Content uploaded by Yiumo Michael Chan
Author content
All content in this area was uploaded by Yiumo Michael Chan on Jul 20, 2018
Content may be subject to copyright.
Fukutin-related protein is essential for mouse
muscle, brain and eye development and mutation
recapitulates the wide clinical spectrums
of dystroglycanopathies
Yiumo Michael Chan1,
{
, Elizabeth Keramaris-Vrantsis1,
{
, Hart G. Lidov2, James H. Norton3,
Natalia Zinchenko4, Helen E. Gruber4, Randy Thresher5, Derek J. Blake6, Jignya Ashar1,
Jeffrey Rosenfeld1,
{
and Qi L. Lu1,∗
1
McColl-Lockwood Laboratory for Muscular Dystrophy Research, Neuromuscular/ALS Center, Carolinas Medical
Center, Charlotte, NC 28231, USA,
2
Department of Pathology, Children’s Hospital, Boston, MA 02115, USA,
3
Biostatistics Core Facility, Carolinas Medical Center, Charlotte, NC 28231, USA,
4
Orthopaedic Biology Research
Laboratory, Carolinas Medical Center, Charlotte, NC 28231, USA,
5
Animal Models Laboratory, University of North
Carolina, Chapel Hill, NC 27599, USA and
6
MRC Centre for Neuropsychiatric Genetics and Genomics, Department of
Psychological Medicine and Neurology, Cardiff University, Henry Wellcome Building, Heath Park, Cardiff F14 4XN, UK
Received April 15, 2010; Revised and Accepted July 20, 2010
Mutations in fukutin-related protein (FKRP) cause a common subset of muscular dystrophies characterized
by aberrant glycosylation of alpha-dystroglycan (a-DG), collectively known as dystroglycanopathies. The
clinical variations associated with FKRP mutations range from mild limb-girdle muscular dystrophy type 2I
with predominantly muscle phenotypes to severe Walker–Warburg syndrome and muscle – eye – brain dis-
ease with striking structural brain and eye defects. In the present study, we have generated animal models
and demonstrated that ablation of FKRP functions is embryonic lethal and that the homozygous-null
embryos die before reaching E12.5. The homozygous knock-in mouse carrying the missense P448L mutation
almost completely lacks functional glycosylation of a-DG in muscles and brain, validating the essential role
of FKRP in the functional glycosylation of a-DG. However, the knock-in mouse survives and develops a wide
range of structural abnormalities in the central nervous system, characteristics of neuronal migration
defects. The brain and eye defects are highly reminiscent of the phenotypes seen in severe dystroglycano-
pathy patients. In addition, skeletal muscles develop progressive muscular dystrophy. Our results confirm
that post-translational modifications of a-DG are essential for normal development of the brain and eyes.
In addition, both the mutation itself and the levels of FKRP expression are equally critical for the survival
of the animals. The exceptionally wide clinical spectrums recapitulated in the P448L mice also suggest the
involvement of other factors in the disease progression. The mutant mouse represents a valuable model
to further elucidate the functions of FKRP and develop therapies for FKRP-related muscular dystrophies.
INTRODUCTION
The dystrophin–glycoprotein complex (DGC) at the sarco-
lemma provides a physical linkage between the actin
cytoskeleton and the extracellular matrix (ECM) that is crucial
for the maintenance of muscle membrane stability (1,2). It is
well established that disruption of this linkage causes different
forms of muscular dystrophies (3). Dystroglycan (DG) is an
†
Present address: UCSF, Division of Neurology, Fresno, California.
‡
These authors contributed equally to this work.
∗
To whom correspondence should be addressed. Tel: +1 7043556427; Fax: +1 7043551679. Email: qi.lu@carolinashealthcare.org
#The Author 2010. Published by Oxford University Press. All rights reserved.
For Permissions, please email: journals.permissions@oxfordjournals.org
Human Molecular Genetics, 2010, Vol. 19, No. 20 3995–4006
doi:10.1093/hmg/ddq314
Advance Access published on July 30, 2010
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
essential component of the DGC (4,5). The polypeptide is post-
translationally cleaved into two closely associated subunits of
DG: a-DG and b-DG (6). a-DG is extensively
glycosylated with both N- and O-linked glycans and acts as a
cellular receptor for laminin and other ECM proteins,
including agrin, perlecan, neurexin and pikachurin (7–13).
The function of a-DG and its interaction with ECM proteins
largely depend on O-linked glycosylation in the mucin-like
domain (central region) of the polypeptide (2,14,15). Although
DG was originally characterized in skeletal and cardiac muscles,
it also plays an important role in the development of the brain,
eye and peripheral nerves (16 –20).
Recently, a subset of muscular dystrophies, known as dystro-
glycanopathies, has been characterized by a common secondary
defect in DG glycosylation. The defect is the result of
autosomal-recessive mutations in at least six different genes
(21). Examples of these include fukutin-related protein
(FKRP), fukutin,LARGE,POMGnT1,POMT1 and POMT2.
A number of studies have suggested that these genes are
involved in post-translational modifications of a-DG (22–28).
POMT1, POMT2 and POMGnT1 were shown to initiate the
first two steps of the O-mannosylation pathway, a unique type
of O-linked glycosylation in a-DG (25,29). There is also evi-
dence to support LARGE being a glycosyltransferase (30–
32). In contrast, the functions of FKRP are largely unknown.
Although mutations in the gene are associated with hypoglyco-
sylation of a-DG, there is no biochemical data to support its
direct involvement in a-DG modifications (33).
The clinical spectra of dystroglycanopathies can vary
considerably. The severe end of the spectrum consists of
Walker–Warburg syndrome (WWS) caused by mutations in
the POMT1 and POMT2 genes, muscle–eye–brain (MEB)
disease caused by mutations in the POMGnT1 gene and
Fukuyama congenital muscular dystrophy caused by
mutations in the fukutin gene. These disorders show significant
defects, including distinctive structural changes in the brain
(cobblestone type II lissencephaly) and eye (retinal hypopla-
sia), in the central nervous system (CNS) and frequently
result in early lethality. Mutations in some of the dystroglyca-
nopathy genes are often associated with variable clinical
severity. In particular, genetic defects in FKRP have been
reported to cause clinically distinct diseases from WWS and
MEB to less severe congenital muscular dystrophies
(MDC1C) with or without CNS involvement and mild limb-
girdle muscular dystrophy type 2I (LGMD2I) with predomi-
nantly myopathic phenotypes (34 –36). Cardiomyopathy is
also observed in some LGMD2I patients (37,38). Recent
studies of FKRP-related muscular dystrophies have not been
able to establish a clear genotype – phenotype correlation to
account for these variations (39). In addition, the levels of
a-DG glycosylation determined by immunostaining of
muscle biopsies were shown to vary in patients (39,40). Fur-
thermore, a recent study has reported that a knock-in mouse
model with a homozygous missense Y307N mutation
[together with a neomycin-resistance (Neo
r
) cassette] in the
FKRP gene expresses relatively abundant functional a-DG,
but the animals died at or soon after birth, raising the question
of whether FKRP is essential for functional glycosylation of
a-DG and the possibility that other factors might also influ-
ence disease severity (41).
In this study, we generated two mouse models using
both knock-in and knockout technologies to investigate the
functional roles of FKRP in muscular dystrophies. First, we
engineered a missense P448L mutation in the mouse Fkrp
gene. This mutation was previously associated with MDC1C
(28,36) and shown to affect the localization of the FKRP
protein (42,43). The homozygous knock-in mice are viable
and recapitulate the variable clinical phenotypes of
FKRP-associated muscular dystrophies. Besides the dys-
trophic pathology in skeletal muscles, the mutant animals
also develop striking abnormalities in the brain and eyes,
associated with severe forms of dystroglycanopathies. Bio-
chemical analysis showed that a-DG is not functionally glyco-
sylated as determined by the loss of its glyco-epitope and
laminin-binding capability. On the other hand, deletion of
the C-terminal consensus DxD motif in FKRP resulted in
early embryonic lethality. Together, our findings clearly
demonstrate an important role of FKRP during both embryo-
nic and post-embryonic development of muscles and CNS.
The abnormalities observed in the mutant mice support the
current hypothesis that FKRP is essential for the functional
modifications of a-DG. However, the significant upregulation
of b
1
-integrin in the mutant muscles suggests that other factors
may also be responsible for the wide variation in disease
severity. The homozygous P448L mice are highly valuable
not only for elucidating the disease mechanism and pro-
gression in long-term studies, but also for developing thera-
peutic strategies for FKRP-related muscular dystrophies in
the future.
RESULTS
Generation of FKRP knock-in and deletion mice
To generate the knock-in animal model, we designed a target-
ing vector containing a C1343T point mutation in the exon 3
of the mouse Fkrp gene. The resulting missense mutation
changed the amino acid at the position 448 from proline to
leucine (P448L). The Neo
r
was inserted in the intron 2 and
flanked by two loxP and FRT recognition sites (Fig. 1A – C).
