Evidence for a role of glutamate as an efferent transmitter in taste buds.

Abstract

Glutamate has been proposed as a transmitter in the peripheral taste system in addition to its well-documented role as an umami taste stimulus. Evidence for a role as a transmitter includes the presence of ionotropic glutamate receptors in nerve fibers and taste cells, as well as the expression of the glutamate transporter GLAST in Type I taste cells. However, the source and targets of glutamate in lingual tissue are unclear. In the present study, we used molecular, physiological and immunohistochemical methods to investigate the origin of glutamate as well as the targeted receptors in taste buds.
Using molecular and immunohistochemical techniques, we show that the vesicular transporters for glutamate, VGLUT 1 and 2, but not VGLUT3, are expressed in the nerve fibers surrounding taste buds but likely not in taste cells themselves. Further, we show that P2X2, a specific marker for gustatory but not trigeminal fibers, co-localizes with VGLUT2, suggesting the VGLUT-expressing nerve fibers are of gustatory origin. Calcium imaging indicates that GAD67-GFP Type III taste cells, but not T1R3-GFP Type II cells, respond to glutamate at concentrations expected for a glutamate transmitter, and further, that these responses are partially blocked by NBQX, a specific AMPA/Kainate receptor antagonist. RT-PCR and immunohistochemistry confirm the presence of the Kainate receptor GluR7 in Type III taste cells, suggesting it may be a target of glutamate released from gustatory nerve fibers.
Taken together, the results suggest that glutamate may be released from gustatory nerve fibers using a vesicular mechanism to modulate Type III taste cells via GluR7.

Full text

Page 1

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Open Access
RESEARCH ARTICLE
Evidence for a role of glutamate as an efferent
transmitter in taste buds
© 2010 Vandenbeuch et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Com-
mons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduc-
tion in any medium, provided the original work is properly cited.
Research article
Aurelie Vandenbeuch*1,4, Marco Tizzano2,4, Catherine B Anderson1,4, Leslie M Stone3, Daniel Goldberg3 and
Sue C Kinnamon1,3,4
Abstract
Background: Glutamate has been proposed as a transmitter in the peripheral taste system in addition to its well-
documented role as an umami taste stimulus. Evidence for a role as a transmitter includes the presence of ionotropic
glutamate receptors in nerve fibers and taste cells, as well as the expression of the glutamate transporter GLAST in Type
I taste cells. However, the source and targets of glutamate in lingual tissue are unclear. In the present study, we used
molecular, physiological and immunohistochemical methods to investigate the origin of glutamate as well as the
targeted receptors in taste buds.
Results: Using molecular and immunohistochemical techniques, we show that the vesicular transporters for
glutamate, VGLUT 1 and 2, but not VGLUT3, are expressed in the nerve fibers surrounding taste buds but likely not in
taste cells themselves. Further, we show that P2X2, a specific marker for gustatory but not trigeminal fibers, co-localizes
with VGLUT2, suggesting the VGLUT-expressing nerve fibers are of gustatory origin. Calcium imaging indicates that
GAD67-GFP Type III taste cells, but not T1R3-GFP Type II cells, respond to glutamate at concentrations expected for a
glutamate transmitter, and further, that these responses are partially blocked by NBQX, a specific AMPA/Kainate
receptor antagonist. RT-PCR and immunohistochemistry confirm the presence of the Kainate receptor GluR7 in Type III
taste cells, suggesting it may be a target of glutamate released from gustatory nerve fibers.
Conclusions: Taken together, the results suggest that glutamate may be released from gustatory nerve fibers using a
vesicular mechanism to modulate Type III taste cells via GluR7.
Background
L-glutamate (hereafter referred to as glutamate) has been
proposed to play a role in neurotransmission in the
peripheral taste system [1,2]. Evidence supporting a role
for glutamate as a transmitter includes the expression of
glutamate receptors in taste cells [3-8] as well as the pres-
ence of the glutamate transporter GLAST [9]. However,
the origin of glutamate and its sites of action in the taste
bud are not well understood. For example, glutamate
could be released from taste cells to activate glutamate
receptors on adjacent taste cells or afferent nerve fibers.
Alternatively, glutamate could be released from either
gustatory or somatosensory nerve fibers to modulate the
activity of taste cells. Studies examining the function of
glutamate as a transmitter in the taste system are compli-
cated by the fact that glutamate is also a taste stimulus
that elicits the umami taste (for review, [10-12]. However,
gustatory nerve responses to glutamate induced umami
taste require much higher concentrations (e.g., 100 mM)
than those typically needed to activate neurotransmitter
receptors (high μM to low mM) [13,14].
Glutamate, the major excitatory neurotransmitter in
the central nervous system of vertebrates, acts on both
ionotropic (iGluRs) and metabotropic (mGluR) recep-
tors. Three pharmacological subtypes of iGluRs are acti-
vated by glutamate: N-methyl-D-aspartate (NMDA), (S)-
2-amino-3-(3-hydroxy-5-methyl-4-isoxazolyl) propionic
acid (AMPA) and Kainate receptors. Of these, taste
receptor cells express both NMDA and Kainate receptors,
which are believed to respond to glutamate as a transmit-
ter rather than a taste stimulus [4,5,15-17], although the
receptor subtypes and their expression patterns are not
clear. In addition to iGluRs, the peripheral taste system
contains several mGluRs, including mGluR1 [8,18],
mGluR2 and mGluR3 [6], and mGluR4 [3,7]. These
* Correspondence: aurelie.vandenbeuch@ucdenver.edu
1 Department of Otolaryngology, University of Colorado, Denver, CO, USA
Full list of author information is available at the end of the article

