Development and Validation of Molecular Markers Closely Linked to H32 for Resistance to Hessian Fly in Wheat.

Abstract

Hessian fly [Mayetiola destructor (Say)] is an important insect pest of wheat (Triticum aestivum L.). Host resistance conferred by H genes has been the most effective means to manage Hessian fly populations. More than 32 H genes have been identified in wheat and its relatives. In a previous study, Hessian fly-resistance gene H32 was assigned to the chromosomal bin 3DL3–0.81–1.00, which also harbors H26. The objectives of this study were to develop and validate sequence-tagged site (STS) markers closely linked to H32 and to determine the genetic relationship between H26 and H32. In this study, 11 wheat EST-derived STS markers linked to H26 and three new STS markers were added to the linkage map of H32 using the International Triticeae Mapping Initiative (ITMI) population. Two of the STS markers, Xrwgs10 and Xrwgs12, were found to flank H32 with a genetic distance of 0.5 cM. Another STS marker Xrwgs11, co-segregated with H32. Molecular markers tightly linked to H32 were validated in 12 bread wheat cultivars and an elite breeding line, demonstrating the efficacy of these markers for marker-assisted selection. Comparative mapping analysis indicated that H26 and H32 are either different alleles at the same gene locus or two different, but tightly linked H genes. Ongoing efforts to perform fine mapping and positional cloning of H26 will resolve the relationship between H26 and H32.

Full text

Page 1

CROP SCIENCE, VOL. 50, JULY–AUGUST 2010 1325
RESEARCH
D
destructive insect pests of bread wheat and durum wheat (T. tur-
gidum L. var. durum) (Berzonsky et al., 2003; Harris et al., 2003;
Porter et al., 2009). To date, 32 Hessian fl y-resistance genes, desig-
nated H1 through H32, have been identifi ed in wheat and its rela-
tives (Berzonsky et al., 2003; Williams et al., 2003; Liu et al., 2005;
Sardesai et al., 2005; McIntosh et al., 2008). All 32 genes have been
mapped to various chromosomes across the A, B, and D genomes.
Wheat chromosome 1A harbors H5, H9, and H10 (Roberts and
Gallun, 1984; Liu et al., 2005; Kong et al., 2005). Wheat chromo-
some 5A carries 11 resistance genes, including H3, H6, H12, H14,
H15, H16, H17, H28, and H29 (McIntosh et al., 2008). Chromo-
some 2B has H20 and H21 (Amri et al., 1990a; Friebe et al., 1996)
eployment of resistance genes has been the most eff ec-
tive way to control the Hessian fl y, one of the world’s most
Development and Validation of Molecular
Markers Closely Linked to H32 for Resistance
to Hessian Fly in Wheat
Guo Tai Yu, Christie E. Williams, Marion O. Harris, Xiwen Cai, Mohamed Mergoum, and Steven S. Xu*
ABSTRACT
Hessian fl y [Mayetiola destructor (Say)] is an
important insect pest of wheat (Triticum aesti-
vum L.). Host resistance conferred by H genes
has been the most effective means to manage
Hessian fl y populations. More than 32 H genes
have been identifi ed in wheat and its relatives.
In a previous study, Hessian fl y-resistance
gene H32 was assigned to the chromosomal
bin 3DL3–0.81–1.00, which also harbors H26.
The objectives of this study were to develop
and validate sequence-tagged site (STS) mark-
ers closely linked to H32 and to determine the
genetic relationship between H26 and H32. In
this study, 11 wheat EST-derived STS mark-
ers linked to H26 and three new STS markers
were added to the linkage map of H32 using the
International Triticeae Mapping Initiative (ITMI)
population. Two of the STS markers, Xrwgs10
and Xrwgs12, were found to fl ank H32 with a
genetic distance of 0.5 cM. Another STS marker
Xrwgs11, co-segregated with H32. Molecular
markers tightly linked to H32 were validated in
12 bread wheat cultivars and an elite breeding
line, demonstrating the effi cacy of these mark-
ers for marker-assisted selection. Comparative
mapping analysis indicated that H26 and H32
are either different alleles at the same gene
locus or two different, but tightly linked H genes.
Ongoing efforts to perform fi ne mapping and
positional cloning of H26 will resolve the rela-
tionship between H26 and H32.
G.T. Yu and M.O. Harris, Department of Entomology, North Dakota
State University, Fargo, ND 58108; C.E. Williams, USDA-ARS, Crop
Production and Pest Control Research Unit, West Lafayette, IN 47907;
X. Cai and M. Mergoum, Department of Plant Sciences, North Dakota
State University, Fargo, ND 58108; S.S. Xu, USDA-ARS, Northern
Crop Science Laboratory, 1307 18th Street North, Fargo, ND 58105-
5677. Mention of trade names or commercial products in this article is
solely for the purpose of providing specifi c information and does not
imply recommendation or endorsement by the U.S. Department of
Agriculture. Received 7 Oct. 2009. *Corresponding author (steven.
xu@ars.usda.gov).
Abbreviations: EST, expressed sequence tag; ITMI, International
Triticeae Mapping Initiative; LOD, logarithm of odds; MAS, marker-
assisted selection; PCR, polymerase chain reaction; RILs, recombinant
inbred lines; RFLP, restriction fragment length polymorphism; SSR,
simple sequence repeat; STS, sequence-tagged site.
Published in Crop Sci. 50:1325–1332 (2010).
doi: 10.2135/cropsci2009.10.0580
Published online 21 May 2010.
© Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA
All rights reserved. No part of this periodical may be reproduced or transmitted in any
form or by any means, electronic or mechanical, including photocopying, recording,
or any information storage and retrieval system, without permission in writing from
the publisher. Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.

