An Induced Mutation in Tomato eIF4E Leads to Immunity to Two Potyviruses

Abstract

The characterization of natural recessive resistance genes and Arabidopsis virus-resistant mutants have implicated translation initiation factors of the eIF4E and eIF4G families as susceptibility factors required for virus infection and resistance function.
To investigate further the role of translation initiation factors in virus resistance we set up a TILLING platform in tomato, cloned genes encoding for translation initiation factors eIF4E and eIF4G and screened for induced mutations that lead to virus resistance. A splicing mutant of the eukaryotic translation initiation factor, S.l_eIF4E1 G1485A, was identified and characterized with respect to cap binding activity and resistance spectrum. Molecular analysis of the transcript of the mutant form showed that both the second and the third exons were miss-spliced, leading to a truncated mRNA. The resulting truncated eIF4E1 protein is also impaired in cap-binding activity. The mutant line had no growth defect, likely because of functional redundancy with others eIF4E isoforms. When infected with different potyviruses, the mutant line was immune to two strains of Potato virus Y and Pepper mottle virus and susceptible to Tobacco each virus.
Mutation analysis of translation initiation factors shows that translation initiation factors of the eIF4E family are determinants of plant susceptibility to RNA viruses and viruses have adopted strategies to use different isoforms. This work also demonstrates the effectiveness of TILLING as a reverse genetics tool to improve crop species. We have also developed a complete tool that can be used for both forward and reverse genetics in tomato, for both basic science and crop improvement. By opening it to the community, we hope to fulfill the expectations of both crop breeders and scientists who are using tomato as their model of study.

Full text

An Induced Mutation in Tomato eIF4E Leads to Immunity
to Two Potyviruses
Florence Piron
1.
, Maryse Nicolaı
¨
2.
, Silvia Minoı
¨a
1
, Elodie Piednoir
1
, Andre
´Moretti
2
, Aure
´lie Salgues
2
,
Dani Zamir
3
, Carole Caranta
2
, Abdelhafid Bendahmane
1
*
1Unite
´de Recherche en Ge
´nomique Ve
´ge
´tale, UMR INRA-CNRS-Uni. EVRY, Evry, France, 2Unite
´de Ge
´ne
´tique et Ame
´lioration des Fruits et Le
´gumes, INRA, UR1052,
Montfavet, France, 3Institute of Plant Sciences, Faculty of Agriculture, The Hebrew University of Jerusalem, Rehovot, Israel
Abstract
Background:
The characterization of natural recessive resistance genes and Arabidopsis virus-resistant mutants have
implicated translation initiation factors of the eIF4E and eIF4G families as susceptibility factors required for virus infection
and resistance function.
Methodology/Principal Findings:
To investigate further the role of translation initiation factors in virus resistance we set up
a TILLING platform in tomato, cloned genes encoding for translation initiation factors eIF4E and eIF4G and screened for
induced mutations that lead to virus resistance. A splicing mutant of the eukaryotic translation initiation factor, S.l_eIF4E1
G1485A, was identified and characterized with respect to cap binding activity and resistance spectrum. Molecular analysis of
the transcript of the mutant form showed that both the second and the third exons were miss-spliced, leading to a
truncated mRNA. The resulting truncated eIF4E1 protein is also impaired in cap-binding activity. The mutant line had no
growth defect, likely because of functional redundancy with others eIF4E isoforms. When infected with different
potyviruses, the mutant line was immune to two strains of Potato virus Y and Pepper mottle virus and susceptible to Tobacco
each virus.
Conclusions/Significance:
Mutation analysis of translation initiation factors shows that translation initiation factors of the
eIF4E family are determinants of plant susceptibility to RNA viruses and viruses have adopted strategies to use different
isoforms. This work also demonstrates the effectiveness of TILLING as a reverse genetics tool to improve crop species. We
have also developed a complete tool that can be used for both forward and reverse genetics in tomato, for both basic
science and crop improvement. By opening it to the community, we hope to fulfill the expectations of both crop breeders
and scientists who are using tomato as their model of study.
Citation: Piron F, Nicolaı
¨M, Minoı
¨a S, Piednoir E, Moretti A, et al. (2010) An Induced Mutation in Tomato eIF4E Leads to Immunity to Two Potyviruses. PLoS
ONE 5(6): e11313. doi:10.1371/journal.pone.0011313
Editor: Ellen A. A. Nollen, University Medical Center Groningen, Netherlands
Received February 26, 2010; Accepted June 3, 2010; Published June 25, 2010
Copyright: ß2010 Piron et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by GENOPLANTE (GENOTILL 097-098 and TRANSVIR GNP05003G), EU-SOL and INRA Transfert. F.P., M.N. and E.P. were
supported by fellowships from the same projects. The M82 TILLING platform was developed within the frame of the European EUSOL Integrated Project. TheM82
TILLING platform is open to the scientific communities worldwide for collaborations. The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: bendahm@evry.inra.fr
.These authors contributed equally to this work.
Introduction
Tomato (Solanum lycopersicum L.) belongs to the Solanaceae
family that contains about 2800 species and many agriculturally
valuable crops. For decades, tomato has played key roles in the
field of plant molecular biology, serving as an excellent model
organism for investigating plant–pathogen interactions [1], fruit
development [2], ripening processes [3,4,5,6], sugar metabolism
[7,8,9], carotenoid biosynthesis [10,11], quantitative trait locus
(QTL) analysis [12], and plant architecture [13].
The genome structures of most of the solanaceous plants are
relatively well conserved [14]. Tomato is the most intensively
researched Solanaceae with the availability of extensive genetic
and genomics resources including interspecific introgression lines
collection, large collections of wild relatives and mutants with
characterized phenotypes, microarrays with approximately 12 000
unigenes designed based on large collections of ESTs [15,16], and
metabolome database of tomato fruit [17]. With the completion of
the genome sequencing project in the near future [18], a major
challenge is to determine gene functions. In plants, the most
common techniques to produce altered or loss of function
mutations are T-DNA or transposon insertional mutagenesis
[19] and RNA interference [20]. However, unless a high-
throughput transformation protocol becomes available for tomato,
functional analysis of tomato genes with the tagging approaches is
not realistic. On the other hand, ethyl methanesulfonate (EMS)
mutagenesis is a straightforward and cost-effective way to saturate
a genome with mutations [21]. TILLING (Targeting Induced
Local Lesions IN Genomes) uses EMS mutagenesis coupled with
gene-specific detection of single-nucleotide mutations [22,23,24].
This strategy generates allelic series of the targeted genes which
makes it possible to dissect the function of the protein as well as to
PLoS ONE | www.plosone.org 1 June 2010 | Volume 5 | Issue 6 | e11313

investigate the role of essential genes that are otherwise not likely
to be recovered in genetic screens based on insertional
mutagenesis. This reverse genetic strategy encompasses all types
of organisms and can be automated in a high throughput mode
[25,26,27,28].