Targeted ES cells were identified by polymerase chain reac-
tion (PCR) and confirmed by Southern blots prior to injection
to the blastocytes (Supplementary Material, Fig. S1A). The
entire coding region of FKRP of all positive ES clones was
sequenced to confirm the P448L mutation. Germline-
transmitted heterozygous mice were obtained and cross-bred
to generate homozygous FKRP knock-in mice (referred to as
FKRP-neo-P448L/FKRP-neo-P448L or FKRP-neo-P448L
mutant mice hereafter). The genotype of the mice was ident-
ified by allele-specific PCR primers that can distinguish the
wild-type from the targeted FKRP alleles (Supplementary
Material, Fig. S1B). Integration of the targeting vector to the
FKRP locus was re-confirmed by PCR, using one primer
matching the genomic sequence not included in the targeting
vector and the other matching the Neo
r
sequence (Supplemen-
tary Material, Fig. S1C). The engineered P448L mutation was
further confirmed by genomic DNA sequencing. As several
studies have recently shown that both FKRP and sarcoglycan
knock-in mouse models did not develop phenotypes after
3996 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
removal of the Neo
r
cassette, we have decided to retain the
Neo
r
cassette in the targeted FKRP alleles (41,44,45).
FKRP deletion mice were generated by removing the FKRP
coding sequence from amino acid E310 to the TGA stop codon
in the targeting vector (Fig. 1D – E). The C terminus of FKRP
contains a consensus DxD motif commonly found in other
glycosyltransferases. As this motif is generally thought to be
critical for the function of proteins, we expect that the deletion
of the C-terminal end of FKRP would lead to loss of the
protein function. The functional knockout homozygote is
referred to as E310del/E310del.
FKRP-null mice are embryonic lethal
Heterozygous E310del/wt mice were fertile and phenotypi-
cally normal as judged by visual examination and muscle
histology. Western blot analysis demonstrated that the levels
of functional glycosylation of a-DG in the heterozygous
muscles were similar to that of wild-type muscles (data not
shown). However, we were not able to obtain homozygous
mutants from cross-breeding of heterozygous mice (Table 1,
E310del/E310del). Genotype analysis of the embryos of
different stages suggested that the homozygous E310del
mutation caused early embryonic lethality (Supplementary
Material, Fig. S1D and Table 1, E310del/E310del).
Phenotypes of homozygous FKRP-neo-P448L
knock-in mice
Heterozygous FKRP-neo-P448L/wt mice showed no obvious
physical or behavioral abnormalities when compared with wild-
type mice. The number of FKRP-neo-P448L homozygous
mutant mice born from mating of heterozygous parents
roughly followed the Mendelian ratio (Table 1, P448L/
P448L). However, approximately one-third of the mutant
mice died at birth or within 2 days. The remaining animals sur-
vived beyond 6 months. The mutant mice were visibly smaller
than their wild-type and heterozygous siblings at birth and
remained 20% smaller by weight (P¼0.0002) throughout
adulthood (Fig. 2A and Supplementary Material, Fig. S2).
Muscle weakness became evident in the mutant mice as early
as 2 weeks and was demonstrated by the abnormal retracting
position of the hind limbs when the mice were suspended by
the tails (Fig. 2B and C). The dystrophic phenotypes in
muscles were consistent with elevated serum creatine kinase
(CK) levels in the mutant mice and 10 times (8260 units/l,
P¼0.0024) higher than the wild-type controls (770 units/l;
Supplementary Material, Fig. S3). The levels of alanine trans-
aminase (ALT) were also significantly higher in the mutant
mice. The results of blood urea nitrogen (BUN), alkaline phos-
Figure 1. Schematic diagram of targeting strategy. (A) Wild-type FKRP
alleles. Non-coding exon 2 and coding exon 3 of mouse FKRP gene are
depicted by open boxes. The direction of translation is denoted by right-angle
arrow. Dashed line represents genomic sequence not included in the targeting
vector. Allele-specific PCR primer sets for genotyping wild-type allele are
designated by opposite arrows (8010/PT5 and 4714/rN374). Probe PB3/4
was used to identify positive ES clones in Southern blots of genomic DNA
digested with EcoRV (E). (B) P448L targeting vector. The long arm (LA)
and short arm (SA) are represented by double arrows. The floxed neomycin-
resistant (Neo
r
) cassette was inserted 5′of the FKRP coding sequence and
flanked by two loxP and FRT recognition sites (open arrowheads). The star
in exon 3 denotes the P448L missense mutation. (C) P448L targeted allele
after homologous recombination. Allele-specific PCR primer sets for genotyp-
ing P448L allele are designated by opposite arrows (F3/PT5 and A1/UNI).
Note the presence of a new EcoRV (E) site in the Neo
r
cassette.
(D) E310del targeting vector. The star in exon 3 denotes the truncated E310
deletion in which the FKRP coding sequence after amino acid E310 was
removed. The floxed Neo
r
cassette was inserted 3′of the remaining FKRP
coding sequence. (E) E310del targeted allele after homologous recombination.
Allele-specific PCR primer set for genotyping E310del allele is designated by
opposite arrows (4714/Neo1).
Table 1. Genotype analysis of progeny from heterozygous parents
E310del/E310del
a
Genotypes
Age # Embryos WT het mutant
E7.5 31 7 16 8
E8.5 29 10 11 8
E9.5 10 0 9 1
E10.5 7 3 4 0
E12.5 6 1 5 0
Adults 24 11 13 0
P448L/P448L
b
Genotypes
No. of females:
no. of males
WT het mutant
79: 74 47 (2) 93 (3) 31 (13)
P448L/E310del
c
Genotypes
No. of females:
no. of males
wt/wt P448L/wt E310del/wt mutant
23: 15 12 12 12 3 (2)
WT, wild-type; het, heterozygous; mutant, homozygous mutants.
a
Interbreeding of heterozygous E310del/wt mice. Embryos between E7.5 and
E12.5 were dissected from uteri of the mothers and genotyped by allele-specific
PCR. Wild-type or heterozygous embryos were morphologically normal.
Homozygous mutant embryos were generally disorganized and resorbed.
b
Interbreeding of heterozygous FKRP-neo-P448L/wt mice. Genotypes of
wild-type, heterozygous and homozygous mutant (FKRP-neo-P448L/
FKRP-neo-P448L) mice were determined by allele-specific PCR. Numbers in
parentheses represent number of mice died at birth or within 2 days after birth.
c
Generation of compound heterozygous FKRP-neo-P448L/E310del mice.
Heterozygous FKRP-neo-P448L/wt and E310del/wt mice were phenotypically
normal.
Human Molecular Genetics, 2010, Vol. 19, No. 20 3997
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
phatase (ALP) and cholesterol tests did not reveal major differ-
ences between the mutant and wild-type littermates. The other
noticeable physical abnormality in more than half of the
mutant mice was cranial deformation associated with enlarged
skull and outward bulging of parietal bone (Fig. 2D and E).
Complete examination of the brains revealed the formation of
expanded lateral ventricles filled with cerebrospinal fluid,
suggesting that the animals suffered from hydrocephalus.
Other skeleton bones appeared to be normal as judged by
visual examination and X-ray. The FKRP-neo-P448L homozy-
gous mutant mice also developed eye abnormalities by 3 – 4
weeks old. The size of the two eyes varied (Fig. 2F) with a haze-
like appearance in the affected eye, indicative of corneal opaci-
fication. The ocular and brain abnormality did not seem to pro-
gress further as the mice aged.
Levels of FKRP transcripts reduce in mutant mice
and vary by tissues and ages
The presence of the Neo
r
cassette can affect the expression of
the targeted gene and the disease severity/phenotype can be
influenced by the level of gene expression (46). As detection
of endogenous FKRP protein is difficult to achieve (43), we
performed quantitative real-time PCR to assess FKRP
expression in the mutant animals using RNAs extracted from
quadriceps, gastronemius and heart. The results showed that
the levels of FKRP transcripts in the FKRP-neo-P448L
mutant mice were reduced to 55% (P¼0.02) compared
with the wild-type controls (Fig. 2G, Supplementary Material,
Fig. S4). On the other hand, the expression of other genes
involved in dystroglycanopathies, such as fukutin,LARGE
and dystroglycan, was not significantly changed in the
mutant animals. Comparison of FKRP expression in different
tissues revealed that the levels of FKRP mRNA in heart were
3-fold higher than those in skeletal muscles (Fig. 2H, P,
0.005, Supplementary Material, Fig. S4). In addition, FKRP
expression decreased significantly over time between 5 and
15 weeks in all three tissues examined (Fig. 2I, P,0.05).
Al together, the expression data suggested that FKRP gene
undergoes complex regulation during development and aging.
