Interleukin-6 promoter polymorphism (-174 G/C) in Indian patients with chronic periodontitis.

Abstract

Recent studies have focused on genetic polymorphism of the interleukin-6 (IL-6) gene, which has led to a better understanding of the intricate interactions between host response, microorganisms, and genetics. Genotype prevalence appears to vary by the race and ethnicity of the population studied. We used a polymerase chain reaction technique to determine the prevalence of single nucleotide polymorphism in IL-6 at position -174 G>C in a population of 30 South Indians. Blood samples were collected from 15 chronic periodontitis patients and 15 healthy controls. The results showed that the G/G genotype was significantly more frequent in the chronic periodontitis group and that the C/C genotype was significantly more frequent in the control group (P = 0.0069 for both). The G allele was more frequent in chronic periodontitis patients (76.67%), whereas the C allele was more frequent in the control group (73.33%). Among chronic periodontitis patients, the odds ratio for having the G allele, as compared with the controls, was 9.04. In this population, the presence of the G/G genotype of IL-6 (-174) might increase susceptibility to chronic periodontitis, whereas the C/C genotype may have a protective effect.

Full text

Page 1

431
Abstract: Recent studies have focused on genetic
polymorphism of the interleukin-6 (IL-6) gene, which
has led to a better understanding of the intricate
interactions between host response, microorganisms,
and genetics. Genotype prevalence appears to vary by
the race and ethnicity of the population studied. We used
a polymerase chain reaction technique to determine the
prevalence of single nucleotide polymorphism in IL-6
at position -174 G>C in a population of 30 South
Indians. Blood samples were collected from 15 chronic
periodontitis patients and 15 healthy controls. The
results showed that the G/G genotype was significantly
more frequent in the chronic periodontitis group and
that the C/C genotype was significantly more frequent
in the control group (P= 0.0069 for both). The G allele
was more frequent in chronic periodontitis patients
(76.67%), whereas the C allele was more frequent in
the control group (73.33%). Among chronic
periodontitis patients, the odds ratio for having the G
allele, as compared with the controls, was 9.04. In this
population, the presence of the G/G genotype of IL-6
(-174) might increase susceptibility to chronic
periodontitis, whereas the C/C genotype may have a
protective effect. (J Oral Sci 52, 431-437, 2010)
Keywords: interleukin-6; single nucleotide
polymorphism; genotype; chronic
periodontitis.
Introduction
There has been considerable new evidence regarding the
pleiotropic role of interleukin-6 (IL-6) in host defense
(1,2). IL-6 has diverse functions, including differentiation
and activation of macrophages and T cells, and growth and
terminal differentiation of B cells. This cytokine has been
implicated in the pathogenesis of many inflammatory
diseases, such as psoriasis (3) and rheumatoid arthritis (4).
It is a major mediator of the host response to injury and
infection: high levels of IL-6 have been observed in patients
with infections, trauma, chronic inflammatory diseases, and
neoplasia (5).
IL-6 is produced by activated macrophages, lymphocytes,
and adipose tissue (6,7). In addition, it has been shown that,
by controlling the level of pro-inflammatory but not anti-
inflammatory cytokines, endogenous IL-6 plays a crucial
anti-inflammatory role in both local and systemic acute
inflammatory responses (8).
Gingivitis and periodontitis are infectious inflammatory
diseases of the periodontium initiated by microorganisms
Journal of Oral Science, Vol. 52, No. 3, 431-437, 2010
Original
Correspondence to Dr. Shivaprasad Bilichodmath, Department
of Periodontics, Rajarajeshwari Dental College and Hospital,
Bangalore, India
Tel: +91-80-26793637, +91-9900511071
Fax: +91-80-28437468
E-mail: drshivaprasad2008@yahoo.co.in
Interleukin-6 promoter polymorphism (-174 G/C) in
Indian patients with chronic periodontitis
Nagaraj B. Kalburgi1), Aman Bhatia2), Shivaprasad Bilichodmath3), Sudhir R. Patil4),
Sachin B. Mangalekar5)and Kishore Bhat6)
1)Department of Periodontics, PMNM Dental College and Hospital, Bagalkot, India
2)Department of Periodontics, Darshan Dental College, Udaipur, India
3)Department of Periodontics, Rajarajeshwari Dental College and Hospital, Bangalore, India
4)Department of Periodontics, KLE Dental College and Hospital, Bangalore, India
5)Department of Periodontics, Chattisgarh Dental College and Research Institute, Rajanandagaon,
Chattisgarh, India
6)Department of Periodontics, Maratha Mandal Dental College and Hospital, Belgaum, India
(Received 19 January and accepted 21 June 2010)

