN1, was also
found to be differentially expressed. Previously, we have
observed fission of the mitochondrial network when SCAD
proteins are overexpressed. This fission was significantly
more prevalent in cells transfected with the p.Arg107Cys
variant. Surprisingly, we found the mitochondrial fusion
protein, MFN1 (Chen et al 2003), to be significantly up-
regulated in the p.Arg107Cys-expressing cells compared
with the untransduced cells and the Wt-expressing cell line.
This finding could be explained as a compensatory
response to a presumed increased fission of the mitochon-
drial network in these cells. Interestingly, we found two
assembly factors of members of the respiratory chain to be
down-regulated in the transduced cells, compared with the
untransduced cells; BCS1l (involved in the assembly of
Complex III; Cruciat et al 1999) and SURF1 (involved in
the assembly of Complex IV; Barrientos et al 2009).
Whether these factors, presumably inhibiting respiration,
reflects a consequence of overexpression or if it is a direct
consequence of the increased SCAD expression remains to
be investigated.
In summary, in the present paper, we have reported the
development of an astrocytic cell model system, expressing
wild-type SCAD or the disease-associated variant SCAD
protein, p.Arg107Cys. We found that misfolded inactive p.
Arg107Cys protein localizes to the mitochondria, inhibiting
cellular proliferation, increasing the mRNA expression of
the antioxidant SOD2. Additionally, we found signs of
increased apoptosis and oxidative stress in the cells
expressing the misfolded SCAD variant protein, as well as
a response in the mitochondrial fission/fusion machinery.
These observed changes are found despite the fact that the
misfolded SCAD variant protein was found present in low
amounts, compared with wild-type SCAD protein. We
hypothesize that misfolded SCAD variant proteins elicit a
toxic response, partly conveyed by a mild production of
oxidative stress, leading to apoptosis. We therefore propose
that this toxic response of the misfolded protein may be
pathophysiologically relevant in patients. Asymptomatic
carriers of p.Arg107Cys may upregulate competent com-
pensatory mechanisms, such as the antioxidant system, to
cope with the cellular stress. On the other hand, symptom-
atic individuals could arise if this variant protein is present
together with susceptibility variations in the genes of
pathways involved in the handling of the misfolded
proteins and their consequences (e.g. the protein quality
control system or the antioxidant system). These are
therefore suitable candidates, when investigating suscepti-
bility factors for SCADD in the future. It is furthermore
interesting to elucidate whether these findings are specific
for the misfolded SCAD variant studied in the present
paper, or if we are dealing with a more general mechanism
for misfolded proteins in the mitochondria. The cellular
system employed in this study has enabled us to isolated
investigate the effects of expressing a misfolding mito-
chondrial variant of SCAD. To investigate the relevance of
these observed changes, in concert with a genetic variable
background, the next step in the process of evaluating the
consequences of expressing a mitochondrial misfolded
SCAD protein is to investigate patient cells.
Acknowledgments
Sciences, University of Aarhus, The Danish Medical Research
Council, Aarhus University, The John and Birthe Meyer Foundation,
and Region Midt.
The study was financed by Faculty of Health
Open Access
Commons Attribution Noncommercial License which permits any
noncommercial use, distribution, and reproduction in any medium,
provided the original author(s) and source are credited.
This article is distributed under the terms of the Creative
References
Auestad N, Korsak RA, Morrow JW, Edmond J (1991) Fatty acid
oxidation and ketogenesis by astrocytes in primary culture. J
Neurochem 56:1376–1386
Barrientos A, Gouget K, Horn D, Soto IC, Fontanesi F (2009)
Suppression mechanisms of COX assembly defects in yeast and
human: insights into the COX assembly process. Biochim
Biophys Acta 1793:97–107
Bauer M, Bauer I (2002) Heme oxygenase-1: redox regulation and
role in the hepatic response to oxidative stress. Antioxid Redox
Signal 4:749–758
Behl C, Davis JB, Lesley R, Schubert D (1994) Hydrogen peroxide
mediates amyloid beta protein toxicity. Cell 77:817–827
Bok LA, Vreken P, Wijburg FA et al (2003) Short-chain Acyl-CoA
dehydrogenase deficiency: studies in a large family adding to the
complexity of the disorder. Pediatrics 112:1152–1155
Chen H, Detmer SA, Ewald AJ, Griffin EE, Fraser SE, Chan DC
(2003) Mitofusins Mfn1 and Mfn2 coordinately regulate mito-
chondrial fusion and are essential for embryonic development. J
Cell Biol 160:189–200
Chowdhury I, Mo Y, Gao L, Kazi A, Fisher AB, Feinstein SI (2009)
Oxidant stress stimulates expression of the human peroxiredoxin
474J Inherit Metab Dis (2011) 34:465–475

Page 11

6 gene by a transcriptional mechanism involving an antioxidant
response element. Free Radic Biol Med 46:146–153
Corydon TJ, Bross P, Jensen TG et al (1998) Rapid degradation of
short-chain acyl-CoA dehydrogenase variants with temperature-
sensitive folding defects occurs after import into mitochondria. J
Biol Chem 273:13065–13071
Corydon TJ, Hansen J, Bross P, Jensen TG (2005) Down-regulation of
Hsp60 expression by RNAi impairs folding of medium-chain
acyl-CoA dehydrogenase wild-type and disease-associated pro-
teins. Mol Genet Metab 85:260–270
Cruciat CM, Hell K, Folsch H, Neupert W, Stuart RA (1999) Bcs1p,
an AAA-family member, is a chaperone for the assembly of the
cytochrome bc(1) complex. EMBO J 18:5226–5233
Ebert D, Haller RG, Walton ME (2003) Energy contribution of octanoate
to intact rat brain metabolism measured by 13 C nuclear magnetic
resonance spectroscopy. J Neurosci 23:5928–5935
Fridovich I (1997) Superoxide anion radical (O2-.), superoxide
dismutases, and related matters. J Biol Chem 272:18515–18517
Gregersen N, Bross P (2010) Protein misfolding and cellular stress;
An overview In. Protein misfolding and cellular stress in disease
and ageing. Humana Press, New Jersey
Gregersen N, Bross P, Vang S, Christensen JH (2006) Protein
misfolding and human disease. Annu Rev Genomics Hum Genet
7:103–124
Hartl FU (1996) Molecular chaperones in cellular protein folding.
