Human papillomavirus-16 presence and physical status in lung carcinomas from Asia.

Abstract

Although human papillomavirus (HPV) genome has been detected in lung cancer, its prevalence is highly variable around the world. Higher frequencies have been reported in far-east Asian countries, when compared with European countries. The present study analysed the HPV-16 presence in 60 lung carcinomas from the Asian countries China, Pakistan and Papua New Guinea.
HPV-16 was present in 8/59 (13%) samples. According to histological type, HPV-16 was detected in 8/18 (44%) squamous cell carcinomas (SQCs), which were mainly from Pakistan; 0/38 (0%) adenocarcinomas (ACs), which were mainly from China; and in 0/4 (0%) small cell carcinomas (SCLCs). The observed histological difference was statistically significant (p < 0.001). HPV-16 viral load was also determined using real-time polymerase chain reaction (qRT-PCR); it ranged between 411 to 2345 copies/100 ng of genomic DNA. HPV-16 genome was found integrated into the host genome in every HPV-16 positive carcinoma.
These results support the notion that HPV-16 infection is highly associated with SQCs in Pakistan. Our results show a frequent HPV-16 integration in SQCs, although the low viral load casts doubt respect a direct etiological role of HPV in lung carcinomas from Asia. Additional HPV-16 characterization is necessary to establish a direct or indirect etiological role of HPV in this malignancy.

Full text

Page 1

RESEARCH ARTICLEOpen Access
Human papillomavirus-16 presence and physical
status in lung carcinomas from Asia
Francisco Aguayo1,6, Muhammad Anwar2, Chihaya Koriyama2, Andres Castillo2, Quanfu Sun3, Jacob Morewaya4,
Yoshito Eizuru5, Suminori Akiba2*
Abstract
Background: Although human papillomavirus (HPV) genome has been detected in lung cancer, its prevalence is
highly variable around the world. Higher frequencies have been reported in far-east Asian countries, when
compared with European countries. The present study analysed the HPV-16 presence in 60 lung carcinomas from
the Asian countries China, Pakistan and Papua New Guinea.
Results: HPV-16 was present in 8/59 (13%) samples. According to histological type, HPV-16 was detected in 8/18
(44%) squamous cell carcinomas (SQCs), which were mainly from Pakistan; 0/38 (0%) adenocarcinomas (ACs), which
were mainly from China; and in 0/4 (0%) small cell carcinomas (SCLCs). The observed histological difference was
statistically significant (p < 0.001). HPV-16 viral load was also determined using real-time polymerase chain reaction
(qRT-PCR); it ranged between 411 to 2345 copies/100 ng of genomic DNA. HPV-16 genome was found integrated
into the host genome in every HPV-16 positive carcinoma.
Conclusion: These results support the notion that HPV-16 infection is highly associated with SQCs in Pakistan. Our
results show a frequent HPV-16 integration in SQCs, although the low viral load casts doubt respect a direct
etiological role of HPV in lung carcinomas from Asia. Additional HPV-16 characterization is necessary to establish a
direct or indirect etiological role of HPV in this malignancy.
Background
Human papillomaviruses (HPVs) are epitheliotropic dou-
ble-stranded DNA viruses that belong to the papillomavir-
idae family. Epidemiological, clinical and basic research
has allowed to conclude that HPV infection is the neces-
sary cause of cervix uterine cancer [1]. In addition, HPV
has been associated with other extra-genital malignancies
such as cancers of the head and neck, esophageal, skin and
lung [2]. The prevalence of HPV in lung cancer is highly
variable around the world. A meta-analysis made by
Srinivasan reported that HPV frequency in lung carcino-
mas ranged between 0 to 78.3% worldwide. Relatively high
frequencies are found in Far East Asian countries when
compared with European countries [3]. In addition, HPV
is suspected to predispose to particular histological sub-
types of lung cancer. A study in Okinawa, southern islands
of Japan, found that HPV was detected in 79% of the
cases, particularly in the well-differentiated SQCs.
However, the proportion of HPV-positive lung carcinomas
in Okinawa decreased in the 1990 s, in parallel with the
falling incidence of well differentiated SQCs, and was only
24% in the late 1990 s [4]. Relatively high HPV prevalence
rates in SQCs were found in our study in Chile [5] and
studies in central China [6]. However, the association of
HPV to lung SQC is not always observed. For example, an
Iranian study showed no evident association to any histo-
logical types [7]: HPV was found in 25% of SQCs, 21% of
ACs, 33% of large cell lung carcinomas and 29% of small
cell lung carcinomas (SCLCs). In Europe, one study ana-
lysed 218 frozen specimens of lung carcinomas from
France, using Roche line blot assay, and found only four
HPV positive samples, one poorly differentiated SQC and
three large cell carcinomas [8]. A Korean study did
not show any histological association of HPV, either [9].
On the other hand, studies conducted in Taiwan and
in Kagoshima, Japan, showed a high prevalence of HPV in
ACs. In a Taiwanese study, HPV-16 and HPV-18 were
* Correspondence: akiba@m.kufm.kagoshima-u.ac.jp
2Department of Epidemiology and Preventive Medicine, Kagoshima
University Graduate School of Medical and Dental Sciences, 8-35-1
Sakuragaoka, Kagoshima, 890-8544, Japan
Full list of author information is available at the end of the article
Aguayo et al. Infectious Agents and Cancer 2010, 5:20
http://www.infectagentscancer.com/content/5/1/20
© 2010 Aguayo et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.