Page 2

432
present in susceptible individuals. Increased levels of
interleukin-6 have been found in gingival crevicular fluid
in patients with periodontitis (9). It has also been shown
that fibroblasts from patients with periodontal lesions
constitutively produced greater amounts of IL-6 than did
those from healthy controls (10).
IL-6 is considered a useful indicator of periodontal
disease (11,12), as levels of this cytokine are higher in sites
with gingivitis than in healthy sites (13-15). In addition,
higher expression of IL-6 mRNA was reported in diseased
tissues than in healthy tissues in patients with periodontitis
(16).
A number of studies have focused on the role of
interleukin-6 genetic polymorphism in inflammatory
systemic diseases and conditions (17-19). There is strong
evidence that genetic, as well as environmental factors
affect the age of onset, severity, and risk of developing
periodontitis (20-22). Studies have found an association
between the polymorphism in IL-6 at position -174 G>C
and periodontitis in different populations, including white
Brazilians (23), Southern Germans (24), Northern
Europeans (25), and white Europeans (26). The findings
of these studies are inconsistent, however, as some have
shown a positive association between this polymorphism
and the severity of periodontitis, while others have not. This
variation may be due to ethnic differences in the studied
populations. Therefore, more research on races from
different parts of the world is essential to understand the
association of IL-6 with periodontitis.
Using a polymerase chain reaction (PCR) technique, we
compared the prevalence of the single nucleotide IL-6
gene polymorphism (-174 G>C) in patients with chronic
periodontitis and in subjects with healthy periodontium.
To our knowledge, this is the first such study conducted
in a South Indian population.
Materials and Methods
The study population was selected randomly from
patients attending the outpatient section of the Department
of Periodontics, PMNM Dental College and Hospital,
Bagalkot, India from March to September of 2008. Venous
blood samples were collected from 15 randomly chosen
subjects with healthy periodontium (9 men and 6 women,
age range 32-41 years, mean age 36.73 ± 2.74 years) and
15 with chronic periodontitis (9 men and 6 women, age
range 33-49 years, mean age 39.20 ± 4.30 years).
Chronic periodontitis was diagnosed using the peri-
odontal disease classification system of the American
Academy of Periodontology (1999). Chronic periodontitis
patients were defined as those with periodontal pockets
greater than 5 mm and clinical attachment loss greater than
3 mm in more than 20 teeth, with moderate to severe bone
loss. All patients were systemically healthy and had not
received periodontal treatment or antibiotics for at least 6
months before the clinical examination and sampling.
Other exclusion criteria were diseases of the oral hard or
soft tissues, except caries; chronic use of anti-inflammatory
drugs; history of diabetes, hepatitis, or human immuno-
deficiency virus infection; history of any disease known
to severely compromise immune function; current
pregnancy or lactation; and history of smoking. Periodontal
evaluation included the oral hygiene index simplified,
gingival index, plaque index, probing pocket depth, and
clinical attachment loss.
Ethical clearance for the study was obtained from the
Ethical Review Board of the PMNM Dental College and
Hospital, Bagalkot, India, and the subjects who satisfied
the inclusion criteria of the study were selected. All
experiments on human subjects were conducted in
accordance with the Declaration of Helsinki, and all
procedures were carried out with the understanding and
written consent of the subjects.
Collection of samples
Venous blood samples (2 ml) were collected from the
antecubital fossa from all subjects, after obtaining their
consent to participate in the study. The whole blood
samples thus collected were transferred to aliquots con-
taining EDTA and sent to a laboratory for PCR analysis
of single nucleotide polymorphism of IL-6. The collection
of blood samples was approved by the ethical review
board.
DNA extraction
Approximately 100 µl of the blood sample was mixed
with Tris-EDTA (TE) buffer incubated for 5 min and then
washed repeatedly with the same buffer to obtain cell
sediment. Then, 400 µl of lysis buffer I (4 M guanidinium
thiocyanate, 0.5% N-lauroylsarcosine, 1 mM dithiothreitol,
25 mM sodium citrate, and 40 µg of glycogen/tube) was
added, incubated for 5 min, and centrifuged again. The
supernatant was discarded and lysis buffer II (Tris-HCL,
Nonidet-P40, Tween 20, and freshly prepared proteinase
K 100 µg/ml) was added to the sediment. The tubes were
kept at 65°C in a water bath for 2 h, followed by boiling
for 10 min. The tubes were cold-stored at -20°C until
processed by the PCR technique. DNA amplification was
done using hot-start PCR.
Primers
The PCR primers were synthesized with an Applied
Biosystems oligonucleotide synthesizer (Lab India