Page 2

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 2 of 12
receptors, as well as the heterodimeric umami taste
receptor T1R1 + T1R3 likely play a role in the detection
of L-glutamate as a tastant, while the mGluRs could also
potentially play a role in taste modulation by glutamate
released as a transmitter by taste cells or nerve fibers.
Taste cells are aggregated in taste buds, which contain
approximately 50-100 individual cells. Generally, 3 types
of taste cells are recognized based on functional and mor-
phological markers. Type I cells (about 50% of the total
number of cells in a bud) share many features of glial cells
in the nervous system [19]. These cells express enzymes
for inactivation and uptake of transmitters [20], including
the glutamate transporter GLAST [9]. Type II cells, also
called "receptor cells" (about 35% of the cells) possess the
G protein-coupled taste receptors and machinery for the
transduction of sweet, bitter and umami compounds.
These cells express downstream signalling effectors such
as Gα-gustducin, PLCβ2, IP3R3 and TRPM5 [21,22].
Although they do not form classical synaptic contacts
with gustatory nerve fibers, Type II cells release ATP via
hemichannels to communicate with nerve endings and
adjacent taste cells [23-25]. Finally, Type III cells, also
called "synaptic cells" (about 10-15% of the cells) form
conventional synapses with afferent gustatory nerve
fibers [21,22,26], although the identity of the transmitter
at the synapse is not known. Type III cells contain and
release serotonin [27-29] and norepinephrine [30], but
also express GAD67, an enzyme involved in the biosyn-
thesis of GABA [31]. In this study, we sought evidence for
release and function of glutamate as a transmitter in the
taste bud.
The participation of glutamate as a neurotransmitter
would imply the presence of vesicular transporters for
glutamate (VGLUTs), which are responsible for the trans-
port of glutamate from the cytosol into synaptic vesicles.
VGLUTs comprise 3 isoforms, VGLUT1, 2 and 3, which
are highly expressed in all glutamatergic neurons in the
central nervous system (for a recent review, see [32]). In
addition, VGLUT3 is expressed in inner hair cells of the
cochlea, where it is necessary for activation of auditory
afferent neurons [33]. VGLUTs would also imply the
presence of glutamate receptors on either nerve fibers or
taste cells that are activated by concentrations of gluta-
mate similar to those in the central nervous system. To
address these questions, we used a combination of physi-
ological, molecular and immunohistological techniques
to show that VGLUTs are not detected in taste cells, but
VGLUT1 and 2 are expressed in the afferent nerve fibers
surrounding taste cells. Further, we show that the Kainate
receptor GluR7 is selectively expressed in Type III taste
cells, where it may respond to glutamate released from
afferent nerve terminals. Portions of these results were
recently presented in abstract form [34,35]
Results
Expression of vesicular glutamate transporters (VGLUTs) in
taste tissue
Glutamate is usually released via a vesicular mechanism,
with the uptake of glutamate into vesicles regulated by
vesicular glutamate transporters (VGLUTs) [32]. We
extracted mRNA from pooled taste buds isolated from
circumvallate (CV) and fungiform (FF) papillae and used
RT-PCR to determine if VGLUTs are expressed in taste
cells. No RT-PCR products were detected for VGLUTs 1,
2, or 3 in the isolated taste buds, although products of the
correct size were expressed in brain (Figure 1). Moreover,
immunohistochemistry using specific antibodies against
the VGLUTs did not label any taste cells (Figures 2 and 3).
However, sections of circumvallate and fungiform papil-
lae show that both VGLUT1 and VGLUT2 immunoreac-
tivity are heavily expressed on nerve fibers innervating
taste buds (Figures 2 and 3). No specific immunoreactiv-
ity for VGLUT3 was observed in taste cells or nerve fibers
(data not shown). Since taste cells are surrounded by
somatosensory as well as gustatory nerve fibers, we used
an antibody against P2X2, a specific marker of gustatory
nerve fibers [36] to determine whether the VGLUT2 anti-
body specifically labels gustatory nerve fibers. The dou-
ble labeling showed that VGLUT2 is co-expressed with
P2X2; i.e., all P2X2 fibers were immunoreactive for
VGLUT2, but a few VGLUT2 positive fibers did not label
Figure 1 Gel image of PCR products for VGLUTs 1, 2 and 3 in
pooled taste buds. PCR products for VGLUT 1, 2, and 3 were not ob-
served in pooled taste buds from fungiform (FF) and circumvallate (CV)
papillae as well as in non taste epithelium (NT). Brain (BR) was used as
a control. Bands are for the expected size for VGLUT1 (398 bp), VGLUT2
(360 bp) and VGLUT3 (523 bp). Left lane indicates a 100-bp ladder.

