Cationic solid lipid nanoparticles loaded by cysteine proteinase genes as a novel anti-leishmaniasis DNA vaccine delivery system: characterization and in vitro evaluations.

Abstract

Leishmaniasis is a major health problem in many tropical and sub-tropical countries and development of a safe and easily-available vaccine has high priority. Although several antigens potentially capable of inducing protective immunity have been studied, in the absence of pharmaceutical industry interest they have remained as fine publications only. Amongst them, Cathepsin L-like cysteine proteinases (CPs) have received considerable attention and type I and II CPs have been used in a heterologous prime-boost vaccination regime for experimental visceral leishmaniasis in dogs. Due to the promising results of the mentioned vaccination regime, we aimed to evaluate cationic solid lipid nanoparticles (cSLNs) for in vitro delivery of cpa, cpb and cpb(CTE) intended to be used as a cocktail DNA vaccine in our forthcoming studies.
cSLNs were formulated of cetyl palmitate, cholesterol, DOTAP and Tween 80 via melt emulsification method followed by high shear homogenization. Different formulations were prepared by anchoring pDNAs on the surface of cSLNs via charge interaction. The formulations were characterized according to their size and zeta potential as well as pDNA integrity and stability against DNase I treatment. Lipoplexes' cytotoxicity was investigated on COS-7 cells by MTT test. The effect of the DOTAP:pDNA ratio on protection ability and cytotoxicity was also studied. In vitro transfection efficiency was qualified by fluorescent microscopy and quantified using flow cytometry technique.
cSLN-pDNA complexes were formulated with suitable size and zeta potential. Efficiency/cytotoxicity ratio of cSLN-pDNAs formulations was comparable to linear PEI-25KD-pDNAs polyplexes while exhibiting significantly lower cytotoxicity.
Tested formulations were able to deliver immunogenic CP genes efficiently. This data proves the ability of this system as a promising DNA vaccine carrier for leishmaniasis to cover the main drawback of naked pDNA delivery that is rapid elimination from the circulation.

Full text

Page 1

J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 320 - 335, 2010


Cationic Solid Lipid Nanoparticles Loaded by Cysteine Proteinase Genes
as a Novel Anti-Leishmaniasis DNA Vaccine Delivery System:
Characterization and In Vitro Evaluations

Delaram Doroud1, 2, AlirezaVatanara1, Farnaz Zahedifard2, Elham Gholami2, Rouhollah Vahabpour3, Abdolhossein
Rouholamini Najafabadi1 and Sima Rafati2



320
1Department of Pharmaceutics, School of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran
2Molecular Immunology and Vaccine Research Laboratory, Pasteur Institute of Iran, Tehran, Iran
3Hepatitis and AIDS Department, Pasteur Institute of Iran, Tehran, Iran

Received, January 3, 2010; Revised, July 28, 2010; Accepted, August 27, 2010; Published, September 5, 2010

ABSTRACT – Purpose. Leishmaniasis is a major health problem in many tropical and sub-tropical countries
and development of a safe and easily-available vaccine has high priority. Although several antigens potentially
capable of inducing protective immunity have been studied, in the absence of pharmaceutical industry interest
they have remained as fine publications only. Amongst them, Cathepsin L-like cysteine proteinases (CPs) have
received considerable attention and type I and II CPs have been used in a heterologous prime-boost vaccination
regime for experimental visceral leishmaniasis in dogs. Due to the promising results of the mentioned
vaccination regime, we aimed to evaluate cationic solid lipid nanoparticles (cSLNs) for in vitro delivery of cpa,
cpb and cpbCTE intended to be used as a cocktail DNA vaccine in our forthcoming studies. Methods: cSLNs
were formulated of cetyl palmitate, cholesterol, DOTAP and Tween 80 via melt emulsification method followed
by high shear homogenization. Different formulations were prepared by anchoring pDNAs on the surface of
cSLNs via charge interaction. The formulations were characterized according to their size and zeta potential as
well as pDNA integrity and stability against DNase I treatment. Lipoplexes' cytotoxicity was investigated on
COS-7 cells by MTT test. The effect of the DOTAP:pDNA ratio on protection ability and cytotoxicity was also
studied. In vitro transfection efficiency was qualified by florescent microscopy and quantified using flow
cytometry technique. Results: cSLN-pDNA complexes were formulated with suitable size and zeta potential.
Efficiency/cytotoxicity ratio of cSLN-pDNAs formulations was comparable to linear PEI-25kDa-pDNAs
polyplexes while exhibiting significantly lower cytotoxicity. Conclusion: Tested formulations were able to
deliver immunogenic CP genes efficiently. This data proves the ability of this system as a promising DNA
vaccine carrier for leishmaniasis to cover the main drawback of naked pDNA delivery that is rapidly elimination
from the circulation.
__________________________________________________________________________________