Page 2

positive in 43% and 49% of ACs, respectively, but only in
24% and 29% of SQCs, respectively [10]. Interestingly, a
recent study in Kagoshima, Japan, examined 20 additional
ACs treated with gefitinib, a tyrosine kinase inhibitor spe-
cific for epidermal growth factor receptor (EGFR), and
detected high-risk HPV genomes in 75% (7/8) of ACs with
complete or partial response to gefitinib but not in the
remaining 12, which did not respond to gefitinib [11].
Note that non-smoking women with East Asian ethnicity
is a predictive factor of gefitinib responsive ACs [12].
In general, high risk-HPVs are frequently integrated in
cervical cancer, and low risk-HPVs are frequently found
to be episomal [13]. Moreover, it has been reported that
HPV integration is more frequently found in high-grade
lesions (invasive carcinoma) when compared with low
grade lesions [14]. The HPV integration frequently dis-
rupts E2 ORF causing E6 and E7 overexpression because
E2 protein functions as a repressor of p97 promoter in
HPV-16. The E6 and E7 overexpression induce p53 and
pRb loss, respectively [15]. In cervical carcinogenesis,
deregulated expression of these two viral oncogenes in
basal cells, mostly by HPV integration, is considered to
be a critical event for disease progression [16].
Epidemiological evidence suggests that pathways
involved in HPV-induced oncogenesis may be influ-
enced by ethnic factors and anatomical location as well
as exposures to risk factors such as smoking and alcohol
[17]. Thus, it is of interest to study the prevalence and
function of HPV-16 in lung carcinomas from countries
with different lifestyles. In the present study we exam-
ined lung cancer specimens from Asian countries such
as China, Pakistan and Papua New Guinea. Studies on
HPV prevalence in lung cancer in Pakistan or Papua
New Guinea have not been reported to date. In addi-
tion, in order to characterize the role of HPV in this
tumour, we determined the physical status (episomal/
integrated) and viral load in HPV-16 positive cases.
Results
The present study analysed the HPV-16 presence in
lung carcinomas from Pakistan, China and Papua New
Guinea. The clinicopathological features of analysed spe-
cimens are shown in Table 1. No statistically significant
differences were observed between analysed histological
types and age, gender or differentiation status (P =
0.295, 0.133 and 0.179, respectively). All ACs analysed
in this study were obtained from China and all SQCs
were obtained from Pakistan and Papua New Guinea.
Thus, in this study there was a statistically significant
difference between analysed histological type of lung
cancer and countries involved (P < 0.05).
We successfully purified DNA in all the analysed speci-
mens. The DNA was highly pure (Absorbance 260/280 =
1, 8) and its concentration was ranged between 50 to
100 ng/μL. In addition, to check the DNA fragmentation
and presence of amplifiable DNA for PCR, we success-
fully amplified a 110 betaglobin DNA fragment in all of
specimens. PCR with GP5+/6+ primers revealed that
8/60 (13%) cases were HPV positive. In order to deter-
mine the HPV genotype, we used PCR for amplification
of a HPV-16 E6 specific DNA fragment. All the cases
that were HPV GP5+/6+ positive were typed as HPV-16.
We confirmed these results using PCR for amplification
of another 65 bp DNA fragment of HPV-16 E6 [18]
(Figure 1A y 1B). No other HPV genotype was found in
this study. The HPV-16 genotype was present in SQCs
(8/18) but not in ACs or SCLCs (Table 2) and this differ-
ence among histological types was statistically significant
(P < 0.001). Gender, age or tumour differentiation was
not significantly associated with HPV-16 presence (P=
0.091, 0.669 and 0.131, respectively). In addition, we used
real-time PCR to determine viral load and physical status
of HPV. All the HPV-16 positive specimens were
Table 1 Clinicopathological features of lung carcinomas
from China, Pakistan and Papua New Guinea
All* histological types
ACs SQCs
p-value
SCLCs
Age 0.295
-64
65+
38
18
23 (61)
14 (78)
11 (29)
4 (22)
4 (11)
0 (0)
Gender0.133
Male
Female
43
17
24 (56)
14 (82)
16 (37)
2 (12)
3 (7)
1 (6)
Differentiation0.179
poor
moderate
well
19
26
11
11 (58)
17 (65)
10 (91)
8 (42)
9 (35)
1 (9)
0 (0)
0 (0)
0 (0)
Country< 0.005
Pakistan
China
PNG
21
31
8
4 (19)
31 (100)
3 (38)
13 (62)
0 (0)
5 (62)
4 (19)
0 (0)
0 (0)
* Ages and tumor differentiation was not available in four cases
PNG: Papua New Guinea.
Figure 1 HPV-16 is detected in lung carcinomas from Asia. DNA
purified from lung carcinomas from Asian patients were amplified
by PCR using A: generic primers flanking the HPV L1 region (65 bp)
and B: specific primers flanking the HPV-16 E6 region (96 bp) and
revealed by agarose gel electrophoresis and ethidium bromide
staining. MW: 100 bp molecular weight marker; wells 1-7: positive
clinical samples; wells 8-9: Negative and positive control (DNA from
HPV-16 recombinant plasmid).
Aguayo et al. Infectious Agents and Cancer 2010, 5:20
http://www.infectagentscancer.com/content/5/1/20
Page 2 of 7