Dystrophic pathology in skeletal muscles
of FKRP-neo-P448L mutant mice
The neonatal FKRP-neo-P448L mutant mice that died at birth
or immediately after birth showed no obvious pathological
changes in skeletal muscles, the heart and diaphragm
(Supplementary Material, Fig. S5). However, when the
mutant mice were examined at the age of 5 weeks and
older, hallmark features characteristics of muscular dystro-
phies became evident in all skeletal muscles, including tibialis
anterior, quadriceps, gastronemius, intercostals, biceps and
diaphragm (Fig. 3A). The pathological changes included vari-
ations in fiber sizes and presence of groups of necrotic fibers
(stars) and central nuclei (arrow), indicating muscle degener-
ation and regeneration. These features of degeneration and
regeneration were seen in nearly all cross-sections of
muscles, but we also found focal areas with fibers of relatively
normal size and without internalized nuclei and necrosis. Infil-
tration of mononuclear cells (arrowhead) and increased inter-
stitial space were observed clearly only in the areas with large
number of necrotic fibers. Fibrosis was not obvious in muscles
of mutant mice at the age of 5 weeks, but became apparent at
the age of 10 weeks or older as demonstrated by Trichrome
Figure 2. Phenotypes of FKRP-neo-P448L mutant mice. (A) The mutant
mouse of 12 weeks old was visibly smaller than the age-matched wild-type
(wt) littermate. (Band C) FKRP-neo-P448L mutant mouse displayed clasping
of hind limbs as soon as it was suspended by the tail. (Dand E) Digital X-ray
images showing an enlarged and deformed skull of the mutant mouse. The
wild-type (D) and mutant mice (E) were both 10-week-old male. (F) Eye
abnormality in 14-week-old FKRP-neo-P448L mutant mouse. Note the size
difference between the two eyes. The affected eyes were usually larger. (G)
Relative FKRP expression in wild-type (wt, n¼4), heterozygous (het, n¼
6) and homozygous FKRP-neo-P448L (P448L, n¼6) mice by quantitative
RT–PCR analysis. The number of mice analyzed is denoted by n. The
levels of reduction in FKRP expression were nearly identical in quadriceps,
gastronemius and heart and individual results obtained from each tissue
were combined to reflect the overall changes in FKRP expression among
the genotypes. Expression of FKRP in wild-type mice was normalized to
1. Statistically significant changes (P¼0.02) are obtained only between wild-
type and mutant mice. (H) FKRP expression in gastronemius, heart and quad-
riceps. All three genotypes showed an 3 – 4-fold increase in FKRP
expression in heart compared with skeletal muscles. Graph was tabulated
from the combined results of wild-type and heterozygous mice, demonstrating
the relatively higher levels of FKRP mRNA in heart (P,0.005). Ten and six
animals were analyzed for FKRP expression in gastronemius/heart and
quadriceps, respectively (I) FKRP expression in muscle and heart of
5–15-week-old mice. Graph was tabulated from the combined results of wild-
type (n¼4) and heterozygous mice (n¼6). Note that FKRP expression in
both gastronemius and heart followed similar trend of reduction over time.
The combined data has a P-value of ,0.05. Error bars represent mean +
SEM.
3998 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
staining (Supplementary Material, Fig. S6). Muscle fiber
degeneration, inflammatory infiltration and increased fibrotic
tissues were, in general, more pronounced in the diaphragm.
In contrast, H&E and Trichrome staining did not reveal dys-
trophic phenotypes in the heart of the FKRP-neo-P448L mice
up to 10 months of age (Fig. 3A). Kidney and liver were unaf-
fected as examined by histology and this was corroborated
with normal serum levels of ALP and BUN (Supplementary
Material, Fig. S3). No pathological changes were observed in
muscles of the wild-type or heterozygous littermates.
Ultrastructural analysis of quadriceps from the FKRP-
neo-P448L mutant mice showed enlarged mitochondria
(Fig. 3B, stars). This is consistent with previous reports that
the presence of swollen mitochondria might represent a second-
ary response to muscle degeneration in other muscle diseases
(47). We also observed significant numbers of degenerating
vacuoles, especially beneath the sarcolemma (Fig. 3B, stars).
In addition, the sarcolemma appeared to be less uniform in the
mutant muscle fibers. Some areas along the sarcolemma were
discontinuous and lacked the plasma membrane (arrow). Con-
sistent with the elevated serum CK levels, the electron micro-
scopic findings suggested an underlying defect in the muscle
membrane of the FKRP-neo-P448L mice.
Loss of functional a-DG glycosylation in FKRP-neo-P448L
mutant mice
In view of the proposed function of FKRP in a-DG glycosy-
lation, we examined the muscle tissues of the FKRP-neo-
P448L mutant mice with monoclonal IIH6C4 and VIA4-1
antibodies. These two antibodies detect undefined
glyco-epitopes of a-DG. The epitope(s) also overlaps with
the laminin-binding site on the a-DG protein (2). Western
blot analysis revealed an almost complete absence of
IIH6C4 and VIA4-1 signals in both skeletal and cardiac
muscles (Fig. 4A and B). The laminin-binding activity of
a-DG was also nearly abolished in the mutant skeletal and
cardiac muscles as demonstrated by laminin overlay assay
(Fig. 4A and D). This was in contrast to the normal functional
glycosylation of a-DG in the muscles of wild-type and hetero-
zygote littermates. The steady-state levels of a-DG in the
FKRP-neo-P448L mutant mice did not change compared
with the wild-type and heterozygous controls as judged by
two different anti-a-DG antibodies (a-DG and DAG-1)
(Fig. 4A). As both a-DG and b-DG are post-translationally
cleaved from a single polypeptide, these results are consistent
with the notion that FKRP primarily affects glycosylation of
a-DG, but not the protein levels.
The lack of functional glycosylation of a-DG was con-
firmed by immunofluorescent studies. Immunolabeling with
both IIH6C4 and VIA4-1 antibodies was absent in all
muscles of the FKRP-neo-P448L mutant mice (Fig. 5and
Supplementary Material, Fig. S7). However, we did not
observe a reduction of laminin a2 staining in the mutant
muscles (Fig. 5). Staining for b-DG and dystrophin was
normal in the mutant muscles. Groups of fibers with strong
signals covering the whole fiber cross-section were detected,
indicating severe membrane leakage with circulating
Figure 3. (A) H&E staining of different tissues of wild-type (wt, left column),
heterozygous (het, middle column) and homozygous FKRP-neo-P448L mice
(right column). Tissues shown in the figure (across each row) were quadriceps,
tibialis anterior (TA), diaphragm, heart and kidney taken from 10-week-old
males. Note the presence of necrotic fibers (asterisk), central nuclei (arrow)
and infiltration of mononuclear cells (arrowhead) in the skeletal muscles of
the FKRP-neo-P448L mutant mice. Bar, 200 mm. (B) Ultrastructural analysis
of FKRP-neo-P448L skeletal muscle. Quadriceps from 5-week-old wild-type
(left column) and FKRP-neo-P448L mutant mice (right column) were exam-
ined by electron microscopy. Enlarged mitochondria in the FKRP-neo-P448L
muscle are represented by asterisks. Note that the vacuoles (denoted by stars)
underneath the plasma membrane are frequently found in the vicinity of other
mitochondria. Arrow points to the disrupted area in the electron-dense sarco-
lemma. Bar, 1 mm in upper panel; 200 nm in lower panel.
Human Molecular Genetics, 2010, Vol. 19, No. 20 3999
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
IgGs inside the degenerating fibers (Fig. 5, arrowhead). This
observation supports the finding of EM that the sarcolemmal
structure is compromised in the mutant muscles.
Given the critical role of the DGC in muscular dystrophies,
we also compared the expressions of dystrophin, dysferlin
and dystrobrevin among the three genotypes and found no
obvious changes in their protein levels (Fig. 4A). On the
other hand, we observed a dramatic upregulation (.10
folds) of b
1
-integrin in the skeletal muscles, but not in the
heart of the mutant mice (Fig. 4A and Supplementary
Material, Fig. S8). As laminin a2 expression was unaffected
in the FKRP-neo-P448L mutant mice, the increased levels of
b
1
-integrin could compensate for the lack of functional DGC
as suggested by Kaufman and his colleagues (48 –50).
Further, western blot analysis of brain extracts also demon-
strated that a-DG was aberrantly glycosylated in the
FKRP-neo-P448L mice (Fig. 4C). The immunoreactivity of
IIH6C4 and VIA4-1 antibodies and the laminin-binding
activity were nearly absent in all mutant brains similar to
that in muscles (Fig. 4E).
FKRP-neo-P448L mutant mice display multiple
developmental defects in the CNS
As dystroglycanopathy patients of severe phenotypes show
distinct CNS abnormalities, we analyzed the brains of the
FKRP-neo-P448L mutant mice. By visual examination, gross
structural abnormalities were noted in the brains of the
mutant mice ranging from newborn to 15 weeks old
(Fig. 6A). The surface of the mutant brains had a smoother
appearance reminiscent of cobblestone type II lissencephaly
(five out of six examined). The appearance of brainstem was
abnormal and did not assume the typical elongated structure,
which is in consistent with the MRI findings in severe dystro-
glycanopathy patients (51). Hydrocephalus was also a
common feature in the mutant mice (four out of six examined).