To investigate the capacity of TILLING as a powerful tool of
reverse genetics in tomato and to identify novel alleles of
agronomic importance, we have set up a tomato TILLING
platform and performed a screen for mutations in host factors
required for the potyvirus infection. The genus Potyvirus is the
largest among plant viruses and includes the widespread and
destructive viruses for a number of crops worldwide. The potyviral
genome consists of a single-stranded, positive-sense RNA molecule
that contains at the 59-end a covalently linked virus-encoded
protein named VPg, replacing the cap structure of mRNA and
required for viral infection [29,30]. In recent years, the molecular
cloning of recessive resistance genes to RNA viruses led to the
identification of a new class of resistance genes corresponding to
mutations in translation initiation factors, including the eukaryotic
initiation factor 4E (eIF4E) [31,32] and to a lesser extent, the
eukaryotic initiation factor 4G (eIF4G) [33]. The majority of
eIF4E-mediated Potyvirus resistances are mediated by a small
number of amino acid changes in the eIF4E protein [31,32]. The
exact mechanism by which eIF4E mutations control resistance is
still unclear but several results argue in favor of an altered function
induced by these amino acid mutations with respect to VPg
binding [34,35,36]. eIF4E like other factors from the translation
initiation complexes belongs to a small multigenic family encoding
for two protein isoforms, eIF4E and eIF(iso)4E [37]. Interestingly,
complete resistance to Potyvirus may result from mutations in a
single eIF4E or from combined mutations in different paralogs,
depending on the virus ability to use one or several eIF4E to
perform its infectious cycle [38,39].
In tomato, the role of eIF4E in resistance to two potyviruses,
Potato virus Y (PVY) and Tobacco etch virus (TEV), was demonstrated
by the molecular cloning of the recessive resistance gene pot-1.pot-
1encodes for the eIF4E1 protein and the resistant and
susceptibility alleles differ by 4 amino acid substitutions [40,41].
To investigate further the role of translation initiation factors
eIF4E and eIF4G in virus resistance, we first set up a tomato
TILLING platform, exploiting the M82 EMS-mutageneized
population described previously ([42] http://zamir.sgn.cornell.
edu/mutants/). Then, we screened for mutations in the five
translation initiation factors, eIF4E1, eIF4E2, eIF(iso)4E, eIF4G
and eIF(iso)4G identified in tomato using the TILLING approach.
The mutant lines were characterized with respect to potyvirus
resistance and translation of mRNA with the objectives to get
insights into molecular mechanisms underlying translation initia-
tion factors-mediated resistance to potyviruses. In this analysis, a
splicing mutant of eIF4E1 was found immune to two strains of
Potato virus Y and Pepper mottle virus and susceptible to Tobacco each
virus.
Results
Set up of the M82 TILLING platform
To set up the TILLING platform we exploited the tomato M82
EMS-mutagenized population described previously [42]. M82 is an
inbred variety with determinate flowering that perform well under
various growth environments and is amenable to fast screens in
seedling trays and pots as well as in field conditions. M82 mutant
population was visually phenotyped in the field and categorized into
a morphological catalogue that can be searched and accessed via the
web (http://zamir.sgn.cornell.edu/mutants/). DNA samples were
prepared from 4759 M3 families, each representing an independent
M1 family and organized in pools of 8 families. One key factor in
TILLING is the availability of the annotated genomic sequence of
the gene to be tilled, which in this case was facilitated by the
sequencing of the tomato euchromatin genomic region and the
availability of high number of ESTs. The CODDLE software
(Codons Optimized to Discover Deleterious Lesions) [43] combined
with the PRIMER3 tool [44] were used to define the best amplicon
for TILLING. Mutations were detected in the amplified targets
using the mismatch-specific endonuclease ENDO1, as described
previously [45].
A primary objective in TILLING is to exploit a mutant
population where every locus is mutated and represented by
multiple alleles. To evaluate the existence of multiple alleles per
locus, we calculated the mutation frequency in 19 targeted genes
(Table 1) according to [21]. Mutation frequency equals the size of
the amplicon multiplied by the total number of samples screened
and divided by the total number of identified mutants. We
estimated the average mutation rate to one mutation every 574 kb
(Table 1). In the 19 selected genes, we identified 256 nucleotides
changes among which 145 were exonic mutations (Table 1). We
obtained from 2 to 43 alleles for each target. Induced mutations
discovered in exons consisted of 58.6% missense, 36.6% silent and
4.8% translation stop or splice junction mutations (Table 2). The
number of silent mutations was higher than the CODDLE-
predicted proportion. In contrast missense, stop and splice
junction mutations were recovered in a slightly lower proportion
than predicted (Table 2).
EMS mutation screening in translation initiation factors
4E and 4G
The molecular cloning of recessive resistance genes in crop
species demonstrated that amino acid changes in translation
initiation factors led to resistance to specific RNA viruses,
including potyviruses [31,32]. To test whether new resistance
alleles could be engineered by TILLING, the M82 mutant
collection was screened for mutations in genes encoding for
translation initiation factors eIF4E and eIF4G. Genomic sequenc-
es required for mutation screening were inferred from the
following cDNAs or EST: Genbank accession AF259801 and
TIGR tentative consensus accessions TC126316 and TC126421
for eIF4E genes and TIGR tentative consensus accessions
TC167837, TC 156946, TC 165028 and TC155154 for eIF4G
genes. Two homologs of eIF4E were identified that shares 74%
sequence identity and are referred hereafter as Sl-eIF4E1 and Sl-
eIF4E2; the other genes are referred as Sl-eIF(iso)4E,Sl-eIF4G and
Sl-eIF(iso)4G based on their conserved genes structures and
sequence identities with Arabidopsis thaliana orthologs (Figure 1).
We screened for mutations in the whole exonic regions of Sl-
eIF4E1, and focalized the screening for other genes only on regions
where natural mutations were shown to lead to virus resistance i.e.,
exons 1 to 3 for Sl-eIF(iso)4E, exon 1 for Sl-eIF4E2 and MiF4G,
MA3 and eIF4E-binding domains for Sl-eIF4G genes (Figure 1).
TILLING of Sl-eIF4E1 yielded seven independent point muta-
tions, which correspond to one silent, four intronic, one missense
and one splicing site mutations (Table 3). TILLING of Sl-eIF4E2
yielded two intronic mutations and one stop codon (W85Stop)
mutations (Figure 1). TILLING of Sl-eIF(iso)4E yielded fourteen
independent point mutants, which correspond to two silent, eight
intronic, three missense and one stop codon (W105Stop) mutations
(Table 3). TILLING of Sl-eIF4G yielded fourty three point
mutations, which correspond to sixteen silent, seven intronic
and twenty missense mutations (Table 3). Finally, TILLING of
Virus Resistant Plants
PLoS ONE | www.plosone.org 2 June 2010 | Volume 5 | Issue 6 | e11313

Sl-eIF(iso)4G yielded sixteen point mutations, which correspond to
six silent, six intronic and four missense mutations (Table 3).