INTRODUCTION

Leishmaniasis is a disease caused by intracellular
protozoan parasites of the genus Leishmania, with a
diverse set of zoonotic diseases in which humans
are incidentally infected. The disease is currently
endemic in 88 countries, some of which are among
the poorest in the world, affecting 12 million people
and threatening 350 million people worldwide (1).
Multiple species of Leishmania are known to cause
human diseases. Amongst them, cutaneous
leishmaniasis (CL) due to Leishmania major (L.
major) infection tends to form lesions in the skin
with duration typically from few months to a year.
Currently, no effective vaccine against
leishmaniasis is available and controlling the
disease is based on two main strategies, both not
efficient enough: controlling Leishmania vectors
and reservoir containments,
administration of a limited number of toxic drugs
that have partial effectiveness,
accompanied by severe side effects and drug
resistency (2).

_________________________________________

Corresponding Authors: Sima Rafati, Molecular Immunology
and Vaccine Research Laboratory, Pasteur Institute of Iran,
Tehran, Iran, s_rafati@yahoo.com; Abdolhossein Rouholamini
Najafabadi Department of Pharmaceutics, School of
Pharmacy, Tehran University of Medical Sciences, Tehran,
Iran, Roholami@sina.tums.ac.ir.
and long-term
sometimes

Page 2

J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 320 - 335, 2010


Therefore, much attention has been given toward
development of effective vaccines. Among different
vaccination strategies, DNA vaccination is a potent
activator of innate and adaptive immunity for such
an intracellular pathogen. It induces both Th1
response and CD8+ cytotoxic T lymphocytes,
accompanied by producing
polypeptides with long period of expression and an
inherent adjuvant capacity in the form of CpG
motifs (3, 4). DNA vaccines are also more potent
and safer than live attenuated and killed vaccines
with no adverse reactions in the injection site,
enabling simultaneous administration of multiple
plasmids without interference.
Searching for protective
recombinant proteins or DNA vaccines, has been a
main objective of
Unfortunately, they induce only partial protection
and/or need some clinically unacceptable adjuvants
to induce proper Th1 response in humans (5).
Among them, cysteine proteinases (CPs) are
enzymes that belong to the papain super family,
which are found in a number of organisms from
prokaryotes to mammals. In Leishmania, extensive
studies have shown that CPs are involved in
parasite survival, replication and the onset of
disease, which makes them attractive vaccine
and/or drug targets for the control of leishmaniasis
(6). Previously, our research team has shown that
the native form of L. major CPs are recognized by
lymphocytes taken from human and mice infected
with Leishmania. Immunization experiments using
CPs type I (CPB) and type II (CPA) have been
carried out in mouse model as well as outbreed
dogs with different strategies including DNA and
recombinant protein vaccination (7, 8). Recently,
prime-boost vaccination using C-terminal extension
(CTE) of L. infantum CPs type I have been
performed in BALB/c mice and exhibited both type
1 and 2 immune responses. We showed that
although CTE is highly immunogenic, it could
direct the immune response toward the Th2
response (9). Therefore, there was a need for further
investigating and examining the protective potential
of the mentioned cocktail vaccine including cpb
without CTE fragment (cpb-CTE).
Despite all of these valuable data, it is crucial to
emphasize that although DNA vaccination offers
promises against experimental leishmaniasis, these
vaccines are known to be poorly immunogenic and
still faced with a number of significant hurdles. It is