Figure 4. Western blot and laminin overlay analysis of skeletal muscle, heart
and brain of FKRP-neo-P448L mutant mice. (A) Quadriceps from four wild-
type (lane W), six heterozygous (lane H) and six FKRP-neo-P448L mutant
(lane M) mice aged 5 –15 weeks were analyzed. Immunoreactivity of
IIH6C4 and VIA4-1 antibodies and laminin-binding activity for a-DG were
significantly reduced in the mutant muscle. The levels of b-DG were assessed
by both b-DG (DSHB) and DAG-1 (Sigma) antibodies. Note the dramatic
upregulation of b
1
-integrin in the mutant muscle. Other skeletal muscles,
including TA, gastronemius and diaphragm, were also analyzed with identical
results. The antibodies used in western blots were listed in Supplementary
Material, Table S1. (B) Western blots of heart. (C) Western blots of brain.
Note that the two bands shown in the dystrophin blot represent full-length dys-
trophin and its brain isoform Dp140. (Dand E) Laminin overlay analysis of
the heart and brain, respectively.
Figure 5. Immunofluorescence images of wild-type (wt, left column), hetero-
zygous (het, middle column) and FKRP-neo-P448L mutant muscle (right
column). Tissues shown in the figure (across each row) were heart, quadriceps,
and diaphragm taken from 12-week-old mice. Immunostaining with IIH6C4
antibody was completely absent in the mutant muscle. Arrowhead indicates
the degenerating fibers stained with goat-anti-mouse Igs Alexa594. In con-
trary, labeling intensity for laminin a2 in the FKRP-neo-P448L mutant
muscle was normal and uniform at the sarcolemma compared with the wild-
type and heterozygous muscles. Small fibers and central nucleation (blue
spots, DAPI staining) were clearly visible in the FKRP-neo-P448L mutant
muscle. Bar, 50 mm.
4000 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
Histological studies revealed characteristic signs of
abnormal migration of neurons in the cerebral cortex of
FKRP-neo-P448L mutant mice. The interhemispheric fissure
was fused characteristic of human polymicrogyria (Fig. 6B,
arrowhead). The lateral ventricles became expanded (stars),
consistent with the presence of hydrocephalus. The cortical
laminar structures were disorganized such that the boundary
between molecular layers I (MLI) and MLII was consistently
obscured in most of the mutant brains examined (Fig. 6C)
although areas which appeared to have normal laminar organ-
ization also existed. All wild-type and heterozygous litter-
mates displayed normal cytoarchitecture.
The structural defects in cerebellum were striking in the
FKRP-neo-P448L mice (six examined) and consistent with
neuronal migration defects (Fig. 6B). The architecture of the
cerebellar folia was highly distorted and partly fused
(Fig. 6D). Neurons from the granular layer frequently
formed clusters at the sub-plial layers between two adjacent
folia (arrow). This result is consistent with recent MRI
studies, showing that this part of the brain is highly susceptible
to the changes in FKRP-related muscular dystrophies (51).
The hippocampus appeared to be moderately affected in
some older mutant mice. Portion of the dentate gyrus was
duplicated and not folded properly into the typical V-shape
layer as reported in other animal models (Fig. 6E;52 –54).
However, normal hippocampal architecture was observed in
three out of six mutant animals examined.
Histological analysis also demonstrated structural abnorm-
alities in the eyes of the FKRP-neo-P448L mutant mice indica-
tive of hypotrophy. The retina is typically organized into
distinct layers but was disrupted in the mutant mice
(Fig. 7A). Both the outer nuclear layer (ONL) and inner
nuclear layer (INL) were thinner in the mutant mice than
those of the wild-type or heterozygote mice. The ganglion
cell layer (GCL) and inner limiting membrane were disrupted
in the presence of ectopic cells outside the membrane. The
optic nerves were generally smaller in the mutant mice, and
cellular components were clearly disorganized near the
retina (Fig. 7B).
DISCUSSION
One of the challenges to understand the role of FKRP in mus-
cular dystrophies is the lack of appropriate mouse models. Here
we report the generation of two FKRP mouse models. While the
homozygous FKRP deletion mice cause embryonic lethality,
the homozygous FKRP-neo-P448L mice are viable and
develop muscle weakness and wasting soon after birth. Patho-
logical findings are consistent with a severe progressive dystro-
phy. Biochemical and immunochemical analyses demonstrate a
marked decrease in a-DG staining using glycan-specific
IIH6C4 and VIA4-1 antibodies. The laminin-binding activity
of a-DG is also reduced to barely detectable levels in both
muscles and brain, indicating that a-DG is not functionally gly-
cosylated. The integrity of the sarcolemma appears to be com-
promised as supported by elevated serum CK levels and
ultrastructural studies. These results are consistent with a desta-
bilized linkage due to the loss or reduced binding of a-DG to
laminin in the ECM. Thus, our knock-in animal model confirms
a critical role of FKRP in muscle survival and function and
supports the current hypothesis that FKRP is involved in the
post-translational modifications of a-DG.
The FKRP E310del mice carried a deletion of the C termi-
nus, including the consensus DxD motif, which is thought to
be responsible for the glycosyltransferase activity in many
enzymes. Genotype analysis reveals that the homozygous –
null embryos died before reaching E12.5. Recent reports
have also documented that fukutin – null and POMT1 – null
embryos did not survive beyond E9.5, suggesting a functional
link between these genes (55,56). The effects of FKRP on
development are likely also mediated by the loss of a-DG gly-
cosylation in the embryos because Dag1 – null embryos dis-
played gross abnormalities as early as E6.5 (57). Together,
these findings indicate that a complete loss of FKRP protein/
function is incompatible with survival and is in agreement
with the observations that no homozygous FKRP – null
mutation has ever been identified in humans. Given that
both wild-type and truncated E310 FKRP proteins were
secreted equally well to the cultured medium when expressed
in CHO cells (58), these results suggest that the underlying
defects of the E310 deletion were probably due to the loss
of an important function associated with the C terminus of
FKRP rather than altered trafficking or localization.
In an attempt to modulate the severity and phenotypes of the
FKRP mice, we generated compound heterozygous mutations
by cross-breeding the heterozygous FKRP-neo-P448/wt mice
with the heterozygous E310del/wt mice. Unlike the homozy-
gous FKRP-neo-P448L mice, the number of compound het-
erozygous FKRP-neo-P448L/E310del mice did not achieve a
Mendelian distribution (Table 1, P448L/E310del). Only a
few mutant mice were born and they died at birth. The
severe phenotypes were consistent with the observations that
the E310 deletion (embryonic lethal) is more deleterious
than the P448L missense mutation (viable) when presented
in homozygous state. Other lines of evidence also suggest
that the severity of disease may be influenced by both the
FKRP mutation itself and the level of expression. The
expression of FKRP transcripts in both FKRP-neo-P448L
and FKRP-Neo
Y307N
mice is reduced to approximately half
of the levels present in the wild-type mice but yet resulting
in different degrees of severity (41). In addition, FKRP
expression in mice carrying the homozygous missense L276I
mutation (with Neo
r
cassette) is also decreased by 45%,
but the animals do not present any obvious disease phenotypes
(Y. Chan, personal observation). In view of these results, it
becomes evident that, besides the levels of FKRP expression,
the nature of the mutations also plays a critical role in deter-
mining the phenotypic variations of different FKRP mutant
mouse models. Clinically, L276I and P448L mutations are
associated with relatively mild LGMD2I (59) and severe
MDC1C phenotypes (28,36), respectively. The Y307N
mutation is known to cause MEB in human (34,60). The cor-
relation between phenotype and genotype in these three lines
of mice, therefore, roughly follows a similar trend parallel to
patients with the corresponding FKRP mutations.
In this study, we found that the CNS of the mutant
FKRP-neo-P448L mice show striking abnormalities re-
miniscent of some human dystroglycanopathy patients.
The primary brain defects include cobblestone (type II)
Human Molecular Genetics, 2010, Vol. 19, No. 20 4001
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
lissencephaly and hydrocephalus. The layering and architec-
ture of both cerebral cortex and cerebellum are highly disorga-
nized and characterized by abnormal neuronal migration.
Prominent ocular defects and retinal malformations are also
consistent features of the mutant mice. Structural defects of
the hippocampus are also observed. Similar pathological fea-
tures are also shared by other animal models of dystroglycano-
pathy, including FKRP-Neo
Y307N
, fukutin chimera,
POMGnT1-null, LARGE
myd
and MORE-DG null mice
(19,41,52–54). Taken together, these results provide strong
evidence that proper a-DG glycosylation is essential for corti-
cogenesis and normal eye development. In addition, the patho-
logical similarities also support the argument that FKRP
participates with other glycosyltransferases in common path-
ways involving a-DG modification.