The Sl-eIF4E1 G1485A splice junction mutant is resistant
to several potyviruses
To test whether induced mutations in translation initiation
factors could confer resistance to potyviruses, mutant lines
affected in eIF4E or eIF4G proteins were challenged with three
potyviruses infecting tomato, PVY (strains PVY-LYE90 and
PVY-LYE84), TEV (strain TEV-HAT) and PepMoV (strain
Texas). Lines derived from the same M3 family but homozygous
wild type for the mutation, hereafter named Hm-WT, were used
as control in the resistance assays, together with the susceptible
cv. M82. All the controls and the TILLING mutant lines, except
the Sl-eIF4E1 G1485A mutant, inoculated with PVY-LYE90,
PVY-LYE84, TEV-HAT or PepMoV-Texas presented mosaic
symptoms in apical non-inoculated leaves and exhibited high
double antibody sandwich (DAS)-ELISA values at fifteen days
post-inoculation (Figure 2A). The Sl-eIF4E1 G1485A mutant was
immune to PVY-LYE90 and PepMoV-Texas infection. PVY-
LYE90 and PepMoV-Texas RNAs were never detected in
inoculated or non-inoculated leaves of the G1485A mutant line,
indicating that viral accumulation is impaired at an early stage of
the infection process (Figure 2B). Sl-eIF4E1 G1485A mutant line
was, however, still susceptible to PVY-LYE84 and TEV infection
(Figure 2).
To confirm this phenotype, Sl-eIF4E1 G1485A mutant line
was backcrossed and the heterozygous line was self pollinated.
Forty four plants obtained from the selfing of Sl-eIF4E1 G1485A
heterozygous, consequently segregating for the mutation, were
challenged with PVY-LYE90 and PepMoV and genotyped for
the mutation. All Hm-WT and heterozygous plants were
susceptible to PVY-LYE90 and PepMoV whereas all plants
homozygous for the mutation were resistant to both viruses,
confirming that resistance indeed results from mutation in Sl-
eIF4E1.
Table 2. Comparison of expected and observed types of mutations in tilled exonic regions.
All mutations Silent changes Missense changes Nonsense changes Splice junction changes
Distribution observed 145 53 85 6 1
Percent Observed 100 36.6 58.6 4.1 0.7
Percent Expected 100 28.1 65.2 5.5 1.2
The percentage of expected mutations was calculated based on the CODDLE analysis of the tilled exonic regions.
doi:10.1371/journal.pone.0011313.t002
Table 1. Tilled genes and mutation density in the M82 mutant population.
Gene Name
Amplicon
size (bp)
Identified
mutants
Missense
mutation
Null
mutation
Silent
mutation
Intronic
mutation
Mutation
density
eIF4E1 1 633 7 1 1
*
1 4 1/1110 kb
eIF4E2 324 3 0 1 0 2 1/514 kb
eIF(iso)4E 1 340 14 3 1 2 8 1/455 kb
eIF4G 3 609 43 20 0 16 7 1/400 kb
eIF(iso)4G 2 017 16 4 0 6 6 1/600 kb
DET1 2 646 23 7 0 4 12 1/547 kb
COP1like 979 4 1 3 0 0 1/1165 kb
DDB1a 1 216 11 3 0 5 3 1/526 kb
COP10 2 213 32 1 0 3 28 1/329 kb
NAM 1 638 5 4 0 1 0 1/1559 kb
ACO1 1 784 8 4 0 2 2 1/1061 kb
E8 1 810 6 2 0 3 1 1/1436 kb
DHS 638 2 1 0 0 1 1/1518 kb
RAB11a 407 2 2 0 0 0 1/968 kb
PG 1 943 28 4 0 0 24 1/330 kb
MET1 4 015 32 24 0 7 1 1/597 kb
Exp1 1 025 8 1 1 0 6 1/610 kb
CRTISO 1 011 9 2 0 1 6 1/535 kb
CUL4 629 3 1 0 2 0 1/998 kb
Total/Mean 30 877 256 85 7 53 111 1/574 kb
M82 mutant population was screened for mutations in the listed genes. The total size of the screened amplicons, for each gene, the number of mutants identified and
the mutation frequency for each amplicon are indicated. The average mutation frequency was estimated to one mutation per 574 kb and is calculated as described
previously [21], except that the sizes of all the amplicons were summed and divided by the total number of identified mutants.
doi:10.1371/journal.pone.0011313.t001
Virus Resistant Plants
PLoS ONE | www.plosone.org 3 June 2010 | Volume 5 | Issue 6 | e11313

The Sl-eIF4E1 G1485A is a splicing mutant that encodes
for a truncated mRNA
The G1485A mutation is located in an intron encoding splice
site. To test whether this mutation affect the splicing of Sl-eIF4E1,
we designed primers to amplify the full-length cDNA of the gene.
The forward primer was designed on the 59UTR of the first exon
encompassing the start codon and the reverse primer was the
adapter primer anchored on the 39end UTR. RT-PCR was
performed on cDNA made from RNA of Sl-eIF4E1 G1485A line
and Hm-WT leaves. The amplified Hm-WT cDNA was of the
expected size (730 bp) and the sequence fitted with the known
exon-intron organization of the plant Sl-eIF4E genes [46]. In
contrast, the amplified cDNA of the Sl-eIF4E1 G1485A allele was
significantly smaller than the one from Hm-WT (450 bp), which
suggested an alteration in intron splicing (Figure 3A). Sequence
analysis of the amplified Sl-eIF4E1 G1485A cDNA showed that
both the second and the third exons were missing (Figure 3B and
3C). The deletion of exons two and three in the mutant line was
further confirmed by northern blot analysis using a Sl-eIF4E1
antisense RNA probe complementary to exon 1 (Figure 3B).
The Sl-eIF4E1 G1485A truncated protein is impaired in
cap-binding activity
Total leaf proteins extracted from Sl-eIF4E1 G1485A, Hm-WT
and Nicotiana tabacum cv. Xanthii (control) plants were probed with
a polyclonal antibody raised against bacterially expressed Nt-eIF4E
cDNA in a western blot analysis. This antibody is known to cross-
react with tobacco eIF(iso)4E [47]. Three polypeptides were
detected from tobacco leaf extracts, migrating at 30, 25 and
22 kDa corresponding to Nt-eIF4E and two isoforms of Nt-
eIF(iso)4E, respectively (Figure 4A). In tomato, a single polypep-
tide of 30 kDa was detected in leaf extract of the Hm-WT and as
expected a polypeptide of approximatively 22 kDa corresponding
to the mutant form was detected in Sl-eIF4E1 G1485A (Figure 4A).
To address the functional consequence of the G1485A mutation
of Sl-eIF4E1 for cap-binding activity, soluble protein extracts of
the Hm-WT and the G1485A mutant line were purified by affinity
chromatography on m7G-sepharose column. After purification,
the fractions, the flow through, the wash and the bound forms
were subjected to western blot analysis, using Nt-eIF4E antibody
(Figure 4B). A single polypeptide of 30 kDa that bound to the
m7G-sepharose and is eluted with m7GDP-cap analogue was
detected in the Hm-WT, whereas no polypeptide could be
detected in the bound fraction of the G1485A mutant (Figure 4B,
lane 4). On the other hand, a single polypeptide of 22 kDa was
detected in the flow through fraction of the G1485A mutant
(Figure 4B, lane 2). All together these results indicate that the Sl-
eIF4E1 G1485A splicing mutant encode for a truncated eIF4E1
protein that is impaired in cap-binding activity.
Discussion
Several EMS-mutagenized populations have been described in
tomato, however, information on the quality of the mutagenesis and
production and maintenance of the seed stocks are often unavailable.