321
correctly-folded
antigens, as
many investigations.
worth mentioning that DNA immunization is
relatively a new strategy and DNA vaccine delivery
is still an immature field and no delivery system has
yet proven to be sufficiently effective in vivo.
However, this field has been improving rapidly in
the recent years. The major obstacle in DNA
delivery is transporting the DNA into the nucleus of
target cells, where they express the foreign gene,
before its degradation. In this regard, several
pharmaceutical approaches are introduced to
overcome these drawbacks. An appropriate vaccine
formulation would offer good opportunities to
increase vaccine efficacy. In this concern, various
colloidal carrier systems have been extensively
studied for the formulation of DNA vaccines.
Among them, lipid-based delivery systems for
DNA in vivo administration represent one of the
most advanced delivery technologies to date. They
protect loaded DNA
pharmacokinetic characteristics and enhance DNA
intracellular uptake and delivery to target APCs
(10). Cationic solid-lipid nanoparticles (cSLN) are
one of the colloidal lipid-based delivery systems
which consist of physiologically well-tolerated
ingredients mostly already
pharmaceutical application in humans, (11). The
solid matrix can protect active biologic ingredients
(i.e. DNA) against degradation and allows
modulation of the release profiles (10). SLN can be
produced without utilizing toxic solvents and even
large scale production is possible (11). Furthermore,
SLNs with suitable composition have been shown
to be well tolerated in vitro, as well as after in vivo
administration in mice and rats (12, 13). Therefore,
Solid Lipid Nanoparticles (SLN) are offered to be a
promising alternative to the other colloidal delivery
systems.
In the present study, cSLNs were prepared by a
melt emulsification method followed by High Shear
Homogenization (HSH)
containing CPs type I and II were anchored on the
cationic surface of nanoparticles via charge
interactions to produce a cSLN-based cysteine
proteinases delivery system. Various cSLN-pDNA
formulationes were prepared as a function of weight
ratio between cationic lipid and pDNAs and
characterized by measuring size and surface charge
values. The cytotoxicity and gene expression effect
of cSLN-pDNAs was evaluated and compared to
linear PEI (25-kDa)-pDNA polyplexes as a standard
control.
while improving its
approved for
method. Plasmids

Page 3

J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 320 - 335, 2010




322
Since 2001 when Solid Lipid Nanoparticles
were launched as non-viral transfection systems,
very few reports on their application for gene
delivery and no comprehensive report about their
usage in anti parasitic DNA vaccination have been
published. Here in this paper, we evaluate the
incorporation of immunogenic CP genes into these
non-toxic nanoparticles as a novel non-viral DNA
vaccine formulation against leishmaniasis.

MATERIALS AND METHODS

Materials
Cetylpalmitate, Tween 80, sodium cholate and
cholesterol were purchased from Merck (Germany).
N-[1-(2,3-Dioleoyloxy)
trimethylammonium
deoxyribonuclease I (DNase I), sodium dodecyl
sulfate (SDS), and MTT [3-(4,5-dimethylthiazol-2-
yl)-2,5-diphenyltetrazolium
purchased from Sigma–Aldrich
pEGFP-N1 encoding the green fluorescent protein
(GFP) was purchased from Bioscience Clontech.
Linear PEI (MW=25 kDa) was purchased from
Polyscience (Europe). The materials employed for
agarose gel electrophoresis were acquired from Bio-
Rad and those applied for PCR and enzymatic
digestion were acquired from Roche Applied
Sciences. Cell culture reagents including Fetal Calf
Sera (FCS), trypsin, EDTA and RPMI were
purchased from GIBCO (Germany). To avoid
surface-active impurities, autoclaved MilliQTM
water was used in all the experiments.