Page 3

433
Instruments Pvt. Ltd., Haryana, India). Primer pair 5’
TGACTTCAGCTTTACTCTTTGT 3’ and 5’
CTGATTGGAAACCTTAT TAAG 3’ was chosen for the
study.
DNA amplification
The amplification was performed with a Perkin-Elmer
Gene Amp PCR system 9600 (Lab Centraal BV, Haarlem,
Netherlands). Forty amplification cycles of 30 s at 94°C,
40 s at 60°C, and 50 s at 72°C were carried out with a final
volume of 50 µl containing 5 µl of 10x reaction buffer, 0.2
mM dNTP, 10 pmol of each of 12 primers, and 2.5 U of
cloned PfuDNA polymerase (Bangalore Genei, Bangalore,
India). Five microliters of appropriate DNA samples
(positive controls) were added to the reaction mixture. After
the final cycle, the samples were incubated for 15 min at
78°C to complete the extension of primers (27).
Confirmation of PCR products with restriction
enzyme
To the 10 µl of PCR reaction mixture, 16 µl of nuclease-
free water, 2 µl of 10x buffer tango, and 1-2 µl of SfaNI
enzyme (New England Biolabs, Lab Mate Asia Pvt. Ltd.,
Madras, India) was added. Then the mixture was gently
mixed and spun down for a few seconds. The mixture was
then incubated at 37°C for 1-6 h and thermal inactivation
was performed. SfaNI was inactivated by incubation at 65°C
for 20 min. SfaNI is an enzyme that cuts the DNA sequences
at GCATC (5/9) and is ideal for cleaving amplified products
of IL-6 into distinct fragments for identification of gene
polymorphism with the set of primers used in the study.
Ten microliters of each amplified product was analyzed
by agarose gel electrophoresis on 2% agarose (NUSIEVE
3:1; FMC, Rockland, ME, USA) containing 1 µg of
ethidium bromide/ml in 1x TBE buffer, and was visualized
in an ultraviolet transilluminator (Fotodyne, Hartland,
WI, USA)
Statistical analysis
The chi-square test was used to analyze the allele ratio
and genotype distribution of periodontitis patients and
healthy controls. Odds ratios were used to measure the
strength of the associations between risk factors and
outcome. A P value of <0.05 was considered significant.
STATA version 9.2 (STATA Corp LP, College Station,
TX, USA) was used for the analysis of the data; Microsoft
Word was used to generate the tables.
Results
This was a case-control study of 30 subjects divided into
2 groups. One group included 15 randomly chosen subjects
with healthy periodontium the other group consisted of 15
chronic periodontitis patients in the age range of 33-49 years
(mean age of 39.20 ± 4.30 years). The numbers of males
(n= 9) and females (n= 6) in both groups were equal. The
prevalence of the single nucleotide polymorphism of IL-
6 in the promoter region -174 (G>C) was compared.
The genotypes in subjects with healthy periodontium
were as follows (Table 1): G/G in 2, G/C in 4, and C/C in
9 subjects. The genotypes in the chronic periodontitis
patients were as follows (Table 1): G/G in 10, G/C in 3,
and C/C in 2 patients. There was a significant difference
in the distribution of the IL 6 -174 alleles between healthy
controls and periodontitis patients (P = 0.0069).
A significant (P < 0.01) difference between groups in
the frequencies of the G and C alleles was noted (Table
2). The G allele was found in 23 (76.67%) of 30 alleles
in the chronic periodontitis subjects (n = 15), and in 8
Table 1 Distribution of genotypes in patients with chronic periodontitis and controls
Table 2 Distribution of alleles in study subjects