However, the importance of functional glycosylation of
a-DG in the pathogenesis of FKRP-related muscular dystro-
phies is not clearly understood. Previous studies have
suggested that the levels of a-DG glycosylation do not
always correlate with clinical severity in patients with FKRP
and fukutin mutations (39), and significant amount of function-
ally glycosylated a-DG can be detected in both LGMD2I and
severe MDC1C muscles (39,40). To add complexity, a recent
study by Ackroyd et al. (41) reported that FKRP-Neo
Y307N
mice express relatively abundant functional a-DG, but the
animals died at or soon after birth. In contrast, functional
glycosylation of a-DG is barely detectable in all tissues in
the FKRP-neo-P448L mutant mice but some of them have
survived more than 10 months, so far. Interestingly, despite
the loss of a-DG glycosylation, the heart is spared of patho-
logical changes in the homozygous FKRP-neo-P448L mutant
mice and this might contribute to their overall survival.
Taken together, these results suggest that FKRP could have
other unknown functions and that factors other than glycosyla-
tion of a-DG are also important for modulating disease
severity. Supporting this view, the expression levels of several
proteins known to cause muscular dystrophies were found to
differ between the FKRP-neo-P448L mutant mice and other
dystroglycanopathy animal models. For example, the levels
and staining pattern of a-2 laminin are unaffected in the
FKRP-neo-P448L mutant muscles in contrast to the reduced
expression reported in the FKRP-Neo
Y307N
and LARGE
myd
mice (41,54). The levels of several DGC proteins are increased
in the skeletal muscles of LARGE
myd
mice, but not in the
FKRP-neo-P448L mutant mice. On the other hand, b
1
-integrin
is significantly upregulated in the FKRP-neo-P448L mutant
Figure 6. (A) Stereoimages of wild-type (wt) and FKRP-neo-P448L mutant brains. The surface of normal brain was covered with folds and grooves. In contrast,
the brain of 7-week-old FKRP-neo-P448L mutant mouse had a smoother surface with obscured longitudinal fissure. Arrowheads indicate the collapsed cortex
after the withdrawn of the fluid from the enlarged lateral ventricles (see B). (B) Coronal sections of wild-type (wt) and FKRP-neo-P448L mutant brains were
stained with H&E. The gross architect of cerebellum is disorganized in the mutant brain. Note the fusion of the interhemispheric fissure (arrowhead) and the
enlarged lateral ventricles (asterisk). (C) Sagittal sections of cerebral cortex of 7-week-old FKRP-neo-P448L mutant mouse were stained with cresyl violet.
The MLI layers in age-matched wild-type and heterozygous (het) brains were easily distinguished from the MLII layers and contained fewer neurons and
appeared less dense. Note the diffused boundary between MLI and II layers in the mutant brain. (D) Sagittal sections of cerebellum of wild-type and
FKRP-neo-P448L mutant mice (1, 5 weeks; 2, 14 weeks) were stained with cresyl violet. Arrow denotes the presence of granule neurons between two adjacent
folia. Note that the cerebellar lobules were fused in the mutant mice. (E) Sagittal sections of hippocampus of wild-type and FKRP-neo-P448L mutant mice
(P448L 3, 5 weeks) were stained with cresyl violet. There were only subtle abnormalities in the hippocampus of the mutant mice. Note the wavy structure
in the dentate gyrus of mutant mice of 15 weeks old (P448L 4).
4002 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
muscles, but its levels are unaffected in the POMGnT1 – null
myoblasts (61). Thus, it is plausible that different secondary
pathways may be activated in response to the nature of the
mutation, thereby partly contributing to the overall phenotypes
in each animal model. Clearly, these observations require
further investigation.
In summary, our FKRP knock-in mouse model develops
muscle and CNS phenotypes accompanied by severe reduction
in functional glycosylation of a-DG and recapitulates the wide
clinical spectra associated with FKRP mutations in dystrogly-
canopathy patients. The FKRP-neo-P448L knock-in mice cer-
tainly add to the growing list of animal models for
dystroglycanopathies. To the best of our knowledge, our
FKRP-neo-P448L mutant mice are the first viable mouse
model reported for FKRP-related muscular dystrophies. In
the future, it will be possible to generate compound heterozy-
gous mutations of different severity by cross-breeding the
FKRP-neo-P448L mice with mice carrying other FKRP
mutations. Such animal models will be valuable for dissecting
the molecular mechanisms and developing therapies tailored
for specific FKRP mutations.
MATERIALS AND METHODS
Generation of FKRP animal models
Knock-in mice were generated by inGenious Targeting Lab-
oratory (Stony Brook, NY, USA). The targeting vector
(Fig. 1B) was engineered with a c.1343C.T point mutation,
resulting in an amino acid change from proline to leucine at
position 448. The Neo
r
cassette was placed in the intron 2
about 140 bp upstream of the coding exon 3. The construct
was designed such that the short homology arm (SA)
extends 3 kb away from the Neo
r
cassette, and the long hom-
ology arm (LA) extends 4 kb 3′to the point mutation intro-
duced in exon 3. The targeting vector was electroporated
into iTL BA1 (C57BL/6NX129/SvEv) embryonic stem cells,
and the correctly targeted ES clones were microinjected into
C57BL/6N blastocysts to produce chimeric mice. Germline-
transmitted heterozygous FKRP-neo-P448L/wt mice were
obtained by breeding male chimeras with female C57BL/6N
mice. FKRP deletion mice were generated using similar
approaches by the Animal Models Laboratory at the Univer-
sity of North Carolina, Chapel Hill. The coding region from
amino acid E310 to TGA stop codon at position 495 was
deleted in the targeting vector, and the Neo
r
cassette was
placed in the 3′UTR region (Fig. 1D). All mice were
housed in the vivarium of Carolinas Medical Center according
to animal care guidelines of the institute. All animal studies
were approved by the Institutional Animal Care and Use Com-
mittee of Carolinas Medical Center.
Genotyping of FKRP mice
Genotypes of the offspring from crossing of heterozygous
FKRP-neo-P448L/wt mice were determined by allele-specific
PCR using genomic DNA extracted from mouse tails. The
primers for amplifying the wild-type allele (Fig. 1A) are
8010 (forward): AGTGGTCTGTTTAGGGCAGG and PT5
(reverse): CCAAACTTCAGCTCCAGGAAG. The primers
for amplifying the P448L targeted allele (Fig. 1C) are F3
(forward): GCATAAGCTTGGATCCGTTCTTCGGAC and
PT5 (reverse). The primer set A1 (forward): TGAGACGACT
GAAGTGGTAACC; UNI (reverse): AGCGCATCGCCTTC
TATCGCCTTC was used to confirm the correct integration
of the P448L-targeted allele (Fig. 1C). The following
primers were used to determine the genotypes of embryos
from crossing of heterozygous E310del/wt mice. Wild-type
allele (Fig. 1A): 4714 (forward): GCTGACAACTTGCTCCA
CACTCCC and rN374 (reverse): TTGCCCACGTCCTC
CAGGTA. Targeted E310del allele (Fig. 1E): 4714
(forward), and neo1 (reverse), GAGAACCTGCGTGCAA
TCCA. Oligo-primers were synthesized by IDT (Coralville,
IA, USA). DNA sequencing was performed on a 310
Genetic Analyzer (Applied Biosystems, Foster City, CA,
USA) at the Molecular Core Facility of Carolinas Medical
Center.
Southern blot analysis
Secondary confirmation of positive FKRP-neo-P448L embryo-
nic stem cell (ES) clones identified by PCR was performed
according to the following procedures. Mouse tail DNA was
digested with EcoRV and separated on 0.8% agarose gel.
After transfer to a nylon membrane, the digested DNA was
hybridized with a 442 bp probe (PB3/4) targeted against the 5′
region external to the targeting vector (Fig. 1C). The probe
was amplified by the PCR primers PB3 (forward): ACTGCC
TCTACGTAGGCAAAGG and PB4 (reverse): TCCTCTT
AGAGGAATGTCTTTGGG. Due to the presence of an
additional EcoRV site in the Neo
r
cassette after homologous
Figure 7. Eye abnormalities in FKRP-neo-P448L mutant mice. (A) Retinal
malformation in mutant mice at 5 weeks of age. The inner (INL) and outer
(ONL) nuclear layers were thinner than those in the control eye. The ganglion
cell layer (GCL) and the inner limiting membrane (red) were highly disorga-
nized. The lower image of FKRP-neo-P448L mouse retina was from the area
near the optic nerve. (B) Optic nerve near the retina. The optic disc was dis-
organized in the FKRP-neo-P448L mutant mice.
Human Molecular Genetics, 2010, Vol. 19, No. 20 4003
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
recombination, the probe detects a 7.5 kb band for the targeted
P448L allele instead of a 12 kb band for the wild-type allele
after EcoRV digest.