Nature 381:571–579
Hegre CS, Halenz DR, Lane MD (1959) The enzymatic carboxylation
fo butyryl coenzyme A. J Am Chem Soc 81:6526–6527
Houry WA, Frishman D, Eckerskorn C, Lottspeich F, Hartl FU (1999)
Identification of in vivo substrates of the chaperonin GroEL.
Nature 402:147–154
Hsu LJ, Sagara Y, Arroyo A et al (2000) Alpha-synuclein promotes
mitochondrial deficit and oxidative stress. Am J Pathol 157:401–410
Ikeda Y, Okamura-Ikeda K, Tanaka K (1985) Purification and
characterization of short-chain, medium-chain, and long-chain
acyl-CoA dehydrogenases from rat liver mitochondria. Isolation
of the holo- and apoenzymes and conversion of the apoenzyme to
the holoenzyme. J Biol Chem 260:1311–1325
Jethva R, Ficicioglu C (2008) Clinical outcomes of infants with
short-chain acyl-coenzyme A dehydrogenase deficiency
(SCADD) detected by newborn screening. Mol Genet Metab
95:241–242
Kopito RR, Ron D (2000) Conformational disease. Nat Cell Biol 2:
E207–E209
Kragh PM, Pedersen CB, Schmidt SP et al (2007) Handling of human
short-chain acyl-CoA dehydrogenase (SCAD) variant proteins in
transgenic mice. Mol Genet Metab 91:128–137
Lin MT, Beal MF (2006) Mitochondrial dysfunction and oxidative
stress in neurodegenerative diseases. Nature 443:787–795
McKenzie M, Lazarou M, Thorburn DR, Ryan MT (2007) Analysis of
mitochondrial subunit assembly into respiratory chain complexes
using Blue Native polyacrylamide gel electrophoresis. Anal
Biochem 364:128–137
Morgenstern JP, Land H (1990) Advanced mammalian gene transfer:
high titre retroviral vectors with multiple drug selection markers
and a complementary helper-free packaging cell line. Nucleic
Acids Res 18:3587–3596
Nakamura T, Lipton SA (2009) Cell death: protein misfolding and
neurodegenerative diseases. Apoptosis 14:455–468
Palmfeldt J, Vang S, Stenbroen V et al (2009) Mitochondrial
proteomics on human fibroblasts for identification of metabolic
imbalance and cellular stress. Proteome Sci 7:20
Pedersen CB, Bross P, Winter VS et al (2003) Misfolding,
degradation, and aggregation of variant proteins. The molecular
pathogenesis of short chain acyl-CoA dehydrogenase (SCAD)
deficiency. J Biol Chem 278:47449–47458
Pedersen CB, Kolvraa S, Kolvraa A et al (2008) The ACADS gene
variation spectrum in 114 patients with short-chain acyl-CoA
dehydrogenase (SCAD) deficiency is dominated by missense
variations leading to protein misfolding at the cellular level. Hum
Genet 124:43–56
Schmidt SP, Corydon TJ, Pedersen CB, Bross P, Gregersen N (2010)
Misfolding of short-chain acyl-CoA dehydrogenase leads to
mitochondrial fission and oxidative stress. Mol Genet Metab
100:155–162
Shimizu S, Narita M, Tsujimoto Y (1999) Bcl-2 family proteins
regulate the release of apoptogenic cytochrome c by the
mitochondrial channel VDAC. Nature 399:483–487
Stefani M, Dobson CM (2003) Protein aggregation and aggregate
toxicity: new insights into protein folding, misfolding diseases
and biological evolution. J Mol Med 81:678–699
TeinI,HaslamRH,RheadWJ,BennettMJ,BeckerLE,VockleyJ(1999)
Short-chain acyl-CoA dehydrogenase deficiency: a cause of
ophthalmoplegia and multicore myopathy. Neurology 52:366–372
Tein I, Elpeleg O, Ben-Zeev B et al (2008) Short-chain acyl-CoA
dehydrogenase gene mutation (c.319 C>T) presents with clinical
heterogeneity and is candidate founder mutation in individuals of
Ashkenazi Jewish origin. Mol Genet Metab 93:179–189
van Maldegem BT, Duran M, Wanders RJ et al (2006) Clinical,
biochemical, and genetic heterogeneity in short-chain acyl-
coenzyme A dehydrogenase deficiency. JAMA 296:943–952
Waisbren SE, Levy HL, Noble M et al (2008) Short-chain acyl-CoA
dehydrogenase (SCAD) deficiency: an examination of the
medical and neurodevelopmental characteristics of 14 cases
identified through newborn screening or clinical symptoms.
Mol Genet Metab 95:39–45
Youle RJ, Karbowski M (2005) Mitochondrial fission in apoptosis.
Nat Rev Mol Cell Biol 6:657–663
J Inherit Metab Dis (2011) 34:465–475 475