Plasmid Construction and Purification

pEGFP-cpb-CTE
Cpb-CTE gene was amplified from the construct
pGEM-cpb (8), using the following sense and anti
sense primers including (5′ and 3′ BamHI and
HindIII restriction sites
respectively) H6KB: 5’ – CGGGATCCACCAT
GGATGCGGTGGACTGGCGCG
and CpbE: 5′ - CTGAAGCTTCACATGCG
CGGACACGGG-3′. The PCR product (650 bps)
was digested with BamHI and HindIII, gel purified
and subcloned into pcDNA 3.1(-). Plasmid DNA
was purified from recombinant clones (QIAGEN
Plasmid Midi Kit, Germany), and verified by
restriction enzyme digestion and sequencing using
the dideoxy chain termination method on an
propyl]-N,N,N-
(DOTAP), chloride
bromide] were
(Germany).
are underlined,
- 3′; min at room temperature. A gel retardation assay
was then applied for monitoring the pDNA/DOTAP
complex formation by loading 15 µl (0.37 µg/µl
DNA) of samples onto a 0.8% agarose gel using 0.5
µg/µl ethidium bromide.
For preparing SLN formulations based on
experimental design matrix sodium cholate was
added to the hot water phase instead of desired
amount of DOTAP that was prescreened in the
automated sequencer. After confirmation, the
desired gene was sub-cloned into pEGFP-N1 for
transfection and named as pEGFP-cpb-CTE.

pEGFP-cpa and pEGFP-cpb
Both pGEM-cpa and pGEM-cpb were available
from previous studies (8). Therefore, both cpa and
cpb fragments from these constructs were cloned
into pEGFP-N1. In all three resulted constructs
(pEGFP-cpa, pEGFP-cpb, and pEGFP-cpb-CTE), the
cpa, cpb, and cpb-CTE open reading frames were
under control of the CMV promoter, inserted
downstream of a Kozak consensus sequence and in
frame with an initiation codon. Plasmid DNAs were
transformed into the DH5αE. coli strain and
purified by alkaline lysis method (QIAGEN
Plasmid Midi Kit) and then confirmed by PCR and
digestion (data not shown). The total concentration
and purity of DNA was determined by NanoDrop®
ND-1000 spectrophotometer (Labtech, UK).

Preparation of cSLN formulations
Application of cetylpalmitate and Tween 80 for
SLN formulation was reported elsewhere (14, 15,
16). We used a slightly modified method to prepare
SLN formulation while different process variables
were evaluated in an experimental design matrix
consisted of 9 runs (32) which were obtained by
Design-Expert 6.0.6 statistical software. The
preparation factors investigated here were the
surfactant:total lipid ratio and the preparation
method that is either based on melt emulsification
(ME), HSH, or a combination of both methods, i.e
homogenization of the obtained hot oil in water
mixture before cooling (M+H) . The effect of these
variable factors were evaluated on the size, zeta and
stability of the formulations.
To determine required amount of DOTAP to
form a stable complex with pDNA, a 200- µl
reaction mixtures were prepared by adding
increasing amounts of DOTAP dissolved in milli
QTM water to 5 µg of pDNA and incubated for 60

Page 4

J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 320 - 335, 2010


previouse step. The lipid phase contained a
constant amount of cetylpalmitate and cholesterol
(core and helper lipids) for all the runs. The
entire full factorial design of experiment is listed
in Table 1.