Page 3

successfully amplified for an 81 bp fragment of E6 gene
but only 3 specimens were successfully amplified for an
82 bp fragment of E2 gene (Figures 2A and 2C). The
amplified fragments were characterized by melting analy-
sis that showed a specific curve with a Tm (melting tem-
perature) of 77.6°C for the E6 fragment and 81.7°C for
the E2 fragment. One specimen positive for E2 gene
showed a Tm that was higher 0.5°C approximately com-
pared with the other two specimens (Figures 2B and 2D).
The specific presence of amplification products was
checked by agarose gel electrophoresis and ethidium bro-
mide staining in all the samples (data not shown). We
found that HPV-16 viral load ranged between 411 to
42141 copies/100 ng of genomic DNA, and the HPV-16
genomes were absolutely integrated in 5/8 (63%) positive
lung carcinomas. In 3/8 (37%) carcinomas, episomal and
integrated HPV genome was present simultaneously
(Table 3). No relationship was observed between HPV-16
viral load and integration status.
Discussion
In this study HPV-16 was found in 13% of the lung car-
cinomas. This finding is consistent with other reports
where HPV-16 has been the most common HPV geno-
type detected in lung cancer [3]. HPV-16 genome was
detected only in SQCs (44%) but not in the other histo-
logical types (Table 2). These results support the notion
that SQCs are more strongly associated with high-risk
HPV in the areas other than far-east Asia. On the other
hand, the absence of HPV genomes in ACs present a
contrast to what was found by studies in Taiwan and
Japan, where HPV-16 genome was more frequently
found in ACs than in SQCs [10,11]. Since ACs respon-
sive to gefitinib tend be located in the lung periphery,
tumor location may be an explanation for those discre-
pant results. Note that ACs surgically resected in the
mainland China may be more centrally located.
Epidemiological evidence suggests that pathways
involved in HPV-mediated oncogenesis are influenced
by ethnic factors and anatomic location as well as expo-
sures to risk factors such as smoking or alcohol [17].
The most important risk factor of lung cancer is smok-
ing. However, no studies reported an evident interactive
effect between HPV infection and tobacco smoking on
lung cancer risk. On the other hand, a Taiwanese study
that showed a high prevalence of high-risk HPV in non-
smoking women [10]. Although 14 ACs in our study
were mainly from Chinese women, who tend to be non-
smokers, we did not have information about smoking
habit in these patients. Therefore, we could not examine
the possibility of high HPV prevalence in lung ACs
among non-smoking women. Another risk among non-
smoking Asian women is long exposure to kitchen
fumes [19], which is however, not a common exposure
in Japan. Recently, a Taiwanese study reported an
increased lung cancer risk in relation to mosquito coil
use [20], which is commonly used in Asian countries,
including Japan. Other possible environmental risk fac-
tors may be heavy metals: A Taiwanese study reported
the accumulation of chromium and nickels in lung
carcinomas [21]. It should also be noted that arsenic
poisoning from artesian well water cause black-foot
Table 2 Clinicopathological features of HPV-16-positive lung carcinomas
All
N(%)
HPV16 positive
N(%)
HPV16 negative
N(%)
p-value
Age0.669
< 65 years
> 65 years
38
18
4 (11)
3 (17)
34 (89)
15 (83)
Gender0.091
Male
Female
43
17
8 (19)
0 (0)
35 (81)
17 (100)
Histology
< 0.001
AC
SQC
SCLC
38
18
4
0 (0)
8 (44)
0 (0)
38 (100)
10 (56)
4 (100)
Differentiation0.131
Poor
Moderate
Well
19
26
11
5 (26)
3 (12)
0 (0)
14 (74)
23 (88)
11 (100)
Country0.001
Pakistan
China
PNG
21
31
8
7 (33)
0 (0)
1 (13)
14 (67)
31 (100)
9 (87)
Aguayo et al. Infectious Agents and Cancer 2010, 5:20
http://www.infectagentscancer.com/content/5/1/20
Page 3 of 7