We have chosen to set up the TILLING platform on M82 mutant
collection for which phenotypic data based on visual characterization
of M2 plants from young seedling to fruit maturation stages were
generated and categorized into a morphological catalogue that can be
searched and accessed via the web ([42]; http://zamir.sgn.cornell.
edu/mutants/). M82 is also a cultivar that performs well under
various growth environments and many genetic resources were
created based on this genetic material.
In order to exploit the mutant population using reverse genetics,
genomic DNA was prepared from the mutant lines via high-
throughput automated protocols and organized in pools for bulked
screening. Although DNA sequence methods are considered the
golden standard for mutation discovery, identification of rare
mutations in large populations using next-generation sequencing
machines is still a challenge. This is mainly due to the high frequency
of sequence errors, and thus, identification of true mutants requires
statistics methods and validation of large numbers of putative
mutations [48,49,50,51]. In this work, we have chosen to till
Figures 1. Representation of induced mutations in
Sl-eIF4E1
,
Sl-eIF4E2
,
Sl-eIF(iso)4E
,
Sl-eIF4G
and
Sl-eIF(iso)4G
.Black boxes represent the
exons. Lanes linking exons indicate introns. Dashed lines indicate the genomic regions screened for mutations. Triangles pointing up indicate
mutations in coding regions, whereas those pointing down indicate mutations in noncoding regions. Red, black and grey triangles represent
alterations causing truncations, missense and silent mutations, respectively. Only exons 7 to 9 are shown for Sl-eIF4G.
doi:10.1371/journal.pone.0011313.g001
Virus Resistant Plants
PLoS ONE | www.plosone.org 4 June 2010 | Volume 5 | Issue 6 | e11313

candidate genes using the ENDO1 system, mainly because of its low
cost and the low number of false positives [45,52].
In our TILLING screens of the 19 genes, on average, we identified
8 alleles per tilled kilobase, estimated from the tilled 30.9 kb and the
256 identified alleles. We also calculated the overall mutation rate of
one mutation every 574 kb in M82 mutant collection. This mutation
frequency is 2-fold lower than the rate of one mutation per 300 kb
reported for A. thaliana [21] or one mutation per 200 kb reported for
Pisum sativum [52], and 2-fold higher than the rate of one mutation per
megabase reported for barley [53]. A much more saturated mutation
density has been observed in polyploid species (1/40 kb in tetraploı
¨d
wheat and 1/24 kb in hexaploı
¨d wheat) [54], however such species
are able to withstand much higher doses of EMS without obvious
impact on survival or fertility rates, probably due to multiple gene
redundancies in their polyploid genomes. The systematic analysis of
4 000 induced mutations in Escherichia coli lac repressor, reported in
[55], has revealed that 41% of the alterations affect the protein
function. Thus 8 alleles per kilobase obtained in our TILLING
screens would be sufficient to identify mutations that alter the
function of the tilled protein.
Translation initiation factor-mediated virus resistance is a wide
spread mechanism in plants [32]. To engineer new resistance
alleles we screened for mutations in translation factors and
identified 83 alleles out of which 7 were in eIF4E1. Because
potyvirus resistance in a range of plant species was previously
demonstrated to result from amino acid changes or knock-out of
eIF4E or eIF(iso)4E proteins, resistance assays were carried out on
these mutants. Among the 7 eIF4E1 mutants, resistance to
potyvirus was only identified in the Sl-eIF4E1 G1485A mutant
line. The feature of this mutant is that it is affected in the pre-
mRNA splicing of Sl-eIF4E1 and encodes for a truncated mRNA
lacking exons 2 and 3. The putative encoded protein is therefore
106 amino acids long in comparison with the 231 amino acids of
the wild type protein. Several amino acids demonstrated to be
hallmarks of functional eIF4E proteins are lacking, including
amino acids involved in cap-binding and stabilization of the
protein structure [56]. The inability of Sl-eIF4E1 G1485A to bind
m7G-sepharose column in vitro confirmed that this truncated
eIF4E1 protein is non-functional for cap-binding. Nevertheless,
plants homozygous for the mutation do not display any obvious
growth and developmental phenotypes, in agreement with the
known ability of eIF4E proteins to compensate for one another in
Table 3. Mutations discovered in Sl-eIF4E1,Sl-eIF4E2,
Sl-eIF(iso)4E,Sl-eIF4G, and Sl-eIF(iso)4G.
Gene name
GenBank
Accession n
u
Nucleotide
changes
Amino acid
changes
Sl
-eIF4E1 GQ451830 G1171A D/N
G1242A L =
G1485A Splicing site
Sl
-eIF4E2 GQ451831 G254A W/Stop
Sl
-eIF(iso)4E GQ451832 G57A E =
C878T S =
G882A V/I
G967A W/Stop
G1213A S/N
G1225A S/N
Sl
-eIF4G GQ451834 A1602T K/I
G1614A R/K
C1860T S/F
C1899T A/V
C1996T A =
G2042A D/N
C2058T T/I
A2064T N/I
T2072A L/I
C2202T T/I
G2236A E =
G2239A K =
G2239A K =
G2246A E/K
G2366A E/K
C2406T P/L
C2411T L =
C2411T L =
G2618A E/D
C2635T S =
C2635T S =
G2637A S/N
A2659T E =
G3068A D/N
C3095T L =
C3136T D =
G3192A G/D
G3272A A/T
C3277T A =
C3290T L =
C3377T E =
C3377T E =
G3427A E =
A3689T N/Y
A5490T S/C
G5647A V/I
Gene name
GenBank
Accession n
u
Nucleotide
changes
Amino acid
changes
Sl
-eiF(iso)4G GQ451835 G2114A R =
G2157A E/K
G2174A K =
G2438A M/I
G2477A Q =
C2486T P =
C2682T S/F
C2771T P/S
C3182T L =
G3397A R =
Only exonic mutations are shown. The position of the mutations are indicated
relative to the first base of the GenBank sequences.
doi:10.1371/journal.pone.0011313.t003
Table 3. Cont.
Virus Resistant Plants
PLoS ONE | www.plosone.org 5 June 2010 | Volume 5 | Issue 6 | e11313

cellular functions [39,47,57]. Other eIF4E mutants, including
those with a stop codon in exon 1 of Sl-eIF4E2 and a stop codon in
exon 2 of Sl-eIF(iso)4E, were fully susceptible to potyviruses.
Altogether, these results confirm the central role of eIF4E1 for
potyvirus resistance in solanaceous crops [32,34].
A complete resistance to most of PVY and TEV strains was
identified in the wild tomato relatives S. habrochaites PI247087.
Genetic and functional analyses suggested that this resistance is
mediated by a few number of amino acid changes in translation
initiation factor eIF4E1 [41]. In link with the result obtained in
this study, it is striking that the Sl-eIF4E1 G1485A mutant line is
immune to PVY-LYE90 and PepMoV-Texas, but susceptible to
other common strains of PVY and TEV, including PVY-LYE84
and TEV-HAT. One possible explanation to the narrow resistance
spectrum of the Sl-eIF4E1 G1485A mutant line could be that
PVY-LYE90 and PepMoV-Texas specifically require Sl-eIF4E1 as
host factor for their infectious cycle whereas PVY-LYE84 and
TEV-HAT may use more than one eIF4E protein forms to infect
the plant. Such a situation was already described in pepper, where
simultaneous mutations in translation initiation factors eIF4E1 and
eIF(iso)4E are required to prevent infection by the potyvirus Pepper
veinal mottle virus [39]. This hypothesis will be addressed by
obtaining and phenotyping the Sl-eIF4E1 G1485A and Sl-
eIF(iso)4E W105Stop double mutants.