Page 2

1326
WWW.CROPS.ORG
CROP SCIENCE, VOL. 50, JULY–AUGUST 2010
while chromosome 5B carries H31 (Williams et al., 2003).
The wheat D genome also contains several Hessian fl y-
resistance genes, including H22 on chromosome 1D (Zhao
et al., 2006), H24, H26, and H32 on the long arm of 3D
(3DL) (Ma et al., 1993; Sardesai et al., 2005; Wang et al.,
2006), H7 on 5D (Amri et al., 1990b), and H13 and H23 on
6D (Gill et al., 1987; Ma et al., 1993).
The Hessian fl y-resistance gene H32, derived from
Aegilops tauschii Cosson, confers resistance to the highly
virulent Hessian fl y biotype L (Sardesai et al., 2005). It was
mapped to 3DL of synthetic wheat derived from a cross
between Ae. tauschii and durum wheat (Sardesai et al.,
2005). This gene was assigned to the chromosomal bin
3DL3–0.81–1.00 in the distal region of 3DL and is fl anked
by two simple sequence repeat (SSR) markers, Xgwm3 and
Xcfd223, at a genetic distance of 3.7 and 1.7 cM, respec-
tively (Sardesai et al., 2005). The map position of H32 was
determined based on the two SSR markers (Xgwm3 and
Xcfd223) and six restriction fragment length polymorphism
(RFLP) markers (Xfbb269, Xfba27, Xfba389, Xfbb316,
XksuE14, and XksuG59) previously assigned to the ITMI
framework map. Although the ITMI genome map is com-
posed of more than 1400 RFLP and SSR markers, many
RFLP marker locations were determined by mapping with
only a subset of the plants in the mapping population, giv-
ing an insuffi cient number of data points for accurate posi-
tioning. Data for four (Xfbb269, Xfba27, Xfba389, Xfbb316)
of the six RFLP markers used to construct the H32 linkage
map were missing data points for at least half of the 129
individuals in the mapping population. Thus, identifying
additional molecular marker loci near H32 was necessary
for more precisely positioning this gene within the chro-
mosomal region and to facilitate its utilization in wheat
breeding through marker-assisted selection (MAS).
H26 is another Hessian fl y-resistance gene that origi-
nated from Ae. tauschii (Cox and Hatchett, 1994). This
gene is particularly valuable for plant breeding programs
because it confers resistance to many of the world’s most
virulent Hessian fl y populations (El Bouhssini et al., 2008).
It confers resistance to biotype L and at least two other
biotypes, Great Plains and vH13 (Cox and Hatchett, 1994;
Wang et al., 2006; Xu et al., 2006). H26 was previously
mapped to chromosome 4D using monosomic analy-
sis (Cox and Hatchett, 1994). Molecular mapping reas-
signed H26 to chromosome 3DL and positioned this gene
to the chromosomal bin 3DL3–0.81–1.00 (Wang et al.,
2006). The two SSR markers, Xgwm3 and Xcfd223, which
fl ank H32 (Sardesai et al., 2005), were mapped to both
sides of H26 at a distance of 16.3 and 6.9 cM, respectively
(Wang et al., 2006). Because H26 and H32 reside in the
same chromosomal interval, clarifi cation of their physical
and genetic relationship is necessary before breeders can
decide whether the two genes might be stacked or pyra-
mided in a single wheat cultivar.
Recently, 26 STS marker loci were identifi ed within
the chromosomal region harboring H26. This was based on
two types of information, wheat expressed sequence tags
(ESTs) that were mapped to the chromosomal bin 3DL3–
0.81–1.00 and genomic sequences of Brachypodium dystachyon
and rice (Oryza sativa L.) that proved to be collinear with the
bin 3DL3–0.81–1.00 (Yu et al., 2009). Since both H26 and
H32 reside within the chromosomal bin 3DL3–0.81–1.00,
these 26 STS markers can be used to further resolve the
relationship between H26 and H32, with this benefi tting
MAS of Hessian fl y-resistance genes in wheat breeding. To
date, H26 and H32 have not been deployed in wheat cul-
tivars (Berzonsky et al., 2003). Validation of the molecular
markers tightly linked to H26 and H32 in wheat cultivars
or advanced breeding lines will have great benefi ts for plant
breeders who need genetic markers for MAS.
The objectives of this study were to: (i) identify and
develop STS molecular markers closely-linked to H32, (ii)
validate the molecular markers tightly linked to H32 in a
set of bread wheat cultivars and advanced breeding lines,
and (iii) determine the genetic relationship between H26
and H32 by comparative mapping.
MATERIALS AND METHODS
Plant Materials
Sardesai et al. (2005) used a subset of 129 of the 150 recom-
binant inbred lines (RILs; derived by single-seed descent to
the F8–9 generation) from the ITMI population for mapping
H32 to chromosomal bin 3DL3–0.81–1.00. The ITMI popula-
tion was developed from a cross of a synthetic hexaploid wheat
(SHW) line W7984 (Pedigree: Altar 84/Ae. tauschii WPI 219)
and spring wheat ‘Opata 85’ (Nelson et al., 1995). In this study,
we used 107 of the 129 RILs originally used for mapping H32
(Sardesai et al., 2005). DNA samples and phenotypic data of
these 107 RILs were obtained from the original study by Sarde-
sai et al. (2005). Each of the 107 lines is either homozygous
susceptible or homozygous resistant to Hessian fl y biotype L.
Sequence-Tagged Site Marker Identifi cation
and Linkage Analysis
To assign the 26 STS markers from the linkage map of H26
developed by Yu et al. (2009) to the linkage map of H32 in
the ITMI population, we fi rst screened for polymorphisms at
the marker loci between the two ITMI parents, W7984 and
Opata 85, and then analyzed these polymorphic markers on
the ITMI population. To develop additional markers linked to
H32, we tested 72 STS primer pairs and 11 single-nucleotide
polymorphism (SNP) primer pairs for polymorphisms between
the two parents. The 72 STS primer pairs were designed from
120 wheat EST sequences in the previous study (Yu et al.,
2009), and the 11 SNP primer pair sequences were downloaded
from the GrainGenes website (http://wheat.pw.usda.gov/SNP/
primers/contig_primer_list.xls). Bulked-segregant analysis was
conducted to identify STS markers linked to H32. Two pools of
DNA were generated by bulking equal amounts of DNA from
six homozygous resistant and six homozygous susceptible ITMI