Page 4

diseases in southern Taiwan, and is suspected to
increase the risk of cancers of the lung, bladder and
liver [22].
The variable frequencies of HPV-positive lung carci-
nomas between countries and continents may be
explained by differences in sensitivity of the molecular
methods used for HPV detection. PCR has been the
most popular method used to detect HPV infection [3];
however the different amplification protocols and pri-
mers used make it difficult to compare study results.
The present study found HPV-16 integration in cellu-
lar genome in every HPV-16 positive carcinoma. Even
so, the low HPV load observed in the present study and
in our previous study in Chile makes it difficult to inter-
pret its etiological significance. It should be pointed out
however that human cancer can be considered as a stem
cell disease originated from a small fraction of cancer
cells that show self-renewal and pluripotency and are
capable of initiating and sustaining tumor growth [23].
HPV may be present only in a small fraction of cancer
cells with stem cell like nature present even in advanced
tumors. The transmission route of HPV detected in the
upper aerodigestive tract cancers is yet unclear. One
possible transmission route of HPV to the lung is
through the bloodstream as suggested by a few studies
[24]. However, it was pointed out that the possibility of
bloodstream transmission appears to be low because of
the exclusive intraepithelial cycle of life of HPV infec-
tion [25]. Moreover, a recent study which compared the
Figure 2 Quantitative Real-time PCR for HPV-16 in lung carcinomas from Asia. A: Amplification of HPV-16 E6 fragment; B: Melting analysis
after E6 amplification; C: Amplification of HPV-16 E2 fragment; D: Melting analysis after E2 amplification.
Table 3 Physical status of HPV-16 in lung carcinomas
Case E6
Copies/100 ng Copies/100 ng
E2 E2/E6Physical status
1
2
3
4
5
6
7
8
411
1737
2139
1724
1384
1876
2345
42141
00Integrated
Mixed
Integrated
Integrated
Mixed
Integrated
Integrated
Mixed
35
0
0
7.6
0
0
0.02
0
0
0.0055
0
0
0.521071
Aguayo et al. Infectious Agents and Cancer 2010, 5:20
http://www.infectagentscancer.com/content/5/1/20
Page 4 of 7