Page 4

434
(26.67%) of 30 alleles in the control group. The frequency
of the C allele was greater in the control group: 22 (73.33%)
of 30 alleles in controls, as compared with 7 (23.33%) of
30 alleles in chronic periodontitis patients. For the G allele
versus the C allele, the odds ratio (chronic periodontitis
patients versus controls) was 9.04.
The distribution of genotypes by sex is listed in Table
3. Among the 18 men, 6 had the G/G genotype, 6 had G/C,
and 6 had C/C. Among the 12 women, 6 had the G/G
genotype, 1 had G/C, and 5 had C/C. The difference
between sexes was not statistically significant.
Discussion
To the best of our knowledge, this is the first study
conducted in a South Indian population of the prevalence
of single nucleotide polymorphism of IL-6 (-174 G>C) in
chronic periodontitis patients. Genetic polymorphism was
assessed using a PCR technique.
The overall genotype distribution was significantly
different between groups. The results showed that the
G/G genotype was more frequent in the periodontitis
group and that the C/C genotype was more frequent in
controls (P = 0.0069). Patients with periodontitis had a
significantly higher frequency of -174 G/G homozygosity
(66.67%) than did controls (13.33%), suggesting that the
-174 G/G genotype plays a role in the progression of
chronic periodontitis. Similar results were found in a study
by Trevilatto et al. (23), who reported that the G/G genotype
was significantly associated with susceptibility to chronic
periodontal disease. They suggested that the G allele plays
a role in the pathogenesis and development of periodontal
disease. The main finding of a study by Tervonen et al.
(28) was that in patients with periodontitis, the T allele of
CD14 -260 and the GG genotype of IL-6 -174 were
independently associated with advanced periodontal
disease, which is in agreement with the findings of the
present study. These findings also support the hypothesis
that a positive genotype predisposes individuals to
periodontitis. Recently, Costa et al. (29) suggested that the
IL-6 gene polymorphism may be associated with chronic
periodontitis in elderly patients. In another study, Nibali
et al. (30) provided support for the hypothesis that IL-6
gene polymorphisms and haplotypes are moderately
associated with periodontitis
In our study, the C/C genotype was more prevalent in
healthy subjects (60%) than in chronic periodontitis patients
(13.33%), indicating that this genotype might reduce
susceptibility to chronic periodontitis. A study conducted
by Fishman et al. (18) showed that patients with systemic-
onset juvenile arthritis had a lower frequency of the C/C
genotype, indicating that this genotype protects against the
development of this condition. However, in a study
conducted by Babel et al. (31), the -174 IL-6 CC genotype,
which codes for IL-6 low phenotypic production, was
more frequent in periodontitis patients than in controls (P
= 0.0283). Moreover, D’Aiuto et al. (32) found that high
serum levels of IL-6 in periodontitis patients were associated
with carriage of the C allele.
In the present study, the prevalence of the G/C genotype
was marginally higher in controls (26.67%) than in chronic
periodontitis patients (20.00%). Trevillato et al. (23)
reported similar results, namely, that the frequency of the
G/C genotype decreased as the severity of periodontal
disease increased: 58.3% with this genotype were healthy,
50% had moderately severe disease, and only 12.5% had
severe disease. Allele C might reduce IL-6 production,
which explains its protective function. However, the -174
G/C polymorphism was reported to influence the
development of septicemia in preterm infants (33), and
Holla et al. (34) found no association between this
polymorphism and chronic periodontitis in white Czechs.
In the present study, significant results were observed
in the distribution of G and C alleles (odds ratio for chronic
periodontitis patients versus controls, 9.04; P < 0.01).
The G allele was present in 76.67% of the alleles of chronic
periodontitis patients and in only 26.67% of those of
controls. Moreover, while the C allele was present in
73.33% of the alleles of controls, it was present in only
23.33% of the alleles of chronic periodontitis patients. Our
findings indicate that subjects with the G allele were at 9
times the risk for chronic periodontitis as those with the
C allele. In other studies, the -174 G allele was more
frequent in periodontitis patients than in healthy controls
(23,35). Moreira et al. (36) suggested that the G genotype
Table 3 Distribution of study subjects according to genotypes and gender