Quantitative PCR analysis
RNA from quadriceps, gastronemius and heart were isolated
using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and
reverse transcribed with iScriptTM cDNA systhesis kit
(Bio-Rad, Hercules, CA, USA). Quantitative PCR was per-
formed on an ABI Prism 7500 Fast Real-Time PCR System
using TaqMan
w
Probe-Based Detection (Applied Biosystems).
RNA samples were treated with RNase-free DNase before
addition of Taqman
w
gene expression assays and Taqman
w
Gene expression master mix. The FKRP probe was custom
designed to amplify a 73 bp fragment from exon 3 region.
The fukutin (Mm00519882-m2), LARGE (Mm00521885-
m1) and DG (Mm00802400-m1) probes were obtained from
Applied Biosystems. GAPDH (Mm03302249-g1) was used
as an internal control. All reactions were performed in
triplicates. Data were analyzed using RealTime StatMiner,
version 4.0 (Integromics, Philadelphia, PA, USA). ANOVA
was performed whenever multiple factors were involved.
Otherwise, t-test was applied.
Histological and morphological analyses
Skeletal muscles and heart were snapped frozen in isopentane
chilled with liquid nitrogen. Sections of 6 mm thickness were
cut from the frozen tissues and stained with hematoxylin and
eosin (H&E), Nissl (cresyl violet) or trichrome. Mouse brains
and muscles were fixed in 10% formalin at room temperature
for 24 h and then embedded in paraffin. Paraffin blocks are cut
into 4 mm serial sections in coronal and sagittal orientation.
Images were examined using an Olympus BX51 microscope
(Center Valley, PA, USA). Pictures of the whole brain were
taken using an Olympus SZ61 stereo microscope. X-ray images
of mouse skeleton were taken using a PiXarray 100 Digital
Specimen Radiography System (Bioptics, Tucson, AZ, USA).
Electron microscopy
Quadriceps muscle was trimmed into 3 mm blocks and fixed
in 2.5% glutaraldehyde (Electron Microscopy Sciences, Hat-
field, PA, USA) in 0.1 MMillonig’s phosphate buffer for
30 min at room temperature. Samples were infiltrated with
1% osmic acid, dehydrated in ethanol and then embedded in
Spurr resin (Electron Microscopy Sciences). Ultrathin sections
on copper grids were stained with 2% uranyl acetate and 0.3 M
lead citrate and analyzed with a Philips CM-10 Transmission
Electron Microscope operated at 60 kV. Digital images were
captured with a digital camera system from 4pi Analysis
(Durham, NC, USA).
Statistical analysis
Descriptive statistics including means and standard deviations,
or counts and percentages were calculated for body weight and
serum blood tests. For data measured on the interval scale,
analysis of variance (ANOVA) was used, followed by
Turkey’s test where appropriate. If the data were not normally
distributed, the Kruskal–Wallis test or Wilcoxon’s rank sum
test was employed. The SAS
w
, version 9.1, was used for all
analyses. A two-tailed P-value of ,0.05 was considered stat-
istically significant.
Antibodies
Antibodies used in the study were listed in Supplementary
Material, Table S1.
Immunofluorescent analysis
Frozen cross-sections of muscles were cut at a thickness of
6mm and blocked with 10% normal goat serum and 20%
fetal bovine serum diluted in phosphate-buffered saline (PBS)
for 30 min. Sections were incubated at room temperature with
the primary antibodies, IIH6C4 (1:200, overnight at 48C),
laminin a2 (1:200, 1 h), DAG-1 (1:2000, 1 h) and dystrophin
P7 (1:500, 1 h). All antibodies were diluted in PBS containing
10% fetal bovine serum. Sections were rinsed extensively
with PBS and then incubated with AlexaFluor 594-conjugated
anti-mouse or anti-rabbit secondary antibodies (Molecular
Probes/Invitrogen). Sections were also stained with secondary
antibody as negative controls. Immunofluorescence was visual-
ized using an Olympus BX51 fluorescent microscopy. Images
were captured using an Olympus DP70 CCD camera system
at standard gain and at same exposure time.
Protein extraction and western blot analysis
Total proteins were extracted from tissues of interest using
TX-100 buffer (1% Triton X-100, 50 mMTris, pH 8.0,
150 mMNaCl, 0.1% SDS) supplemented with protease inhibi-
tor cocktail (Roche, Germany). Tissues were homogenized in
TX-100 buffer and the supernatants were collected by cen-
trifugation at 18 000gfor 15 min. The lysates were then
passed through Zeba desalting column (Pierce, Rockford, IL,
USA) and loaded on 4–20% Tris–glycine gel (Invitrogen).
Protein concentration was determined by modified Lowry
assay (Bio-Rad DC protein assay). For western blot, polyviny-
lidene difluoride (PVDF) membranes were incubated with
protein-free T20-blocking buffer (Pierce, Rockford, IL,
USA). Primary and secondary antibodies were incubated in
20 mMTris, pH 7.4, 150 mMNaCl, 0.1% Tween 20 and
0.5% gelatin at recommended concentrations (Supplementary
Material, Table S1). Blots were developed with ECL (Perki-
nElmer, Waltham, MA, USA) and the images were exposed
and processed by an LAS-4000 imaging system (Fujifilm, Val-
halla, NY, USA).
Laminin-binding assay
Proteins were transferred to PVDF membranes and incubated
for 6 h at 48C in laminin overlay buffer (10 mMethanolamine,
140 mMNaCl, 1 mMMgCl
2
and 1 mMCaCl
2
, pH 7.4) contain-
ing 5% nonfat dry milk. Laminin probe was prepared by con-
jugating Engelbreth-Holm-Swarm laminin (Sigma, St. Louis,
MO, USA) with EZ-link plus activated horseradish peroxidase
(HRP) according to manufacturer’s protocol (Pierce). The
4004 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
activated laminin probe was desalted with Micro Bio-Spin
P-30 column (Bio-Rad). Membranes were incubated with the
labeled laminin–HRP (5 mg/ml) overnight at 48C. After
washing extensively with laminin overlay buffer containing
5% nonfat dry milk, blots were developed with ECL.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG online.
ACKNOWLEDGEMENTS
The authors would like to thank Traci Williamson (Animal
Facility), Jane Ingram and Tracy Walling (Histology Core),
David Radoff and Daisy Ridings (Electron Microscopy
Core), Tonya Bates, Kris Bennett, Judy Vachris and Nury
Steuerwald (Molecular Biology Core), Ailan Lu and Paul
Sheiffele (inGenious Targeting) for their technical help.
Conflict of Interest statement. None declared.
FUNDING
This work was supported by the Carolinas Muscular Dystro-
phy Research Endowment at the Carolinas HealthCare Foun-
dation.
REFERENCES
1. Ervasti, J.M. and Campbell, K.P. (1991) Membrane organization of the
dystrophin– glycoprotein complex. Cell,66, 1121 – 1131.
2. Ervasti, J.M. and Campbell, K.P. (1993) A role for the dystrophin–
glycoprotein complex as a transmembrane linker between laminin and
actin. J. Cell Biol.,122, 809–823.
3. Kanagawa, M. and Toda, T. (2006) The genetic and molecular basis of
muscular dystrophy: roles of cell-matrix linkage in the pathogenesis.
J. Hum. Genet.,51, 915– 926.
4. Ervasti, J.M., Ohlendieck, K., Kahl, S.D., Gaver, M.G. and Campbell,
K.P. (1990) Deficiency of a glycoprotein component of the dystrophin
complex in dystrophic muscle. Nature,345, 315–319.
5. Yoshida, M. and Ozawa, E. (1990) Glycoprotein complex anchoring
dystrophin to sarcolemma. J. Biochem,108, 748–752.
6. Ibraghimov-Beskrovnaya, O., Ervasti, J.M., Leveille, C.J., Slaughter,
C.A., Sernett, S.W. and Campbell, K.P. (1992) Primary structure of
dystrophin-associated glycoproteins linking dystrophin to the extracellular
matrix. Nature,355, 696– 702.
7. Campanelli, J.T., Roberds, S.L., Campbell, K.P. and Scheller, R.H. (1994)
A role for dystrophin-associated glycoproteins and utrophin in
agrin-induced AChR clustering. Cell,77, 663– 674.
8. Gee, S.H., Montanaro, F., Lindenbaum, M.H. and Carbonetto, S. (1994)
Dystroglycan-alpha, a dystrophin-associated glycoprotein, is a functional
agrin receptor. Cell,77, 675–686.
9. Talts, J.F., Andac, Z., Gohring, W., Brancaccio, A. and Timpl, R. (1999)
Binding of the G domains of laminin alpha1 and alpha2 chains and
perlecan to heparin, sulfatides, alpha-dystroglycan and several
extracellular matrix proteins. EMBO J.,18, 863–870.
10. Sugita, S., Saito, F., Tang, J., Satz, J., Campbell, K. and Sudhof, T.C.
(2001) A stoichiometric complex of neurexins and dystroglycan in brain.