A screen for mutations was also performed in translation
initiation factors eIF4G and eIF(iso)4G. Among the 43 Sl-eIF4G
and 16 Sl-eIF(iso)4G point mutants obtained, 20 for eIF4G and 4
for eIF(iso)4G respectively correspond to missense mutations.
Among these, 4 Sl-eIF4G and 4 Sl-eIF(iso)4G mutants showed
amino acid changes in the MiF4G domain demonstrated to be
involved interaction with Rice yellow mottle virus [33]. Nevertheless,
none of the mutant lines showed virus resistance. Although
mutations in eIF4G factors responsible for potyvirus resistance
were never identified in the natural diversity of cultivated species,
the requirement of eIF4G for potyvirus infection was demonstrat-
ed through susceptibility analysis of A. thaliana knocked-out for
eIF4G genes [58]. As above, functional redundancy between
eIF4G and eIF(iso)4G may be the cause of the full susceptibility of
the mutant lines.
Conclusion
In conclusion, our results on eIF4E show that TILLING is an
appropriate technology to engineer new resistance alleles to
economicallyimportantplantviruses,usingastargethostfactors
required for the viral infectious cycle. The new eIF4E1 allele, Sl-
eIF4E1 G1485A, discovered by TILLING could be used as a new
genetic resource for potyvirus resistance in tomato breeding
programs. As the EMS mutants are nontransgenic, subsequent
generations can be grown under field conditions, without restrictions,
for phenotypic analysis and advantageous alleles can be immediately
incorporated into a fast-paced molecular breeding program using the
characterized induced mutations as markers for selection.
Methods
Plant material and growing conditions
The S. lycopersicum cv. M82. mutant collection was described
previously [42]. Plants were grown in a growth chamber at 25uC
day, 19uC night, 50% relative humidity and 12h day length.
Figure 2. Potyvirus resistance assays of the
Sl
-eIF4E1 G1485A
splicing mutant. Sl-eIF4E1 G1485A mutant and the corresponding Hm-
WT were inoculated with PVY-LYE90, PVY-LYE84, TEV-HAT or PepMoV-
Texas. (A) At 15 dpi, plants were assayed for potyviral coat protein
accumulation by DAS-ELISA in non-inoculated leaves. (B) PVY-LYE90 and
PepMoV RNA accumulation was assessed by RT-PCR in inoculated (il) and
systemic leaves (sl). Mock indicates non inoculated M82 plants.
doi:10.1371/journal.pone.0011313.g002
Figure 3. cDNA analysis of
Sl
-eIF4E1 G1485A splicing mutant. (A) Total RNA was extracted from leaf tissues of the Hm-WT and G1485A
mutant and full lengh cDNAs were amplified and analysed on 1% agarose gel. (B) Northern analysis of Sl-eIF4E1 from Hm-WT and G1485A mutant
lines, using exon 1 as probe. (C) Representation of the cDNA structure of the wildtype and the G1485A mutant form. The G1485A mutation is shown
by a dashed rectangle.
doi:10.1371/journal.pone.0011313.g003
Virus Resistant Plants
PLoS ONE | www.plosone.org 6 June 2010 | Volume 5 | Issue 6 | e11313

Genomic DNA extraction and pooling
Eighteen tomato leaf discs (diameter 10mm) from six individual
plants per M3 family were collected in 96-well plates containing 2
steel beads (4mm) per well, and tissues were ground using a bead
mill. Genomic DNA was isolated using the Dneasy 96 Plant Kit
(Qiagen, Hilden, Germany). DNAs were quantified on a 0.8%
agarose gel using lDNA (Invitrogen, Carlsbad, USA) as a
concentration reference. DNA samples were diluted tenfold and
pooled eightfold in a 96-well format. A population of 4759 arrayed
DNAs from mutagenized individuals is presently available for
screening.
PCR amplification and mutation detection
The GenBank accession numbers of sequences we produced for
TILLING are GQ451830 (Sl-eIF4E1), GQ451831 (Sl-eIF4E2),
GQ451832 (Sl-eIF(iso)4E), GQ451834 (Sl-eIF4G) and GQ451835
(Sl-eIF(iso)4G). PCR amplification is based on nested-PCR. The
first PCR amplification is a standard PCR reaction using target-
specific primers and 4 ng of tomato genomic DNA. One microlitre
of the first PCR served as a template for the second nested PCR
amplification, using gene-specific inner primers labelled at the
59end with infra-red dyes IRD700 and IRD800 (see Table 4, LI-
CORH, Lincoln, Nebraska, USA). Mutation detection was carried
out as described previously [45]. The identity of the mutations was
determined by sequencing.
Potyvirus strains and disease resistance evaluation
All plants were grown under greenhouse conditions and
transferred into growth chambers before inoculation. The
susceptibility of M82, homozygous mutant lines and their
corresponding homozygous wild type (Hm-WT) to PVY, PepMoV
and TEV were determined by mechanical inoculation of 12 plants
per genotype at the two-leaf stage using PVY-LYE84 [59], PVY-
LYE90 [59], TEV-HAT [60] and PepMoV-Texas strains [61].
PVY and PepMoV strains were maintained on Capsicum annuum
Yolo Wonder plants and TEV strain on Datura stramonium plants,
respectively, and transferred every 4–8 weeks. Inoculum and
mechanical inoculation procedures were as described previously
[62]. Fifteen days post-inoculation (dpi), systemic infection was
assayed by determining the presence/absence of symptoms on
non-inoculated leaves and confirmed by DAS-ELISA using PVY,
TEV or PepMoV antibodies.
PVY and PepMoV RNAs accumulation were assessed by RT-
PCR on inoculated and upper non-inoculated leaves of the Sl-
eIF4E1 splicing mutant G1485A, the corresponding Hm-WT and
M82. Total RNA was isolated from leaf tissue using TRI Reagent
(Sigma, Aldrich) and 2 ml was used for reverse transcription
followed by polymerase chain reaction (RT-PCR). RT-PCR for
PVY and PepMoV were performed with primers specific for the
VPg (PVY-forward, 59-GGCAAGAATAAATCCAAGAGAATA-
39; PVY-reverse, 59- TTCATGCTCTACTTCTTGACTGGG-
39; PepMoV-forward, 59-AGAGGATCCTAGGACGCTCTAA-
GACGAAAAGAATT-39; PepMoV-reverse, 59-ATAGTC-
GACTTTATTCGTGCTTCACAACTTCCTTTGG-39). RT-
PCR for Sl-eIF4E1 cDNA amplification was used as control.