Page 3

CROP SCIENCE, VOL. 50, JULY–AUGUST 2010
WWW.CROPS.ORG 1327
stunting of the youngest leaves and dead fi rst-instar larvae at the
base of the leaf sheathes were scored as resistant.
Three STS markers, Xrwgs10, Xrwgs11, and Xrwgs12, were
known to be tightly linked to H26 (Yu et al., 2009). The map
positions of these three markers relative to H32 were deter-
mined in the current study. The 12 wheat cultivars and the elite
breeding line, along with the resistant and susceptible checks
(W7984, Opata 85, and SW8), were used for validation analy-
sis of these three STS markers. The seeds of the cultivars and
lines were planted in 15.2-cm clay pots in a greenhouse with
photoperiods of 16:8 L:D. At the three-leaf stage, leaf samples
were taken and the genomic DNA was isolated using the proce-
dure described by Dellaporta et al. (1983). The PCR and elec-
trophoresis for genotyping of EST-derived STS markers were
conducted using the procedures described above.
RESULTS
Eleven of the 26 STS markers (Xrwgs1– Xrwgs26) from
the linkage map of H26 and three newly-developed STS
markers (Xrwgs5–2, Xrwgs15–2, and Xrwgs16–2) in this
study showed polymorphisms between W7984 and Opata
85, the two parents of the ITMI mapping population (Fig.
1). All 14 STS markers were assigned to the linkage map
of H32 using the ITMI population (Fig. 2). In addition,
we assigned two SSR markers (Xcfd223 and Xgwm3) to
this map. Thus, a linkage map, with 16 markers span-
ning a genetic distance of 53.7 cM, was constructed for
the genomic region harboring H32 within the chromo-
somal bin 3DL3–0.81–1.00 (Fig. 2, Table 1). This link-
age map represents an average density of one marker per
3.3 cM. All the STS markers assigned to the ITMI map
were codominant. Also most of the STS markers pro-
duced polymorphic bands with high intensity and large
size diff erences (Fig. 1). The band size of these markers
ranged from 124 to 1450 bp. Most of the primers gener-
ated polymorphic bands under 700 bp (Table 1).
Three STS markers, Xrwgs10, Xrwgs11, and Xrwgs12,
which fl anked H26, also fl anked H32 in the same ori-
entation (Fig. 2). Xrwgs10 was 3.2 cM proximal to H26
and Xrwgs11 and Xrwgs12, which co-segregated with each
other, were 1.0 cM distal to H26 on the linkage map con-
structed in the population of 96 F2 individuals (Fig. 2, Yu
et al., 2009). Both Xrwgs10 and Xrwgs12, however, were
0.5 cM away from H32 on both sides, and Xrwgs11 co-
segregated with H32 on the linkage map constructed in
the ITMI population of 107 RILs (Fig. 2).
To validate the effi cacy of the newly identifi ed STS
markers for MAS, we phenotyped and genotyped the elite
breeding line and 12 bread wheat cultivars and compared
them to the two resistant checks (W7984 and SW8). Eval-
uation showed that the elite breeding line and 12 wheat
cultivars were all susceptible to biotype L (Table 2), indi-
cating that none carry H32 or H26. At the three STS
marker loci that are most tightly linked to H32 and H26
(Xrwgs10, Xrwgs11, and Xrwgs12), the two resistant checks
RIL individuals, respectively. Positions of the linked markers
were verifi ed by mapping with the subset of 107 RILs from
the ITMI population. Two SSR markers, Xcfd223 and Xgwm3,
that were linked to H32 (Sardesai et al., 2005) were used as the