Page 5

435
reduced the severity of periodontitis in a Brazilian
population.
The C allele was associated with significantly lower levels
of plasma IL-6 in a study by Fishman et al. (18), who
maintained that a single nucleotide change from G to C
at position -174 results in suppression of IL-6 transcription
in response to lipopolysaccharide. The fact that the 115-
bp fragment does not elicit high basal expression suggests
that sequences between -225 and -164 exert a negative
influence on this promoter and thus a negative regulatory
effect on gene expression (37).
The results of studies associating genetic polymorphism
of the IL-6 gene and periodontitis are inconsistent. A
positive association of the single nucleotide polymorphism
of IL-6 (-174G>C) with the severity of periodontitis was
found in some studies, while other studies found no such
association (23-26). If the prevalence of this polymorphism
varies in different populations, the association with
susceptibility to periodontitis might also vary. This would
lead to discrepancies in genetic polymorphism studies
conducted on periodontitis patients of different ethnicities
and diverse genetic backgrounds. Apart from racial
differences, the differences might occur due to a number
of confounding factors, including clinical diagnoses,
environmental variables, biologic plausibility, penetrance,
and logic of association studies (38).
In conclusion, the results of the present study of South
Indian patients show that the G/G genotype is more frequent
in chronic periodontitis patients than in healthy controls,
and that the reverse is true for the C/C genotype. This
suggests that the G/G (-174) genotype of IL-6 cytokine
increases susceptibility to chronic periodontitis and that
the C/C genotype protects against the development and
progression of chronic periodontitis. The inconsistent
results yielded by studies of IL-6 polymorphisms emphasize
the need for more research on different populations with
diverse genetic backgrounds. If such research is conducted,
the association between chronic periodontitis and the
single nucleotide polymorphism in IL-6 at position -174
G>C can be characterized globally.
References
1. Van Snick J (1990) Interleukin-6: an overview.
Annu Rev Immunol 8, 253-278.
2. Akira S, Taga T, Kishimoto T (1993) Interleukin 6
in biology and medicine. Adv Immunol 54, 1-78.
3. Grossman RM, Krueger J, Yourish D, Granelli-
Piperno A, Murphy DP, May LT, Kupper TS, Sehgal
PB, Gottlieb AB (1989) Interleukin 6 is expressed
in high levels in psoriatic skin and stimulates
proliferation of cultured human keratinocytes. Proc
Natl Acad Sci U S A 86, 6367-6371.
4. Houssiau FA, Devogelaer JP, Van Damme J, de
Deuxchaisnes CN, Van Snick J (1988) Interleukin-
6 in synovial fluid and serum of patients with
rheumatoid arthritis and other inflammatory
arthritides. Arthritis Rheum 31, 784-788.
5. Hirano T, Akira S, Taga T, Kishimoto T (1990)
Biological and clinical aspects of interleukin 6.
Immunol Today 11, 443-449.
6. Yudkin JS, Kumari M, Humphries SE, Mohamed-
Ali V (2000) Inflammation, obesity, stress and
coronary heart disease: is interleukin-6 the link?
Atherosclerosis 148, 209-214.
7. Mohamed-Ali V, Goodrick S, Rawesh A, Katz DR,
Miles JM, Yudkin JS, Klein S, Coppacket SW
(1997) Subcutaneous adipose tissue releases
interlukin-6, but not tumor necrosis factor-alpha, in
vivo. J Clin Endocrinol Metab 82, 4196-4200.
8. Xing Z, Gauldie J, Cox G, Baumann H, Jordana M,
Lei XF, Achong MK (1998) IL-6 is an anti-
inflammatory cytokine required for controlling local
or systemic acute inflammatory responses. J Clin
Invest 101, 311-320.
9. Kurti¸ s B, Develio˘ glu H, Taner IL, Balo¸ s K, Tekin
IO (1999) IL-6 levels in gingival crevicular fluid
(GCF) from patients with non-insulin dependent
diabetes mellitus (NIDDM), adult periodontitis and
healthy subjects. J Oral Sci 41,163-167.
10. Dongari-Bagtzoglou AI, Ebersole JL (1998)
Increased presence of interleukin-6 (IL-6) and IL-
8 secreting fibroblast subpopulations in adult
periodontitis. J Periodontol 69, 899-910.
11. Geivelis M, Turner DW, Pederson ED, Lamberts BL
(1993) Measurements of interleukin-6 in gingival
crevicular fluid from adults with destructive
periodontal disease. J Periodontol 64, 980-983.
12. Reinhardt RA, Masada MP, Kaldahl WB, DuBois
LM, Kornman KS, Choi JI, Kalkwarf KL, Allison
AC (1993) Gingival fluid IL-1 and IL-6 levels in
refractory periodontitis. J Clin Periodontol 20, 225-
231.
13. Kono Y, Beagley KW, Fujihashi K, McGhee JR, Taga
T, Hirano T, Kishimoto T, Kiyono H (1991) Cytokine
regulation of localized inflammation. Induction of
activated B cells and IL-6 mediated polyclonal IgG
and IgA synthesis in inflamed human gingiva. J
Immunol 146, 1812-1821.
14. Matsuki Y, Yamamoto T, Hara K (1992) Detection
of inflammation cytokine messenger RNA (mRNA)-
expressing cells in human inflamed gingiva by
combined in situ hybridization and