39-RACE PCR and northern analysis
Total RNA was isolated from 100 mg leaf tissues of the Sl-
eIF4E1 G1485A splicing mutant and its corresponding Hm-WT
using Tri-Reagent (Sigma-Aldrich, St Louis, USA). 39RACE-
PCR was performed using the GIBCO/BRL Life Technologies 39
RACE System. In a first step, a nested 39RACE-PCR was
performed with a forward primer encompassing the Sl-eIF4E1
start codon (59-ATGGCAGCAGCTGAAATGGAGAGA-39)in
combination with the adapter primer (AUAP) of the kit. A dilution
(1/100) of this PCR was used for the second PCR with a forward
primer hybridizing in exon 1 of Sl-eIF4E1 (59-GCATCGTATT-
TAGGGAAAGAAATC-39) and the AUAP primer. All amplifi-
cations were performed with High Fidelity Platinium Taq
polymerase (GIBCO/BRL, Life Technologies). PCR products
were sequenced by Genome Express (Grenoble, France). Northern
blot analysis was performed using standard procedures [63] using
a[
32
P]-labelled Sl-eIF4E1 antisense RNA probe complementary
to exon 1 of the Sl-eIF4E1 cDNA.
Protein purification and cap-affinity chromatography
Total proteins were extracted by grinding 100 mg of leaf tissues
in Laemmli buffer (0.125 mM Tris-HCl pH6.8, 10% b-mercap-
toethanol, 4% SDS, 0.004 mM Bromophenol blue and 20%
glycerol). For cap-binding analysis, total soluble proteins were
extracted by grinding 500 mg of leaf tissues in 1 ml of extraction
buffer (20 mM HEPES pH 7.6, 0.1 M KCl, 2 mM EDTA and
5% Glycerol). After centrifugation (15 600 g, 5 min), the super-
natant was recovered and incubated with 100 mlofm
7
GTP
Sepharose 4B (Amersham Biotech) at 4uC for 16h. The beads
were pelleted for 2 min at 15 600g and washed extensively with
extraction buffer. The proteins retained were eluted with
extraction buffer containing 100 mMm
7
GDP. The different
fractions (elution, wash and supernatant) were analyzed by
western blotting. Proteins were resolved using standard 12.5%
sodium dodecyl sulphate-polyacrylamide gel electrophoresis and
transferred to a 0.22 mm-pore-size nitrocellulose membrane by
electroblotting. The membranes were blocked with 3% BSA-
TTBS (20 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween) and
were incubated with the Nt-eIF4E antibody (gift from David
Twell, Univ. Leicester, UK, [47] diluted 1/1 000 with 3% BSA-
TTBS for 1 h at room temperature. Then, membranes were
washed 3 times in TTBS buffer and incubated with alkaline
phosphatase–conjugated anti-rabbit antibodies diluted 1/10000
for 1 hour. After washing, the signal was visualized with nitroblue
tetrazolium.
Figure 4. Protein analysis of
Sl
-eIF4E1 G1485A splicing mutant.
(A) Western blot analysis of total soluble leaf protein of N. tabacum,S.
lycopersicum Hm-WT and Sl-eIF4E1 G1485A mutant probed with an
antibody raised against N. tabacum Nt-eIF4E1. (B) Soluble protein
extracts of the Hm-WT and G1485A mutant were purified by affinity
chromatography on m7G-sepharose column. Total protein extract (lane
1), the flow through (lane 2), the wash (lane 3) and the bound eIF4E
proteins eluted with an m7GDP-cap analogue were analysed by
Western blot, using Nt-eIF4E antibody.
doi:10.1371/journal.pone.0011313.g004
Virus Resistant Plants
PLoS ONE | www.plosone.org 7 June 2010 | Volume 5 | Issue 6 | e11313

Acknowledgments
We thank P. Audigier and C. Lepage for plant care and A. Boualem, A.
Martin, C. Clepet and A. Winger for discussions and comments on the
manuscript.
Author Contributions
Conceived and designed the experiments: CC AB. Performed the
experiments: FP MN SM EP AM AS. Analyzed the data: AB. Contributed
reagents/materials/analysis tools: FP DZ. Wrote the paper: FP MN CC
AB.
References
1. Pedley KF, Martin GB (2 003) Molecular basis of Pto-mediated resistance to
bacterial speck disease in tomato. Annu Rev Phytopathol 41: 215–243.
2. Gillaspy G, Ben-David H, Gruissem W (1993) Fruits: A Developmental
Perspective. Plant Cell 5: 1439–1451.
Table 4. Primers used to amplify Sl-eIF4E1,Sl-eIF4E2,Sl-eIF(iso)4E,Sl-eIF4G and Sl-eIF(iso)4G genes and the size of the tilled
amplicons.
Gene Primers name* Sequence (59to 39)
Fragment
size (bp)
SleIF4E1 SleIF4E1-ext-F1 ATGGCAGCAGCTGAAATGGAGAGAACGATGT 395
SleIF4E1-ext-R1 GACTATCTAAACTTTCTCGAGGATTTG
SleIF4E1-F1 TGAAATGGAGAGAACGATGT 331
SleIF4E1-R1 GTTTTCCCTTACACTACACTATCAC
SleIF4E1-ext-F2 GTACAACTTGAACGATGACATACCTG 1381
SleIF4E1-ext-R3 CTAGTACCTACCAACCTTTCCAGTACG
SleIF4E1-F2 TAGGTCTTTGAAATGCTATTATCCT 822
SleIF4E1-R2 ACGAGACAAAACAATATCACACTTT
SleIF4E1-F3 AAGTCATCAGATATATAGGAAGTGC 665
SleIF4E1-R3 GTGTTTCTTGCAATCCCACACTGCATC
SleIF4E2 SleIF4E2-ext-F1 GCAGGCGGGACGAAAACACCAAAAATG 471
SleIF4E2-ext-R1 AGTACTAGAGATTTCTGCTACATGC
SleIF4E2-F1 GGGACGAAAACACCAAAAATG 324
SleIF4E2-R1 AAAACATTAGAAACCCTAATCCTAC
SleIF(iso)4E SleIF(iso)4E-ext-F1 CTATACAAAAGGAGAGGATTTTGAC 1381
SleIF(iso)4E-ext-R1 CAGAGATAGTGGAACAATAACACAG
SleIF(iso)4E-F1 GGAGAGGATTTTGACGGGAAAACA 1340
SleIF(iso)4E-R1 GTTCTGAAGCTATATAACACCAGAG
SleIF4G SleIF4G-ext-F1 CTGAACCTTTGGATTCCAGAAATCAGG 1148
SleIF4G-ext-R1 CCAGGCATCTTATTCCACTTGTCTC
SleIF4G-F1 CTTTGGATTCCAGAAATCAGGATGCG 1137
SleIF4G-R1 CATCTTATTCCACTTGTCTCCATCC
SleIF4G-ext-F2 AATACTATCTGGACCAATGCAATCC 979
SleIF4G-ext-R2 ACTAGGAGTACGAGCAAGCCTAGTAGC
SleIF4G-F2 CACAGAATATGCACAAAGCTGAAGT 846
SleIF4G-R2 TAGGAGTACGAGCAAGCCTAGTAGC
SleIF4G-ext-F3 ATACATGCCTGAGCGATTATCTAGT 1698
SleIF4G-ext-R3 CCCCCACCTATTAAAACCCTAAATA
SleIF4G-F3 GCCTGAGCGATTATCTAGTCAACAT 1626
SleIF4G-R3 AAAGTTCTCAAGCCGCATAGTAGAG
SleIF(iso)4G SleIF(iso)4G-ext-F1 CTCTCTCTGTATCCCTTTCCATCTCT 1709
SleIF(iso)4G-ext-R1 TTTAGTACATCAGGTGTCAAACTTGC
SleIF(iso)4G-F1 GTTTTCACTTGCACATGAGACTACTAC 1300
SleIF(iso)4G-R1 GATAATGACAACTGGGAAGTTCCTA
SleIF(iso)4G-ext-F2 AACTAGGAAGATGCCTGGTACACCT 1156
SleIF(iso)4G-ext-R2 CAAAGAGAGGAGATAAACAAATAACT
SleIF(iso)4G-F2 ACACCTGATGTACTAAAGAGAAAAA 717
SleIF(iso)4G-R2 AAATCTTTCTTTCAACATACTACTACC
*F and R indicate forward and reverse primers, respectively.