J. Cell Biol.,154, 435– 445.
11. Montanaro, F., Lindenbaum, M. and Carbonetto, S. (1999)
a-Dystroglycan is a laminin receptor involved in extracellular matrix
assembly on myotubes and muscle cell viability. J. Cell Biol.,145, 1325 –
1340.
12. Brown, S.C., Fassati, A., Popplewell, L., Page, A.M., Henry, M.D.,
Campbell, K.P. and Dickson, G. (1999) Dystrophic phenotype induced
in vitro by antibody blockade of muscle alpha-dystroglycan –laminin
interaction. J. Cell Sci.,112 (Pt. 2), 209– 216.
13. Sato, S., Omori, Y., Katoh, K., Kondo, M., Kanagawa, M., Miyata, K.,
Funabiki, K., Koyasu, T., Kajimura, N., Miyoshi, T. et al. (2008)
Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon
synapse formation. Nat. Neurosci.,11, 923– 931.
14. Brancaccio, A., Schulthess, T., Gesemann, M. and Engel, J. (1995)
Electron microscopic evidence for a mucin-like region in chick muscle
alpha-dystroglycan. FEBS Lett.,368, 139– 142.
15. Saito, F., Blank, M., Schroder, J., Manya, H., Shimizu, T.,
Campbell, K.P., Endo, T., Mizutani, M., Kroger, S. and Matsumura, K.
(2005) Aberrant glycosylation of alpha-dystroglycan causes defective
binding of laminin in the muscle of chicken muscular dystrophy. FEBS
Lett.,579, 2359– 2363.
16. Michele, D.E., Barresi, R., Kanagawa, M., Saito, F., Cohn, R.D.,
Satz, J.S., Dollar, J., Nishino, I., Kelley, R.I., Somer, H. et al. (2002)
Post-translational disruption of dystroglycan–ligand interactions in
congenital muscular dystrophies. Nature,418, 417– 422.
17. Moore, S.A., Saito, F., Chen, J., Michele, D.E., Henry, M.D., Messing, A.,
Cohn, R.D., Ross-Barta, S.E., Westra, S., Williamson, R.A. et al. (2002)
Deletion of brain dystroglycan recapitulates aspects of congenital
muscular dystrophy. Nature,418, 422– 425.
18. Saito, F., Moore, S.A., Barresi, R., Henry, M.D., Messing, A., Ross-Barta,
S.E., Cohn, R.D., Williamson, R.A., Sluka, K.A., Sherman, D.L. et al.
(2003) Unique role of dystroglycan in peripheral nerve myelination, nodal
structure, and sodium channel stabilization. Neuron,38, 747–758.
19. Satz, J.S., Barresi, R., Durbeej, M., Willer, T., Turner, A., Moore, S.A.
and Campbell, K.P. (2008) Brain and eye malformations resembling
Walker–Warburg syndrome are recapitulated in mice by dystroglycan
deletion in the epiblast. J. Neurosci.,28, 10567– 10575.
20. Satz, J.S., Philp, A.R., Nguyen, H., Kusano, H., Lee, J., Turk, R.,
Riker, M.J., Hernandez, J., Weiss, R.M., Anderson, M.G. et al. (2009)
Visual impairment in the absence of dystroglycan. J. Neurosci.,29,
13136– 13146.
21. Martin, P.T. (2007) Congenital muscular dystrophies involving the
O-mannose pathway. Curr. Mol. Med.,7, 417–425.
22. Longman, C., Brockington, M., Torelli, S., Jimenez-Mallebrera, C.,
Kennedy, C., Khalil, N., Feng, L., Saran, R.K., Voit, T., Merlini, L. et al.
(2003) Mutations in the human LARGE gene cause MDC1D, a novel
form of congenital muscular dystrophy with severe mental retardation and
abnormal glycosylation of alpha-dystroglycan. Hum. Mol. Genet.,12,
2853–2861.
23. van Reeuwijk, J., Janssen, M., van den Elzen, C., Beltran-Valero de
Bernabe, D., Sabatelli, P., Merlini, L., Boon, M., Scheffer, H.,
Brockington, M., Muntoni, F. et al. (2005) POMT2 mutations cause
alpha-dystroglycan hypoglycosylation and Walker– Warburg syndrome.
J. Med. Genet.,42, 907–912.
24. Beltran-Valero de Bernabe, D., Currier, S., Steinbrecher, A., Celli, J.,
van Beusekom, E., van der Zwaag, B., Kayserili, H., Merlini, L.,
Chitayat, D., Dobyns, W.B. et al. (2002) Mutations in the
O-mannosyltransferase gene POMT1 give rise to the severe neuronal
migration disorder Walker– Warburg syndrome. Am. J. Hum. Genet.,71,
1033–1043.
25. Yoshida, A., Kobayashi, K., Manya, H., Taniguchi, K., Kano, H., Mizuno,
M., Inazu, T., Mitsuhashi, H., Takahashi, S., Takeuchi, M. et al. (2001)
Muscular dystrophy and neuronal migration disorder caused by mutations
in a glycosyltransferase, POMGnT1. Dev. Cell,1, 717–724.
26. Kobayashi, K., Nakahori, Y., Miyake, M., Matsumura, K., Kondo-Iida, E.,
Nomura, Y., Segawa, M., Yoshioka, M., Saito, K., Osawa, M. et al. (1998)
An ancient retrotransposal insertion causes Fukuyama-type congenital
muscular dystrophy. Nature,394, 388– 392.
27. Brockington, M., Yuva, Y., Prandini, P., Brown, S.C., Torelli, S., Benson,
M.A., Herrmann, R., Anderson, L.V., Bashir, R., Burgunder, J.M. et al.
(2001) Mutations in the fukutin-related protein gene (FKRP) identify limb
girdle muscular dystrophy 2I as a milder allelic variant of congenital
muscular dystrophy MDC1C. Hum. Mol. Genet.,10, 2851 –2859.
28. Brockington, M., Blake, D.J., Prandini, P., Brown, S.C., Torelli, S.,
Benson, M.A., Ponting, C.P., Estournet, B., Romero, N.B., Mercuri, E.
et al. (2001) Mutations in the fukutin-related protein gene (FKRP) cause a
form of congenital muscular dystrophy with secondary laminin alpha2
deficiency and abnormal glycosylation of alpha-dystroglycan.
Am. J. Hum. Genet.,69, 1198– 1209.
Human Molecular Genetics, 2010, Vol. 19, No. 20 4005
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
29. Manya, H., Chiba, A., Yoshida, A., Wang, X., Chiba, Y., Jigami, Y.,
Margolis, R.U. and Endo, T. (2004) Demonstration of mammalian protein
O-mannosyltransferase activity: coexpression of POMT1 and POMT2
required for enzymatic activity. Proc. Natl Acad. Sci. USA,101, 500–505.
30. Grewal, P.K., McLaughlan, J.M., Moore, C.J., Browning, C.A. and
Hewitt, J.E. (2005) Characterization of the LARGE family of putative
glycosyltransferases associated with dystroglycanopathies. Glycobiology,
15, 912– 923.
31. Kanagawa, M., Saito, F., Kunz, S., Yoshida-Moriguchi, T., Barresi, R.,
Kobayashi, Y.M., Muschler, J., Dumanski, J.P., Michele, D.E., Oldstone,
M.B. et al. (2004) Molecular recognition by LARGE is essential for
expression of functional dystroglycan. Cell,117, 953–964.
32. Patnaik, S.K. and Stanley, P. (2005) Mouse large can modify complex N-
and mucin O-glycans on alpha-dystroglycan to induce laminin binding.
J. Biol. Chem.,280, 20851– 20859.
33. Yamamoto, T., Kawaguchi, M., Sakayori, N., Muramatsu, F.,
Morikawa, S., Kato, Y., Shibata, N. and Kobayashi, M. (2006)
Intracellular binding of fukutin and alpha-dystroglycan: relation to
glycosylation of alpha-dystroglycan. Neurosci. Res.,56, 391– 399.
34. Beltran-Valero de Bernabe, D., Voit, T., Longman, C., Steinbrecher, A.,
Straub, V., Yuva, Y., Herrmann, R., Sperner, J., Korenke, C., Diesen, C.
et al. (2004) Mutations in the FKRP gene can cause muscle – eye–brain
disease and Walker–Warburg syndrome. J. Med. Genet.,41, e61.
35. Brown, S.C., Torelli, S., Brockington, M., Yuva, Y., Jimenez, C.,
Feng, L., Anderson, L., Ugo, I., Kroger, S., Bushby, K. et al. (2004)
Abnormalities in alpha-dystroglycan expression in MDC1C and LGMD2I
muscular dystrophies. Am. J. Pathol.,164, 727– 737.
36. Mercuri, E., Brockington, M., Straub, V., Quijano-Roy, S., Yuva, Y.,
Herrmann, R., Brown, S.C., Torelli, S., Dubowitz, V., Blake, D.J. et al.