Page 6

436
immunohistochemistry. Immunology 76, 42-47.
15. Takahashi K, Takashiba S, Nagai A, Takigawa M,
Myoukai F, Kurihara H, Murayama Y (1994)
Assessment of interleukin-6 in the pathogenesis of
periodontal disease. J Periodontol 65, 147-153.
16. Prabhu A, Michalowicz BS, Mathur A (1996)
Detection of local and systemic cytokines in adult
periodontitis. J Periodontol 67, 515-522.
17. Bonafè M, Olivieri F, Cavallone L, Giovagnetti S,
Mayegiani F, Cardelli M, Pieri C, Marra M,
Antonicelli R, Lisa R, Rizzo MR, Paolisso G, Monti
D, Franceschi C (2001) A gender-dependent genetic
predisposition to produce high levels of IL-6 is
detrimental for longevity. Eur J Immunol 31, 2357-
2361.
18. Fishman D, Faulds G, Jeffery R, Mohamed-Ali V,
Yudkin JS, Humphries S, Woo P (1998) The effect
of novel polymorphisms in the interleukin-6 (IL-6)
gene on IL-6 transcription and plasma IL-6 levels,
and an association with systemic-onset juvenile
chronic arthritis. J Clin Invest 102, 1369-1376.
19. Kiszel P, Fust G, Pessi T, Hurme M, Prohászka Z
(2006) Associations between interleukin-6 genetic
polymorphisms and levels of autoantibodies to 60-
kDa heat-shock proteins. Hum Hered 62, 77-83.
20. Michalowicz BS, Aeppli D, Virag JG, Klump DG,
Hinrichs JE, Segal NL, Bouchard TJ Jr, Pihlstrom
BL (1991) Periodontal findings in adult twins. J
Periodontol 62, 293-299.
21. Beaty TH, Boughman JA, Yang P, Astemborski JA,
Suzuki JB (1987) Genetic analysis of juvenile
periodontitis in families ascertained through an
affected proband. Am J Hum Genet 40, 443-452.
22. Kornman KS, Crane A, Wang HY, di Giovine FS,
Newman MG, Pirk FW, Wilson TG Jr, Higginbottom
FL, Duff GW (1997) The interleukin-1 genotype as
a severity factor in adult periodontal disease. J Clin
Periodontol 24, 72-77.
23. Trevilatto PC, Scarel-Caminaga RM, de Brito RB
Jr, de Souza AP, Line SRP (2003) Polymorphism
at position -174 of IL-6 gene is associated with
susceptibility to chronic periodontitis in a Caucasian
Brazilian population. J Clin Periodontol 30, 438-442.
24. Meiser H, Schöttler D, Genius J, Lichy C, Grau AJ,
Dörfer CE (2003) Polymorphism in the promoter
of interleukin-6 gene and periodontitis in a South
German population. J Dent Res 82, Spec B, Abstract
#2818.
25. Jansson H, Lyssenko V, Gustavsson A, Hamberg K,
Söderfeldt B, Groop L, Bratthall G (2006) Analysis
of the interleukin-1 and interleukin-6 polymorphisms
in patients with chronic periodontitis. A pilot study.
Swed Dent J 30, 17-23.
26. Groessner-Schreiber B, Jepsen S, Scholz C, Schaefer
C, Schenck K, Vander Velden U (2004)