Page 3

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 3 of 12
with the P2X2 antibody (Figure 3). This result suggests
that the majority of VGLUT2-labeled fibers are gustatory
fibers. To confirm this, we isolated mRNA from the
geniculate ganglion, which contains the cell bodies of the
chorda tympani nerve fibers that innervate the fungiform
taste buds. RT-PCR showed the expected expression of
VGLUT1 and 2 in the ganglion (Figure 4). In addition, the
ganglion was also sectioned and stained with antibodies
against VGLUT1 and 2, as well as P2X2. The results con-
firmed that the majority of ganglion cells were immuno-
reactive for both VGLUT1 and 2 and that VGLUT2-
immunoreactive cells also co-expressed P2X2 (Figure 5).
We also examined co-localization of VGLUTs 1 and 2 in
the ganglion, since in most systems these two VGLUTs
are expressed in mutually exclusive neuronal populations
[37]). However, we found that nearly all geniculate gan-
glion cells co-expressed VGLUT1 and 2. Taken together,
these results indicate that gustatory ganglion cells express
VGLUTs and that these VGLUTs are targeted to the dis-
tal end of the fibers within taste buds.
Taste cells respond to glutamate stimulation
VGLUT-labeled nerve fibers were present throughout the
taste bud. Labeled fibers appeared to associate with both
TRPM5-GFP labelled Type II cells (e.g., Figure 2 and 3)
and GAD67-GFP labelled Type III cells (Figure 3). To fur-
ther investigate which cell type might be the target of glu-
tamate released from nerve fibers, we used calcium
imaging to test whether Type II and/or Type III taste cells
respond to glutamate (as monosodium glutamate)
applied at concentrations expected for a neurotransmit-
ter. Since taste cells may also respond to glutamate as a
taste stimulus, we chose concentrations that would allow
us to differentiate taste responses from putative neu-
rotransmitter responses. For these experiments, 1 mM
and 10 mM glutamate were used to elicit neurotransmit-
ter responses, and 100 mM was used to activate gluta-
mate taste receptors responsible for transducing umami
taste [38]. Transgenic mice expressing GFP from the
T1R3 promoter were used to identify a subset of Type II
taste cells [21], those responding to umami and sweet
taste stimuli, and mice expressing GFP from the GAD67
promoter to identify Type III cells, since GAD67 is
expressed in a large subset of them [31]. In addition, cells
were also stimulated with a 55 mM KCl solution. Only
Type III cells express voltage-gated calcium channels and
respond to the application of KCl with an increase of
intracellular calcium [21]. T1R3-GFP cells responded pri-
marily to 100 mM glutamate. A total of 6 fungiform
T1R3-GFP cells (out of 46 cells tested), 2 circumvallate
T1R3-GFP cells (out of 18) and 2 palate T1R3-GFP cells
(out of 13) responded to glutamate at 100 mM (Figure
6A). Only 2 of these responding cells also responded to
Figure 2 VGLUT1 immunoreactivity in TRPM5-GFP mice. The figures illustrate the expression of GFP under the control of the TRPM5 promoter
(green), VGLUT1 (red) in circumvallate papillae (CV; A-C), fungiform papillae (FF; D-F). In circumvallate taste buds, VGLUT1 is not expressed in taste cells
but only in nerve fibers surrounding these taste cells. Each figure represents merged images from a Z-series. The Photoshop digital filters Dust &
Scratches and Unsharp Mask were used in some images to eliminate pixel noise in this and subsequent figures containing confocal images.