(2003) Phenotypic spectrum associated with mutations in the
fukutin-related protein gene. Ann. Neurol.,53, 537– 542.
37. Boito, C.A., Melacini, P., Vianello, A., Prandini, P., Gavassini, B.F.,
Bagattin, A., Siciliano, G., Angelini, C. and Pegoraro, E. (2005) Clinical
and molecular characterization of patients with limb-girdle muscular
dystrophy type 2I. Arch. Neurol.,62, 1894– 1899.
38. Poppe, M., Bourke, J., Eagle, M., Frosk, P., Wrogemann, K.,
Greenberg, C., Muntoni, F., Voit, T., Straub, V., Hilton-Jones, D. et al.
(2004) Cardiac and respiratory failure in limb-girdle muscular dystrophy
2I. Ann. Neurol.,56, 738– 741.
39. Jimenez-Mallebrera, C., Torelli, S., Feng, L., Kim, J., Godfrey, C.,
Clement, E., Mein, R., Abbs, S., Brown, S.C., Campbell, K.P. et al. (2009)
A comparative study of alpha-dystroglycan glycosylation in
dystroglycanopathies suggests that the hypoglycosylation of
alpha-dystroglycan does not consistently correlate with clinical severity.
Brain. Pathol.,19, 596– 611.
40. Mercuri, E., Messina, S., Bruno, C., Mora, M., Pegoraro, E., Comi, G.P.,
D’Amico, A., Aiello, C., Biancheri, R., Berardinelli, A. et al. (2009)
Congenital muscular dystrophies with defective glycosylation of
dystroglycan: a population study. Neurology,72, 1802– 1809.
41. Ackroyd, M.R., Skordis, L., Kaluarachchi, M., Godwin, J., Prior, S.,
Fidanboylu, M., Piercy, R.J., Muntoni, F. and Brown, S.C. (2009)
Reduced expression of fukutin related protein in mice results in a model
for fukutin related protein associated muscular dystrophies. Brain,132,
439–451.
42. Keramaris-Vrantsis, E., Lu, P.J., Doran, T., Zillmer, A., Ashar, J., Esapa,
C.T., Benson, M.A., Blake, D.J., Rosenfeld, J. and Lu, Q.L. (2007)
Fukutin-related protein localizes to the Golgi apparatus and mutations
lead to mislocalization in muscle in vivo. Muscle Nerve,36, 455– 465.
43. Esapa, C.T., Benson, M.A., Schroder, J.E., Martin-Rendon, E.,
Brockington, M., Brown, S.C., Muntoni, F., Kroger, S. and Blake, D.J.
(2002) Functional requirements for fukutin-related protein in the Golgi
apparatus. Hum. Mol. Genet.,11, 3319– 3331.
44. Kobuke, K., Piccolo, F., Garringer, K.W., Moore, S.A., Sweezer, E.,
Yang, B. and Campbell, K.P. (2008) A common disease-associated
missense mutation in alpha-sarcoglycan fails to cause muscular dystrophy
in mice. Hum. Mol. Genet.,17, 1201–1213.
45. Bartoli, M., Gicquel, E., Barrault, L., Soheili, T., Malissen, M.,
Malissen, B., Vincent-Lacaze, N., Perez, N., Udd, B., Danos, O. et al.
(2008) Mannosidase I inhibition rescues the human alpha-sarcoglycan
R77C recurrent mutation. Hum. Mol. Genet.,17, 1214– 1221.
46. Lewandoski, M. (2001) Conditional control of gene expression in the
mouse. Nat. Rev. Genet.,2, 743– 755.
47. Sher, R.B., Aoyama, C., Huebsch, K.A., Ji, S., Kerner, J., Yang, Y.,
Frankel, W.N., Hoppel, C.L., Wood, P.A., Vance, D.E. et al. (2006)
A rostrocaudal muscular dystrophy caused by a defect in choline kinase
beta, the first enzyme in phosphatidylcholine biosynthesis. J. Biol. Chem.,
281, 4938– 4948.
48. Kaariainen, M., Nissinen, L., Kaufman, S., Sonnenberg, A., Jarvinen, M.,
Heino, J. and Kalimo, H. (2002) Expression of alpha7beta1 integrin
splicing variants during skeletal muscle regeneration. Am. J. Pathol.,161,
1023– 1031.
49. Liu, J., Burkin, D.J. and Kaufman, S.J. (2008) Increasing alpha 7 beta
1–integrin promotes muscle cell proliferation, adhesion, and resistance to
apoptosis without changing gene expression. Am. J. Physiol. Cell Physiol.,
294, C627– C640.
50. Hodges, B.L., Hayashi, Y.K., Nonaka, I., Wang, W., Arahata, K. and
Kaufman, S.J. (1997) Altered expression of the alpha7beta1 integrin in
human and murine muscular dystrophies. J. Cell Sci.,110(Pt. 22),
2873– 2881.
51. Clement, E., Mercuri, E., Godfrey, C., Smith, J., Robb, S., Kinali, M.,
Straub, V., Bushby, K., Manzur, A., Talim, B. et al. (2008) Brain
involvement in muscular dystrophies with defective dystroglycan
glycosylation. Ann. Neurol.,64, 573– 582.
52. Liu, J., Ball, S.L., Yang, Y., Mei, P., Zhang, L., Shi, H., Kaminski, H.J.,
Lemmon, V.P. and Hu, H. (2006) A genetic model for muscle –eye–brain
disease in mice lacking protein O-mannose 1,2-N-acetylglucosaminyl-
transferase (POMGnT1). Mech. Dev.,123, 228– 240.
53. Takeda, S., Kondo, M., Sasaki, J., Kurahashi, H., Kano, H., Arai, K.,
Misaki, K., Fukui, T., Kobayashi, K., Tachikawa, M. et al. (2003) Fukutin
is required for maintenance of muscle integrity, cortical histiogenesis and
normal eye development. Hum. Mol. Genet.,12, 1449– 1459.
54. Holzfeind, P.J., Grewal, P.K., Reitsamer, H.A., Kechvar, J., Lassmann, H.,
Hoeger, H., Hewitt, J.E. and Bittner, R.E. (2002) Skeletal, cardiac and
tongue muscle pathology, defective retinal transmission, and neuronal
migration defects in the Large(myd) mouse defines a natural model for
glycosylation-deficient muscle– eye – brain disorders. Hum. Mol. Genet.,
11, 2673– 2687.
55. Kurahashi, H., Taniguchi, M., Meno, C., Taniguchi, Y., Takeda, S.,
Horie, M., Otani, H. and Toda, T. (2005) Basement membrane fragility
underlies embryonic lethality in fukutin–null mice. Neurobiol. Dis.,19,
208–217.
56. Willer, T., Prados, B., Falcon-Perez, J.M., Renner-Muller, I.,
Przemeck, G.K., Lommel, M., Coloma, A., Valero, M.C., de Angelis,
M.H., Tanner, W. et al. (2004) Targeted disruption of the
Walker-Warburg syndrome gene Pomt1 in mouse results in embryonic
lethality. Proc. Natl Acad. Sci. USA,101, 14126– 14131.
57. Williamson, R.A., Henry, M.D., Daniels, K.J., Hrstka, R.F., Lee, J.C.,
Sunada, Y., Ibraghimov-Beskrovnaya, O. and Campbell, K.P. (1997)
Dystroglycan is essential for early embryonic development: disruption of
Reichert’s membrane in Dag1-null mice. Hum. Mol. Gen,6, 831–841.
58. Lu, P.J., Zillmer, A., Wu, X., Lochmuller, H., Vachris, J., Blake, D.,
Chan, Y.M. and Lu, Q.L. (2009) Mutations alter secretion of
fukutin-related protein. Biochim. Biophys. Acta,1802, 253– 258.
59. Sveen, M.L., Schwartz, M. and Vissing, J. (2006) High prevalence and
phenotype– genotype correlations of limb girdle muscular dystrophy type
2I in Denmark. Ann. Neurol.,59, 808– 815.
60. Mercuri, E., Topaloglu, H., Brockington, M., Berardinelli, A.,
Pichiecchio, A., Santorelli, F., Rutherford, M., Talim, B., Ricci, E.,
Voit, T. et al. (2006) Spectrum of brain changes in patients with
congenital muscular dystrophy and FKRP gene mutations. Arch. Neurol.,
63, 251– 257.
61. Miyagoe-Suzuki, Y., Masubuchi, N., Miyamoto, K., Wada, M.R.,
Yuasa, S., Saito, F., Matsumura, K., Kanesaki, H., Kudo, A., Manya, H.
et al. (2009) Reduced proliferative activity of primary POMGnT1-null
myoblasts in vitro.Mech. Dev.,126, 107– 116.
4006 Human Molecular Genetics, 2010, Vol. 19, No. 20
Downloaded from https://academic.oup.com/hmg/article-abstract/19/20/3995/645933
by guest
on 19 July 2018