doi:10.1371/journal.pone.0011313.t004
Virus Resistant Plants
PLoS ONE | www.plosone.org 8 June 2010 | Volume 5 | Issue 6 | e11313

3. Alba R, Payton P, Fei Z, McQuinn R, Debbie P, et al. (2005) Transcriptome
and selected metabolite analyses reveal multiple points of ethylene control during
tomato fruit development. Plant Cell 17: 2954–2965.
4. Giovannoni J (2001) Molecular Biology of Fruit Maturation and Ripening. Annu
Rev Plant Physiol Plant Mol Biol 52: 725–749.
5. Giovannoni JJ (2007) Fruit ripening mutants yield insights into ripening control.
Curr Opin Plant Biol 10: 283–289.
6. Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An
ethylene-inducible component of signal transduction encoded by never-ripe.
Science 270: 1807–1809.
7. Carrari F, Baxter C, Usadel B, Urbanczyk-Wochniak E, Zanor MI, et al. (2006)
Integrated analysis of metabolite and transcript levels reveals the metabolic shifts
that underlie tomato fruit development and highlight regulatory aspects of
metabolic network behavior. Plant Physiol 142: 1380–1396.
8. Ohyama A, Ito H, Sato T, Nishimura S, Imai T, et al. (1995) Suppression of acid
invertase activity by antisense RNA modifies the sugar composition of tomato
fruit. Plant Cell Physiol 36: 369–376.
9. Robinson NL, Hewitt JD, Bennett AB (1988) Sink Metabo lism in Tomato Fruit:
I. Developmental Changes in Carbohydrate Metabolizing Enzymes. Plant
Physiol 87: 727–730.
10. Bramley PM (2002) Regulation of carotenoid formation during tomato fruit
ripening and development. J Exp Bot 53: 2107–2113.
11. Isaacson T, Ronen G, Zamir D, Hirschberg J (2002) Cloning of tangerine from
tomato reveals a carotenoid isomerase essential for the production of beta-
carotene and xanthophylls in plants. Plant Cell 14: 333–342.
12. Frary A, Nesbitt TC, Grandillo S, Knaap E, Cong B, et al. (2000) fw2.2: a
quantitative trait locus key to the evolution of tomato fruit size. Science 289: 85–88.
13. Wang Y, Li J (2008) Molecular basis of plant architecture. Annu Rev Plant Biol
59: 253–279.
14. Doganlar S, Frary A, Ku HM, Tanksley SD (2002) Mapping quantitative trait
loci in inbred backcross lines of Lycopersicon pimpinellifolium (LA1589).
Genome 45: 1189–1202.
15. D’Agostino N, Aversano M, Frusciante L, Chiusano ML (2007) TomatEST
database: in silico exploitation of EST data to explore expression patterns in
tomato species. Nucleic Acids Res 35: D901–905.
16. Fei Z, Tang X, Alba RM, White JA, Ronning CM, et al. (2004) Comprehensive
EST analysis of tomato and comparative genomics of fruit ripening. The Plant
Journal 40: 47–59.
17. Moco S, Bino RJ, Vorst O, Verhoeven HA, de Groot J, et al. (2006) A Liquid
Chromatography-Mass Spectrometry-Based Metabolome Database for Tomato.
Plant Physiol 141: 1205–1218.
18. Stack SM, Royer SM, Shearer LA, Chang SB, Giovannoni JJ, et al. (2009) Role
of fluorescence in situ hybridization in sequencing the tomato genome.
Cytogenet Genome Res 124: 339–350.
19. Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, et al. (2003) Genome-
wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657.
20. Waterhouse PM, Graham MW, Wang MB (1998) Virus resistance and gene
silencing in plants can be induced by simultaneous expression of sense and
antisense RNA. Proc Natl Acad Sci U S A 95: 13959–13964.
21. Greene EA, Codomo CA, Taylor NE, Henikoff JG, Till BJ, et al. (2003)
Spectrum of Chemically Induced Mutations From a Large-Scale Reverse-
Genetic Screen in Arabidopsis. Genetics 164: 731–740.
22. Comai L, Henikoff S (2006) TILLING: practical single-nucleotide mutation
discovery. Plant J 45: 684–694.
23. Henikoff S, Till BJ, Comai L (2004) TILLING. Traditional mutagenesis meets
functional genomics. Plant Physiol 135: 630–636.
24. McCallum CM, Comai L, Greene EA, Henikoff S (2000) Targeting induced
local lesions IN genomes (TILLING) for plant functional genomics. Plant Physiol
123: 439–442.
25. Bentley A, MacLennan B, Calvo J, Dearolf CR (2000) Targeted recovery of
mutations in Drosophila. Genetics 156: 1169–1173.
26. Coghill EL, Hugill A, Parkinson N, Davison C, Glenister P, et al. (2002) A gene-
driven approach to the identification of ENU mutants in the mouse. Nat Genet
30: 255–256.
27. Colbert T, Till BJ, Tompa R, Reynolds S, Steine MN, et al. (2001) High-
throughput screening for induced point mutations. Plant Physiol 126: 480–484.
28. Perry JA, Wang TL, Wel ham TJ, Gardner S, Pike JM, et al. (2003) A TILLING
reverse genetics tool and a web-accessible collection of mutants of the legume
Lotus japonicus. Plant Physiol 131: 866–871.
29. Leonard S, Plante D, Wittmann S, Daigneault N, Fortin MG, et al. (2000)
Complex formation between potyvirus VPg and translation eukaryotic initiation
factor 4E correlates with virus infectivity. J Virol 74: 7730–7737.
30. Revers Fdr, Le Gall O, Candresse T, Maule AJ (1999) New Advances in
Understanding the Molecular Biology of Plant/Potyvirus Interactions. Molec-
ular Plant-Microbe Interactions 12: 367–376.
31. Maule A, Caranta C, Boulton M (2007) Sources of natural resistance to plant
viruses: status and prospects. Molecular Plant Pathology 8: 223–231.
32. Robaglia C, Caranta C (2006) Translation initiation factors: a weak link in plant
RNA virus infection. Trends Plant Sci 11: 40–45.
33. Albar L, Bangratz-Reyser M, Hebrar d E, Ndjiondjop MN, Jones M, et al. (2006)
Mutations in the eIF(iso)4G translation initiation factor confer high resistance of
rice to Rice yellow mottle virus. Plant J 47: 417–426.
34. Charron C, Nicolai M, Gallois JL, Robaglia C, Moury B, et al. (2008) Natural
variation and functional analyses provide evidence for co-evolution between
plant eIF4E and potyviral VPg. Plant J 54: 56–68.