anchors in this study and their primer sequences were obtained
from the GrainGenes Database (http://wheat.pw.usda.gov/cgi-
bin/graingenes/browse.cgi?class=marker).
The STSs were amplifi ed according to optimized conditions
of polymerase chain reaction (PCR) (Yu et al., 2009). The SSRs
were amplifi ed as described by Röder et al. (1998). The PCR
products were separated on 6% nondenaturing polyacrylamide gels
in 0.5 X TBE buff er at 120W for 1 h. The gels were scanned with
a Typhoon 9410 variable mode imager (Molecular Dynamics,
Ithaca, NY) after staining with GelRed (Sigma, St. Louis, MO).
Linkage analysis was performed using MAPMAKER
2.0 (Lander et al., 1987) for Macintosh at LOD 6.0 with the
Kosambi mapping function (Kosambi, 1944).
Evaluation of Wheat Resistance to Hessian
Fly and Validation of Molecular Markers
Eleven hard red spring wheat cultivars including Alsen (Frohberg
et al., 2006), Faller (Mergoum et al., 2008), Glenn (Mergoum et al.,
2006b), Grandin (PI 531005), Howard (Mergoum et al., 2006c),
Len (CItr 17790), Parshall (PI 613587), Reeder (PI 613586), Russ
(PI 592785), Dapps (Mergoum et al., 2005a), and Steele-ND
(Mergoum et al., 2005b), one elite hard red spring wheat breeding
line ND735 (Mergoum et al., 2006a), and a winter wheat cultivar
Newton (CItr 17715) that is known to be susceptible to the Great
Plains biotype (Patterson et al., 1994; Anderson and Harris, 2006)
were used for validation of the markers closely linked to H26 and
H32. This validation tested for polymorphisms that would make
the markers useful in introgressing the resistance genes into this set
of valuable wheat germplasm for future development of cultivars
adapted to the northern Great Plains. The W7984 and Opata 85
(PI 591776) parents of the ITMI population and the SW8 parent
(containing H26) of the SHW population (Wang et al., 2006) were
included as checks in the validation analysis.
To determine whether the 12 wheat cultivars and the elite
breeding line used for marker validation had Hessian fl y resis-
tance, each was evaluated for reaction to Hessian fl y biotype L
along with the resistant and susceptible checks (W7984, Opata
85, and SW8). Six plants were evaluated for each line. One seed
was sown in each super-cell cone (Stuewe and Sons, Inc., Cor-
vallis, OR) fi lled with Sunshine SB100 Mix (Sun Gro Horti-
culture Distribution Inc., Bellevue, WA), with an application of
Osmocote Plus 15–19–12 fertilizer (Scotts Sierra Horticultural
Product Company, Marysville, OH). At the three-leaf stage, 96
seedlings were infested for 24 h with mated Hessian fl y females
(n = 40) under a tent made from a blue cotton sheet. Seventy-
two hours after eggs were oviposited, plants were transferred to
a high humidity chamber (60% RH, 25°C, 16:8 L:D). Forty-
eight hours after the eggs hatched, plants were transferred to the
greenhouse at 25°C, with a photoperiod of 16:8 h L:D and 30%
RH. Fifteen days after infestation, the plants were scored for
resistance or susceptibility (Cartwright and LaHue, 1944; Ander-
son and Harris, 2006, 2008). Plants that had stunted growth of
the youngest leaves and live larvae or pupae at the base of the leaf
sheathes were scored as susceptible. Plants that had little or no

