A rare case of alpha-thalassaemia intermedia in a Malay patient double heterozygous for alpha(+)-thalassaemia and a mutation in alpha1 globin gene CD59 (GGC --> GAC).

Haematology Unit, Department of Pathology, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.
The Medical journal of Malaysia 12/2009; 64(4):321-2.
Source: PubMed


A rare case of thalassaemia-intermedia involving a non-deletion alpha thalassemia point mutation in the alpha1-globin gene CD59 (GGC --> GAC) and a deletion alpha+ (-alpha(3.7)) thalassaemia in which use of high performance liquid chromatography (HPLC) C-gram Hb subtype profile and DNA molecular analysis helped establish the diagnosis.

Download full-text


Available from: Mary Anne Tan Jin Ai, Jan 12, 2015
  • [Show abstract] [Hide abstract]
    ABSTRACT: Alpha (Α) thalassaemia is the most common inherited disorder in Malaysia. The clinical severity is dependant on the number of Α genes involved. Full blood count (FBC) and haemoglobin (Hb) analysis using either gel electrophoresis, high performance liquid chromatography (HPLC) or capillary zone electrophoresis (CE) are unable to detect definitively alpha thalassaemia carriers. Definitive diagnosis of Α-thalassaemias requires molecular analysis and methods of detecting both common deletional and non-deletional molecular abnormailities are easily performed in any laboratory involved in molecular diagnostics. We carried out a retrospective analysis of 1623 cases referred to our laboratory in Universiti Kebangsaan Malaysia Medical Centre (UKMMC) for the diagnosis of Α-thalassaemia during the period October 2001 to December 2012. We examined the frequency of different types of alpha gene abnormalities and their haematologic features. Molecular diagnosis was made using a combination of multiplex polymerase reaction (PCR) and real time PCR to detect deletional and non-deletional alpha genes relevant to southeast Asian population. Genetic analysis confirmed the diagnosis of Α-thalassaemias in 736 cases. Majority of the cases were Chinese (53.1%) followed by Malays (44.2%), and Indians (2.7%). The most common gene abnormality was ΑΑ/--(SEA) (64.0%) followed by ΑΑ/-Α(3.7) (19.8%), -Α(3.7) /--(SEA) (6.9%), ΑΑ/ΑΑCS (3.0%), --(SEA)/--(SEA) (1.2%), -Α(3.7)/-Α(3.7) (1.1%), ΑΑ/-Α(4.2) (0.7%), -Α(4.2)/--(SEA (0.7%), -Α(3.7)/-Α(4.2) (0.5%), ΑΑ(CS)/-- SEA) (0.4%), ΑΑ(CS)/ΑΑ(Cd59) (0.4%), ΑΑ(CS)/ΑΑ(CS) (0.4%), -Α(3.7)/ΑΑ(Cd59) (0.3%), ΑΑ/ΑΑ(Cd59) (0.1%), ΑΑ(Cd59)/ ΑΑ(IVS I-1) (0.1%), -Α(3.7)/ΑΑ(CS) (0.1%) and --(SEA) /ΑΑ(Cd59) (0.1%). This data indicates that the molecular abnormalities of Α-thalassaemia in the Malaysian population is heterogenous. Although Α-gene deletion is the most common cause, non-deletional Α-gene abnormalities are not uncommon and at least 3 different mutations exist. Establishment of rapid and easy molecular techniques is important for definitive diagnosis of alpha thalassaemia, an important prerequisite for genetic counselling to prevent its deleterious complications.
    The Malaysian journal of pathology 04/2014; 36(1):27-32.
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Abstract Hb Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a rare hemoglobin (Hb) variant due to a mutation at codon 59 of the α2- or α1-globin gene resulting in a glycine to aspartic acid substitution. Two siblings with a unique coinheritance of Hb Adana and Hb Constant Spring (Hb CS, α142, Term→Gln, TAA>CAA; HBA2: c.427 T>C) (α(codon 59)α/α(CS)α), were compared phenotypically with another two siblings carrying the Hb Adana mutation and a 3.7 kb deletion (α(codon 59)α/-α(3.7)). Although they all had α-thalassemia intermedia (α-TI), the former were clinically more severe than the latter. The first pair of siblings presented at a much younger age than the second pair and showed lower Hb levels and significant extramedullay hemopoiesis. Another case of a hydropic fetus as a result of Hb H/Hb Adana is also described. Their clinical phenotypes and hematological parameters are all presented for comparison.
    Hemoglobin 05/2014; 38(4):1-5. DOI:10.3109/03630269.2014.916720 · 0.79 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Public Health Genomics 01/2015; 18(1):60-64. DOI:10.1159/000368342 · 2.21 Impact Factor