35. Kang BC, Yeam I, Frantz JD, Murphy JF, Jahn MM (2005) The pvr1 locus in
Capsicum encodes a translation initiation factor eIF4E that interacts with
Tobacco etch virus VPg. Plant J 42: 392–405.
36. Yeam I, Cavatorta JR, Ripoll DR, Kang BC, Jahn MM (2007) Functional
dissection of naturally occurring amino acid substitutions in eIF4E that confers
recessive potyvirus resistance in plants. Plant Cell 19: 2913–2928.
37. Gallie DR, Browning KS (2001) eIF4G functionally differs from eIFiso4G in
promoting internal initiation, cap-independent translation, and translation of
structured mRNAs. J Biol Chem 276: 36951–36960.
38. Hwang J, Li J, Liu WY, An SJ, Cho H, et al. (2009) Double mutations in eIF4E
and eIFiso4E confer recessive resistance to Chilli veinal mottle virus in pepper.
Mol Cells 27: 329–336.
39. Ruffel S, Gallois JL, Moury B, Robaglia C, Palloix A, et al. (2006) Simultaneous
mutations in translation initiation factors eIF4E and eIF(iso)4E are required to
prevent pepper veinal mottle virus infection of pepper. J Gen Virol 87:
2089–2098.
40. Parrella G, Ruffel S, Moretti A, Morel C, Palloix A, et al. (2002) Recessive
resistance genes against potyviruses are localized in colinear genomic regions of
the tomato (Lycopersicon spp.) and pepper (Capsicum spp.) genomes. Theor
Appl Genet 105: 855–861.
41. Ruffel S, Gallo is JL, Lesage ML, Caranta C (2005) The recessive potyvirus
resistance gene pot-1 is the tomato orthologue of the pepper pvr2-eIF4E gene.
Mol Genet Genomics 274: 346–353.
42. Menda N, Semel Y, Peled D, Eshed Y, Zamir D (2004) In silico screening of a
saturated mutation library of tomato. Plant J 38: 861–872.
43. Till BJ, Reynolds SH, Greene EA, Codomo CA, Enns LC, et al. (2003) Large-
scale discovery of induced point mutations with high-throughput TILLING.
Genome Res 13: 524–530.
44. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general use rs and for
biologist programmers. Methods Mol Biol 132: 365–386.
45. Triques K, Sturbois B, Gallais S, Dalmais M, Chauvin S, et al. (2007)
Characterization of Arabidopsis thaliana mismatch specific endonucleases:
application to mutation discovery by TILLING in pea. Plant J 51: 1116–1125.
46. Ruffel S, Caranta C, Palloix A, Lefebvre V, Caboche M, et al. (2004) Structural
analysis of the eukaryotic initiation factor 4E gene controlling potyvirus
resistance in pepper: exploitation of a BAC library. Gene 338: 209–216.
47. Combe JP, Pet racek ME, van Eldik G, Meulewaeter F, Twell D (2005)
Translation initiation factors eIF4E and eIFiso4E are required for polysome
formation and regulate plant growth in tobacco. Plant Mol Biol 57: 749–760.
48. Hoffmann C, Minkah N, Leipzig J, Wang G, Arens MQ, et al. (2007) DNA bar
coding and pyrosequencing to identify rare HIV drug resistance mutations.
Nucleic Acids Res 35: e91.
49. Huse SM, Huber JA, Morrison HG, Sogin ML, Welch DM (2007) Accuracy and
quality of massively parallel DNA pyrosequencing. Genome Biol 8: R143.
50. Rigola D, van Oeveren J, Janssen A, Bonne A, Schn eiders H, et al. (2009) High-
throughput detection of induced mutations and natural variation using KeyPoint
technology. PLoS One 4: e4761.
51. Wang C, Mitsuya Y, Gharizadeh B, Ronaghi M, Shafer RW (2007)
Characterization of mutation spectra with ultra-deep pyrosequencing: applica-
tion to HIV-1 drug resistance. Genome Res 17: 1195–1201.
52. Dalmais M, Schmidt J, Le Signor C, Moussy F, Burstin J, et al. (2008)
UTILLdb, a Pisum sativum in silico forward and reverse genetics tool. Genome
Biology 9: R43.
53. Caldwell DG, McCallum N, Shaw P, Muehlbauer GJ, Marshall DF, et al. (2004)
A structured mutant population for forward and reverse genetics in Barley. The
Plant Journal 40: 143–150.
54. Slade AJ, Fuerstenberg SI, Loeffler D, Steine MN, Facciotti D (2005) A reverse
genetic, nontransgenic approach to wheat crop improvement by TILLING. 23:
75–81.
55. Markiewicz P, Kleina LG, Cruz C, Ehret S, Miller JH (1994) Genetic Studies of
the lac Repressor. XIV. Analysis of 4000 Altered Escherichia coli lac Repressors
Reveals Essential and Non-essential Residues, as well as ‘‘Spacers’’ which do not
Require a Specific Sequence. Journal of Molecular Biology 240: 421–433.
56. Marcotrigiano J, Gingras AC, Sonenberg N, Burley SK (1997) Cocrystal
structure of the messenger RNA 59cap-binding protein (eIF4E) bound to 7-
methyl-GDP. Cell 89: 951–961.
57. Duprat A, Caranta C, Revers F, Menand B, Browning KS, et al. (2002) The
Arabidopsis eukaryotic initiation factor (iso)4E is dispensable for plant growth
but required for susceptibility to potyviruses. Plant J 32: 927–934.
58. Nicaise V, Gallois JL, Chaf iai F, Allen LM, Schurdi-Levraud V, et al. (2007)
Coordinated and selective recruitment of eIF4E and eIF4G factors for potyvirus
infection in Arabidopsis thaliana. FEBS Lett 581: 1041–1046.
59. Moury B, Morel C, Johansen E, Guilbaud L, Souche S, et al. (2004) Mutations
in Potato virus Y Genome-Linked Protein Determine Virulence Toward
Recessive Resistances in Capsicum annuum and Lycopersicon hirsutum.
Molecular Plant-Microbe Interactions 17: 322–329.
60. Schaad MC, Anderberg RJ, Carrington JC (2000) Strain-Specific Interaction of
the Tobacco Etch Virus NIa Protein with the Translation Initiation Factor
eIF4E in the Yeast Two-Hybrid System. Virology 273: 300–306.
61. Vance V, Moore D, Turpen T, Bracker A, Hollowell V (1992) The complete
nucleotide sequence of pepper mottle virus genomic RNA: comparison of the
Virus Resistant Plants
PLoS ONE | www.plosone.org 9 June 2010 | Volume 5 | Issue 6 | e11313

encoded polyprotein with those of other sequenced potyviruses. Virology 191:
19–30.
62. Caranta C, Palloix A (1996) Both common and specific genetic factors are
involved in polygenic resistance of pepper to several potyviruses. Theoretical and
Applied Genetics 92: 15–20.
63. Sambrook J, Frisch E, Maniatis T (1989) Molecular cloning: a laboratory
manual. 2nd eds Cold Spring Harbor Laboratory press.
Virus Resistant Plants
PLoS ONE | www.plosone.org 10 June 2010 | Volume 5 | Issue 6 | e11313