Page 4

1328
WWW.CROPS.ORG
CROP SCIENCE, VOL. 50, JULY–AUGUST 2010
(W7984 and SW8) contained the same alleles, whereas
the susceptible check (Opata 85) contained the alterna-
tive alleles (Table 2 and Fig. 3). The elite breeding line
and 12 bread wheat cultivars contained the same marker
alleles as the susceptible check (Opata 85) at the marker
loci Xrwgs11 and Xrwgs12. However, they all possessed a
unique allele, diff erent from those of both resistant and
susceptible checks at locus Xrwgs10 (Table 2 and Fig. 3).
DISCUSSION
The ITMI population has been widely used in the study of
wheat genetics (Gupta et al., 2002; Lohwasser et al., 2005;
Röder et al., 1998; Sardesai et al., 2005). However, relative
to the homeologous chromosomes 3A and 3B, the long arm
of chromosome 3D, particularly its distal region, has fewer
PCR-based markers in both the consensus map (Somers et
al., 2004) and the composite map (http://wheat.pw.usda.
gov/cmap/). Through the development of STS markers in
the present study, we successfully mapped 14 STS markers
onto this less-known region of the wheat genome using the
ITMI population, substantially increasing marker density.
The 14 newly-found markers will be useful tools for genetic
studies of several important genes, such as Lr24 for resistance
to leaf rust (Puccinia triticina Erikss) (Boyko et al., 1999) that
have been found in this region of the wheat genome.
Hessian fl y-resistance gene H32 was previously placed
between two SSR markers, Xgwm3 and Xcfd223, which
were 3.7 and 1.7 cM from H32, respectively (Sardesai et
al., 2005). In the present study, the three newly developed
EST-derived STS markers mapped between these two SSR
markers. One of them, Xrwgs11, co-segregated with H32
and the other two, Xrwgs10 and Xrwgs12, were positioned to
each side of H32 at a distance of 0.5 cM (Fig. 2). In addition,
the three STS markers were closely linked to H26.
Fig. 1. Codominant sequence-tagged site (STS) markers.
Amplicons of 14 codominant STS markers were separated
on polyacrylamide gels and generated polymorphic bands
distinguishing the W7984 (lane 1) and Opata 85 (lane 2) parents of
the ITMI mapping population. Lanes three through eight contain
samples from the International Triticeae Mapping Initiative (ITMI)
mapping population with the parental marker genotypes. Arrows
indicate size of polymorphic bands.
Fig. 2. Genetic maps showing the locations of H32 and H26.
Markers common to the consensus genetic map of 3D (left),
genetic map of 3DL harboring H32 (middle), and genetic map of
3DL harboring H26 (right) are indicated. Marker loci are listed to
the right and centiMorgan (cM) distances to the left.