Table 1. Variable factors applied in the design of
experiment for SLN formulation
Total lipid ratio:
Tween 80
S1
1
S2
1
S3
1
S4
2.5
S5
2.5
S6
2.5
S7
4
S8
4
S9
4


In order to prepare the final cationic formulation,
briefly desired amount of DOTAP (0.4% w/v) was
dissolved in hot aqueous phase. The hot aqueous
phase was then added to the melted cetyl palmitate
and cholesterol (5.1% w/v) phase containing Tween
80 as a nonionic surfactant at the ratio obtained
from the experimental design and emulsification
was carried out by stirring the mixture at 2000 rpm
by a mechanical stirrer (IKAR , Germany) for 10
min at 90 °C. Samples were then homogenized
using a high shear homogenizer (IKAR, Germany)
at 18,000 rpm for 15 min. cSLN dispersion was
obtained by direct cooling
microemulsion on an ice-bath while stirring at 1000
rpm. Reproducibility of the results was also studied.
cSLNs were washed by centrifugation (6000 rpm,
10 min, three times) using the Amicon® Ultra
centrifugal filters (Millipore) to purify the
suspension from excess surfactants.

pDNA Loading on Nanoparticles

Preparation of cSLN-pDNA complexes
Volumes corresponded to 5 µg of each purified
pEGFP plasmid DNA (pEGFP-cpa, pEGFP-cpb,
pEGFP-cpb-CTE and vector without insert as control)
were mixed with different amounts of cSLN
suspensions in Milli-Q™ water separately. The
amounts of cSLNs required for complete DNA
binding were determined individually by agarose


323
Formulation code
Formulation
method
HSH
ME
M+H
HSH
ME
M+H
HSH
ME
M+H
of hot O/W
gel electrophoresis and expressed as w/w ratio of
DOTAP/pDNA. DOTAP/pDNA ratios assayed
ranged from 10:1 to 1:1. cSLN–pDNA complexes
were prepared by adding pDNA solution to cSLN
suspension and 60 min incubation at room
temperature.

Preparation of PEI–pDNA complexes
PEI-pDNA complexes were prepared by mixing
appropriate volumes of 10 μM linear PEI (25 kDa)
solution (calculated for 7, 10, 13 N/P ratios) with
5 μg of each pEGFP-N1construct (pEGFP-cpa,
pEGFP-cpb , pEGFP-cpb-CTE and vector without
insert as control) and incubating the mixture at
room temperature for 60 min.
Assessment of Nanoparticles

Measurement of Size and zeta potential
The sizes of cSLNs and cSLN–pDNA complexes
were determined by
spectroscopy (PCS). For this purpose, the SLN in
water dispersions were diluted in the ratio of 1:100
before analysis. Both size and zeta potential
measurements were performed on a Malvern
Zetasizer 3000 (Malvern
Worcestershire, UK). The analysis was performed
on each sample immediately after preparation of the
cSLNS and 2 hrs after preparing the cSLN-pDNA
complex in milli Q water.

Gel retardation analysis
Gel retardation assay was applied to determine
complex formation between pDNA (5 µg) and
cSLNs (DOTAP different weight ratios). For this
purpose, 15 µl aliquots of the complexes samples
(containing 0.375 µg of pDNA) were subjected to
electrophoresis on a 0.8% agarose gel containing
0.5 µg/µl ethidium bromide after mixing with 7 µl
loading buffer (0.25% bromophenol blue and 30%
glycerol). Electrophoresis was carried out in 80 V
for about 2 h in 1X TBE running buffer. The bands
were observed with a transilluminator (Bio Doc-
ITTM System, UK). Images were captured using a
digital camera.

DNase I protection study
In order to assess protection ability of cSLNs for
loaded pDNAs, DNase I was added to cSLN–
pDNA complexes to a final concentration of 0.8 U
DNase I to 5 μg DNA and the mixtures were
photon correlation
Instruments,

Page 5

J Pharm Pharmaceut Sci (www.cspsCanada.org) 13(3) 320 - 335, 2010


incubated at 37 °C for 1 hr. Then SDS solution was
added to the samples to a final concentration of 1%
to release DNA from cSLNs. Samples were then
analyzed by electrophoresis on agarose gel 0.8%
containing ethidium bromide and the integrity of
the DNA in each sample was visualized and
compared with free DNA as control.

