Near-infrared fluorescent proteins. Nat Methods

Shemiakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Science, Moscow, Russia.
Nature Methods (Impact Factor: 32.07). 10/2010; 7(10):827-9. DOI: 10.1038/nmeth.1501
Source: PubMed

ABSTRACT Fluorescent proteins with emission wavelengths in the near-infrared and infrared range are in high demand for whole-body imaging techniques. Here we report near-infrared dimeric fluorescent proteins eqFP650 and eqFP670. To our knowledge, eqFP650 is the brightest fluorescent protein with emission maximum above 635 nm, and eqFP670 displays the most red-shifted emission maximum and high photostability.

36 Reads
  • Source
    • "A plasmid containing cDNA copy of recombinant VSV-XN2-ΔM51 genome (VSV Indiana serotype) (Lawson et al., 1995; Wollmann et al., 2010) was kindly provided by Jack Rose (Yale University). A pUC57 plasmid encoding near-infrared fluorescent protein eqFP650 was designed based on the published eqFP650 sequence (accession HQ148301) (Shcherbo et al., 2010) and was purchased from Genscript. The pUC57-eqFP650 plasmid contains a T7 promoter, a XhoI site, and a Kozak consensus sequence upstream of the eqFP650 start site (TAATACGACTCACTATAGGGAGACTCGAGCCACCATG). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Virus-encoded tumor suppressor p53 transgene expression has been successfully used in vesicular stomatitis virus (VSV) and other oncolytic viruses (OVs) to enhance their anticancer activities. However, p53 is also known to inhibit virus replication via enhanced type I interferon (IFN) antiviral responses. To examine whether p53 transgenes enhance antiviral signaling in human pancreatic ductal adenocarcinoma (PDAC) cells, we engineered novel VSV recombinants encoding human p53 or the previously described chimeric p53-CC, which contains the coiled-coil (CC) domain from breakpoint cluster region (BCR) protein and evades the dominant-negative activities of endogenously expressed mutant p53. Contrary to an expected enhancement of antiviral signaling by p53, our global analysis of gene expression in PDAC cells showed that both p53 and p53-CC dramatically inhibited type I IFN responses. Our data suggest that this occurs through p53-mediated inhibition of the NF-κB pathway. Importantly, VSV-encoded p53 or p53-CC did not inhibit antiviral signaling in non-malignant human pancreatic ductal cells, which retained their resistance to all tested VSV recombinants. To the best of our knowledge, this is the first report of p53-mediated inhibition of antiviral signaling, and it suggests that OV-encoded p53 can simultaneously produce anticancer activities while assisting, rather than inhibiting, virus replication in cancer cells. Copyright © 2015 Elsevier Inc. All rights reserved.
    Virology 05/2015; 483:126-140. DOI:10.1016/j.virol.2015.04.017 · 3.32 Impact Factor
  • Source
    • "Recent developments in these fields are already providing indications on the future avenues of IVM studies. For example, fluorescent proteins emitting in the near-infrared region (such as Neptune [53] and eqFP650/670 [54]) and the infrared region (such as iRFP [123,124]) are becoming popular because they are more efficiently excited and detected in living tissues, where light scattering, autofluorescence and absorption are highest at lower wavelengths [125,126]. These proteins have so far been successfully used for whole-body imaging experiments in mice [53,54,123,124] and more sensitive near-infrared photomultipliers (PMTs) built into confocal microscopes will make them promising candidates also for single-cell resolution in vivo imaging approaches. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Intravital microscopy has become increasingly popular over the past few decades because it provides high-resolution and real-time information about complex biological processes. Technological advances that allow deeper penetration in live tissues, such as the development of confocal and two-photon microscopy, together with the generation of ever-new fluorophores that facilitate bright labelling of cells and tissue components have made imaging of vertebrate model organisms efficient and highly informative. Genetic manipulation leading to expression of fluorescent proteins is undoubtedly the labelling method of choice and has been used to visualize several cell types in vivo. This approach, however, can be technically challenging and time consuming. Over the years, several dyes have been developed to allow rapid, effective and bright ex vivo labelling of cells for subsequent transplantation and imaging. Here, we review and discuss the advantages and limitations of a number of strategies commonly used to label and track cells at high resolution in vivo in mouse and zebrafish, using fluorescence microscopy. While the quest for the perfect label is far from achieved, current reagents are valuable tools enabling the progress of biological discovery, so long as they are selected and used appropriately.
    Interface focus: a theme supplement of Journal of the Royal Society interface 06/2013; 3(3):20130001. DOI:10.1098/rsfs.2013.0001 · 2.63 Impact Factor
  • Source
    • "We used lentiviral transduction to establish populations of HeyA8 cells stably expressing CXCL12 fused to Gaussia luciferase (HeyA8-CXCL12-GL), unfused Gaussia luciferase (Hey-GL), and firefly luciferase and green fluorescent protein (GFP) (HeyA8-FL/GFP) [18], [19]. We also transduced HeyA8-CXCR4-CBRN/Ar-CBC and HeyA8-CXCL12-GL cells with fluorescent protein eqFP650 [20]. Figure 1 shows a list of stably transduced cells used in this study (Fig. 1A). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Chemokine CXCL12 and receptor CXCR4 have emerged as promising therapeutic targets for ovarian cancer, a disease that continues to have a dismal prognosis. CXCL12-CXCR4 signaling drives proliferation, survival, and invasion of ovarian cancer cells, leading to tumor growth and metastasis. Pleiotropic effects of CXCR4 in multiple key steps in ovarian cancer suggest that blocking this pathway will improve outcomes for patients with this disease. To quantify CXCL12-CXCR4 signaling in cell-based assays and living mouse models of ovarian cancer, we developed a click beetle red luciferase complementation reporter that detects activation of CXCR4 based on recruitment of the cytosolic adapter protein β-arrestin 2. Both in two-dimensional and three-dimensional cell cultures, we established that bioluminescence from this reporter measures CXCL12-dependent activation of CXCR4 and inhibition of this pathway with AMD3100, a clinically-approved small molecule that blocks CXCL12-CXCR4 binding. We used this imaging system to quantify CXCL12-CXCR4 signaling in a mouse model of metastatic ovarian cancer and showed that treatment with AMD3100 interrupted this pathway in vivo. Combination therapy with AMD3100 and cisplatin significantly decreased tumor burden in mice, although differences in overall survival were not significantly greater than treatment with either agent as monotherapy. These studies establish a molecular imaging reporter system for analyzing CXCL12-CXCR4 signaling in ovarian cancer, which can be used to investigate biology and therapeutic targeting of this pathway in cell-based assays and living mice.
    PLoS ONE 01/2013; 8(1):e51500. DOI:10.1371/journal.pone.0051500 · 3.23 Impact Factor
Show more