Page 5

CROP SCIENCE, VOL. 50, JULY–AUGUST 2010
WWW.CROPS.ORG 1329
The Hessian fl y-resistance gene H32 in the SHW line
W7984 was derived from the Ae. tauschii accession CIae
18 (WPI 219; Sardesai et al., 2005) while the H26 in the
SHW line SW8 was derived from the Ae. tauschii acces-
sion CIae 25 (Wang et al., 2006). Both of the parent SHW
lines contain the same alleles at the three STS marker
loci: Xrwgs10, Xrwgs11, and Xrwgs12. On the other hand,
the elite breeding line and 12 common wheat cultivars,
which were all susceptible to Hessian fl y biotype L, all
contained the same marker alleles at the Xrwgs10, Xrwgs11,
and Xrwgs12 loci. These alleles diff er from the alleles pos-
sessed by the two resistant lines. This demonstrates that
the three markers provide uniquely divergent Ae. tauschii-
derived alleles that will be useful for MAS in a large set
of bread wheat breeding lines during introgression of
the two genes. However, due to lack of polymorphism
between the resistance sources of H26 and H32, the three
STS markers are not useful in pyramiding H26 and H32
into one wheat cultivar. Thus, additional mapping eff orts
are needed to develop tightly linked molecular markers
that are unique to each of the genes.
Table 1. Sequence-tagged site (STS) markers developed from wheat expressed sequence tags (ESTs) and Brachypodium
genomic sequences.
STS marker PCR primersAT† (°C)
55
Band size
(W7984/Opata85)
960/966
EST accession or
genomic group‡
BE404125
Xrwgs1
GCTGTCGCACAAGCAATAAA
CGGCCCGTACAGAAGTGTAT
GTTCTCGGCATCAATCACCT
AGAGCTATGCCCATGGTGAC
TGGTGGGATTTCTTATCATCTGAC
CCATCACGTACACCAGCATC
CCGAGGACGTCGAGAAAAAC
CCGAGGACGTCGAGAAAAAC
CCTAACTGAGGTCCCACCAA
GCAAAGGACTTGATGCCTGT
GGAGAGTCGCAGGATCCA
TCTCTGCCCAGTCCAACTTT
CGTATCGGCGACAAGGTAAT
ACTGGAAGAAGCCCCAGTCT
GAGGCCATCAAGTCCAAGTT
TGGGTTCGTGAAGAAAAAGC
GCCTCGTCCACTACCAGAAG
AAACATGCACCGACACAAGA
CTCTTCGTCCCTGTGGTGAT
GCTTCGTATTCTACATAAGCACGC
GGAGAAGCATCACAAGCACA
TCCTTCATCTTGTGCGACCT
ACAATGGCTAGCTATGGAGATGT
CGTTCACGCACGAGTAAAAC
CTCAAGGACCTGCTGGAGAC
ATCTAGAGGCGCGACAAAAA
TCGACTTCAGGAGCCACTTT
CACGTTCAGGAACTGCTTCA
Xrwgs5
55 594/617BG262734
Xrwgs5–2
55886/900 BG262734
Xrwgs7
57 301/294BE444335
Xrwgs10
55 837/856
Brachypodium Super contig 13
Xrwgs11
55 1450/1165BE403428
Xrwgs12
55 270/247BE426418
Xrwgs15
55618/673BE426763
Xrwgs15–2
55 464/431BE426763
Xrwgs16–2§
55289/302BG608151
Xrwgs21
55519/882 BE446756
Xrwgs22
55539/526BE444579
Xrwgs23
55536/529 BE489841
Xrwgs25
55 124/133BM137927
†Annealing temperature.
‡Wheat EST accessions were obtained from website: http://wheat.pw.usda.gov/cgi-bin/westsql/map_locus.cgi (verifi ed on 21 Apr. 2010).
§Primer sequences were obtained from website: http://wheat.pw.usda.gov/SNP/primers/contig_primer_list.xls (verifi ed on 21 Apr. 2010).
Table 2. Reaction of 16 wheat genotypes to Hessian fl y bio-
type L and band size at three marker loci.
Cultivar/line
SW8
W7984
Opata 85
Reeder
Alsen
Parshall
Glenn
Howard
Steele-ND
Grandin
Russ
Newton
Faller
Len
Dapps
ND735
Reaction to
Hessian fl y†
R
R
S
S
S
S
S
S
S
S
S
S
S
S
S
S
Band size (bp)
Xrwgs11
1450
1450
1165
1165
1165
1165
1165
1165
1165
1165
1165
1165
1165
1165
1165
1165
Xrwgs10
837
837
856
846
846
846
846
846
846
846
846
846
846
846
846
846
Xrwgs12
257+270
257+270
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
247+260
†Reaction to Hessian fl y: R = resistant, S = susceptible.