Polymorphism in the IL-6 and FcγRIIIa genes in
aggressive periodontitis. J Dent Res 83, Spec B,
Abstract #0478.
27. Newton CR, Graham A (1997) PCR. 2nd ed, BIOS
Scientific, Oxford, 46-67.
28. Tervonen T, Raunio T, Knuuttila M, Karttunen R
(2007) Polymorphism in the CD14 and IL-6 genes
associated with periodontal disease. J Clin
Periodontol 34, 377-383.
29. Costa AM, Guimarães MC, de Souza ER, Nóbrega
OT, Bezerra AC (2010) Interleukin-6 (G-174C) and
tumor necrosis factor-alpha (G-308A) gene
polymorphisms in geriatric patients with chronic
periodontitis. Gerodontology 27, 70-75.
30. Nibali L, D’Aiuto F, Donos N, Griffiths GS, Parkar
M, Tonetti MS, Humphries SE, Brett PM (2009)
Association between periodontitis and common
variants in the promoter of the interleukin-6 gene.
Cytokine 45, 50-54.
31. Babel N, Cherepnev G, Babel D, Tropmann A,
Hammer M, Volk HD, Reinke P (2006) Analysis of
tumor necrosis factor-α, transforming growth factor-
β, interleukin-10, IL-6, and interferon-γ gene
polymorphisms in patients with chronic periodontitis.
J Periodontol 77, 1978-1983.
32. D’Aiuto F, Parker M, Brett PM, Ready D, Tonetti
MS (2004) Gene polymorphisms in pro-
inflammatory cytokines are associated with systemic
inflammation in patients with severe periodontal
infections. Cytokine 28, 29-34.
33. Harding D, Dhamrait S, Millar A, Humphries S,
Marlow N, Whitelaw A, Montgomery H (2003) Is
interleukin-6 -174 genotype associated with the
development of septicemia in preterm infants?
Pediatrics 112, 800-803.
34. Holla LI, Fassmann A, Stejskalová A, Znojil V,
Van˘ ek J, Vacha J (2004) Analysis of the interleukin-
6 gene promoter polymorphism in Czech patients
with chronic periodontitis. J Periodontol 75, 30-
36.
35. Brett PM, Zygogianni P, Griffiths GS, Tomaz M,
Parkar M, D’Aiuto F, Tonetti M (2005) Functional
gene polymorphisms in aggressive and chronic
periodontitis. J Dent Res 84, 1149-1153.
36. Moreira PR, Lima PMA, Sathler KOB, Imanishi SA,
Costa JE, Gomes RS, Gollob KJ, Dutra WO (2007)
Interleukin-6 expression and gene polymorphism are

Page 7

437
associated with severity of periodontal disease in a
sample of Brazilian individuals. Clin Exp Immunol
148, 119-126.
37. Ray A, Sassone-Corsi P, Sehgal PB (1989) A
multiple cytokine- and second messenger-responsive
element in the enhancer of the human interleukin-
6 gene: similarities with c-fos gene regulation. Mol
Cell Biol 9, 5537-5547.
38. Kinane DF, Hart TC (2003) Genes and gene
polymorphisms associated with periodontal disease.
Crit Rev Oral Biol Med 14, 430-449.