Stability studies
The physicochemical stability of cSLNs alone and
in complex with pDNA constructs were evaluated
at 4±1°C, 25±1°C at dark for 1 month at regular
time intervals via observation of any changes in
suspension clarity, particle size and zeta potential
assessments.

In Vitro Studies

Cytotoxicity assay
COS -7 cells (ATCC no. CRL 1654) were plated at
a density of 1×104 cells/well in a 96 well microtiter
plates at 37°C in 5% CO2 in RPMI as growth
medium and incubated at 37 °C overnight in 5%
CO2 atmosphere (Memmert, USA). Then the
medium was removed and cells were washed with
serum-free RPMI medium and 200 µl of serum-free
RPMI medium was added to each well. After
overnight incubation, SLN suspensions or PEI
solution sample in desired concentrations were
added to the medium and cells were incubated for
another 24 hrs. As controls, a well with only
medium (100% viability) and a well with 2% triton
X (0% viability) were assigned. The plate was
incubated for 24 hrs in 37°C. Then 100 µl MTT
solution per 1 ml medium was added to each well
after removing the media. Four hrs after incubation,
the insoluble formazan crystals were solubilzed in
DMSO and absorption was measured at 570 nm in
an automated ELISA plate reader (Bio-Tek
ELx808, UK). Viability was expressed in percent
compared to untreated cells (100% survival).
Experiments were performed in triplicates and
repeated at least twice. Relative cell viability was
calculated by dividing [Abs] (mean absorbance) of
treated cells to [Abs] of the control cells.

Plasmid Delivery Assays

Transfection studies via fluorescent microscopy
COS-7 cells were transfected with pEGFP-N1
(encoding enhanced GFP as a positive transfection


324
control), pEGFP-cpa, pEGFP-cpb and pEGFP-cpb-
CTE using SLN and linear PEI (25 kDa). Non-
transfected COS-7 cells were used as negative
control.
Briefly, the day prior to transfection, 1.5×105
COS-7 cells were seeded in each well of 4-well
plates (SPL life sciences, South Korea) and grown
in RPMI 5% supplemented with heat-inactivated
FCS until the cell reached 75% confluency. Cell
culture medium was replaced with serum free
medium immediately before transfection. PEI-
pDNA and cSLN-pDNA complexes were added to
the cells and incubated for 6 hrs at 37 ºC in 5%
CO2, and then the medium was replaced with fresh
complete RPMI containing 5% FCS. The GFP
expression of positive transfection control (the
COS-7 cells transfected by pEGFP-N1) was
confirmed by an inverted fluorescence microscopy
(Nikon E200, USA). Observations and image
captures were performed using a 10X objective at
24, 48 and 72 hrs after transfection. The expression
of L. major CPA, CPB and CPB-CTE in transfected
COS-7 cells were carried out and qualified by
detection of GFP expression via fluorescence
microscopy at different time intervals (24, 48 and
72 hrs) after transfection.

Flow cytometry analysis
At 48 hrs after incubation, cells in 4-well plates
were washed once with 300 μl of PBS and were
detached with 300 μl of trypsin/EDTA. Then the
cells were centrifuged at 1500 g and the supernatant
was discarded. The cells were resuspended in RPMI
and kept on ice. Afterward, cells were directly
applied to a Partec PASIII flow cytometer (Partec
GmbH, Germany) using a bivariate scatter plot of
fluorescence versus side scatter, by gate setting with
un-transfected cells. A minimum of 10,000 events
from the viable transfected cell population per
sample were analyzed.

STATISTICAL ANALYSIS

All of the pharmaceutical experiments were
repeated 3 times and all measurements were
repeated three to five times. Means and standard
deviations were calculated using GraphPad Prism
5.0 (if necessary). The statistical analysis between
different groups was determined with an ANOVA
test. Differences were considered statistically
significant when p < 0.05.