Page 5

second cancer risk of 335 women with invasive cervical
cancer and their first degree relatives did not find any
increase of lung cancer risk among cervical cancer
patients [26]. Another possibility is a sexual transmis-
sion. However, considering the fact that Islamic coun-
tries have low incidence of cervical cancer [27], which is
almost exclusively caused by HPV infection, such a
route is unlikely to explain the presence of HPV in
SQCs from Pakistan. Since the virus can infect oral
mucosa and subsequently, larynx and bronchial tissue,
that may be the main source of HPV detected in the
lung.
This report has some methodological biases that need
to be commented: First, DNA specimens from paraffin
embedded tissues are known to be degraded because of
heat during embedding and formalin fixation. Therefore,
the present study might have underestimated the viral
load “in vivo”. Second, the amplification through PCR is
not able to detect HPV directly in tumoral cells, so in
the future a very sensitive “in situ“ method to detect
HPV or an alternative method to obtain only tumoral
cells from clinical specimens, as tissue microdissection
are warranted.
Conclusion
The results obtained in this study support the notion
that HPV-16 infection is more strongly associated with
SQCs than with ACs in the areas other than far-east
Asian countries. Even though HPV-16 was frequently
integrated in lung carcinomas, its low viral load casts
doubt on a direct etiological role, which has been well
established in the case of uterine cervical cancer. How-
ever, whether HPV-16 has a direct or indirect impact in
the tumour development or modulation remains to be
investigated.
Methods
Study subjects
We examined 60 bronchoscopic biopsy specimens of
paraffin-embedded tissue of SQCs (N = 30) and ACs
(N = 32) of the lung from Pakistan, China and Papua
New Guinea (PNG). The cases from Pakistan (N = 22)
were diagnosed in Pathology Department of King
Edward Medical University, Mayo Hospital, Lahore,
Pakistan from 1996 to 2002. Cases from PNG were diag-
nosed in the period 1986-88 at Pathology Department of
Port Moresby General Hospital, the major teaching cen-
ter of School of Medicine & Health Sciences, University
of Papua New Guinea. Cases from China were diag-
nosed during the period between 1989 and 2002 in
hospitals in eastern China. Based on 1982 WHO classifi-
cations of lung tumors, lung carcinomas were classified
into four broad categories: SQCs, ACs, small cell carci-
nomas and large cell carcinomas [28]. In the present
study, histological classification was made using the
guideline of the Japan Lung Cancer Society [29], which
follows the WHO classification. The institutional review
board of the Kagoshima University Graduate School of
Medical and Dental Sciences of Japan approved the pre-
sent study.
Polymerase chain reaction (PCR) and Southern blotting
Ten-μm-thick sections of each formalin-fixed paraffin-
embedded sample were prepared. The samples were
added with 1 mL of xylene, and then with 1 mL of etha-
nol. After centrifugation, the pellet was resuspended in
digestion buffer (50 mM Tris-Cl pH 8.0, 1 mM EDTA
pH 8.0, 0.5% Tween 20) containing 200 μg of Proteinase
K (Invitrogen Corp., USA) and incubated during
24 hours at 56°C. The solution was heated at 100°C for
10 min and centrifuged at 10,000 rpm for 10 min. After
phenol/Chloroform extraction, the obtained DNA was
quantified using the Nanodrop 1000 spectrophotometer.
HPV amplification with GP5+/GP6+ primers [30] was
made in a reaction mixture that contained 2.5 μL of
sample (containing 100 ng of DNA), 200 μM dNTP,
0.5 μM of each primer and 1.0 U Taq DNA polymerase
(Takara, Japan) in a total volume of 25 μL of reaction
buffer (50 mM KCl, 20 mM Tris-Cl, pH 8.3). A “hot
start” protocol was used with the following conditions
of amplification: initial denaturation at 95° for 4 min;
subsequent 45 cycles at 95°C for 1 min, 40°C for 2 min
and 72°C for 1.5 min and final extension at 72°C for
5 min. The amplification of a betaglobin fragment with
a set of PCO3/PCO4 primers (Takara, Japan) was used
as internal positive control. All the analysed samples
were betaglobin positive. The PCR program was as fol-
lows: initial denaturation at 95°C for 4 min, 40 cycles
with the cycling profile of 95°C for 1 min, 52°C for
1 min and 72°C for 2 min and final extension for 5 min
at 72°C. In addition, the generic HPV presence was
detected using another L1 region as previously reported
[31]. The specific HPV-16 amplification was made
according to the following conditions: initial denatura-
tion at 95°C for 5 min, 45 cycles with the cycling profile
of 94°C for 45 s, 55°C for 45 s and 72°C for 45 s and a
final extension for 5 min at 72°C. The amplified pro-
ducts were detected through electrophoresis on 3.0%
agarose gel.
Quantitative Real-time PCR
Real-time PCR was performed using the ABI Prism 7000
Sequence Detection System and SYBR-Green PCR mas-
ter mix (PE, Applied Biosystems, USA). The amplifica-
tion conditions were 10 min at 95°C and a two-step
cycle of 95°C for 15 sec and 60°C for 60 sec for a total
of 45 cycles. The primers used were: E6F: gagaaactg-
caatgtttcaggacc and E6R: tgtatagttgtttgcagctctgtgc,
Aguayo et al. Infectious Agents and Cancer 2010, 5:20
http://www.infectagentscancer.com/content/5/1/20
Page 5 of 7