Page 4

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 4 of 12
glutamate at 10 mM. In GAD67-GFP cells, out of 53 cir-
cumvallate cells tested, 15 responded to 1 mM glutamate
while 14 additional cells responded to 10 mM glutamate
(Figure 6B). All the GAD67-GFP cells showed a response
to the high K+ stimulation as expected. These results
demonstrate a difference in the sensitivity of taste cells to
glutamate, with Type III cells responding to concentra-
tions likely to activate neurotransmitter receptors and
Type II cells requiring a higher concentration of gluta-
mate usually detected as a tastant.
Glutamate receptors involved in the glutamate response
We used an AMPA/Kainate glutamate receptor antago-
nist, NBQX, to identify AMPA/Kainate ionotropic gluta-
mate receptors involved in the response elicited by
glutamate in Type III cells, since these cells responded to
glutamate at concentrations expected for a neurotrans-
mitter receptor. NBQX partially blocked the response to
1 mM glutamate (n = 9 cells) as shown in Figure 6C, D.
Since previous studies have shown that taste cells fail to
respond to AMPA agonists [4,15], we assumed that the
receptor must be a member of the Kainate family, and we
designed primers against GluR5-7 (now known as
GLUK1-3), KA1 (now known as GLUK4), and KA2 (now
knows as GLUK5). We used RT-PCR assays on mRNA
isolated from pooled circumvallate taste buds, fungiform
taste buds and non taste tissue. GluR7, and KA1 and KA2
were present in circumvallate and fungiform papillae
(Figure 7). Non taste tissue was devoid of PCR products
for these receptors. We used immunohistochemistry to
identify the taste cells expressing GluR7, since KA1 and
KA2 are usually associated with GluR7 to form functional
receptors [39]. An antibody against GluR6/7 labeled sub-
sets of taste cells in circumvallate, but not fungiform
papillae. In all circumvallate taste buds examined, GluR7
co-localizes with a subset of GAD67-GFP cells but not
with TRPM5 -GFP cells (Table 1, Figure 8). These data
demonstrate that GluR7 is expressed specifically in Type
Figure 3 VGLUT2 immunoreactivity in TRPM5-GFP and GAD67-GFP mice. Laser scanning confocal images illustrate the expression of GFP under
the control of the TRPM5 promoter (green), VGLUT2 (red) and P2X2 (blue) in circumvallate papillae (CV; A-D), fungiform papillae (FF; E-H). Panels I-K
represent VGLUT2 immunoreactivity in GAD67-GFP mice. In fungiform and circumvallate taste buds, VGLUT2 is not expressed in taste cells but only
in nerve fibers surrounding these taste cells. Moreover, the VGLUT2-positive fibers are co-localized with P2X2 fibers, a marker for gustatory fibers. Each
figure represents merged images from a Z-series.

Page 5

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 5 of 12
III taste cells, which supports our results from calcium
imaging studies.
Discussion
Our results suggest that the glutamate vesicular trans-
porters, VGLUT1 and 2 are expressed in nerve fibers
innervating taste buds but not in taste cells themselves.
These data imply that afferent nerve fibers, rather than
taste cells have the machinery to release glutamate into
the taste bud to potentially modulate the activity of taste
cells. Further, we report physiological, molecular, and
immunohistochemical evidence that one likely target of
the glutamate is the Kainate receptor GluR7, which is
localized in Type III cells.
Somatosensory nerve fibers originating from the
trigeminal ganglion also penetrate taste buds, and their
cell bodies express VGLUT1 and 2 isoforms e.g, Figure.
4[40]. To differentiate the origin of the VGLUT-positive
fibers (trigeminal or gustatory), the P2X2 antibody was
used as a marker for gustatory fibers, since cell bodies in
the trigeminal ganglion lack P2X2 expression [36]. Our
results show that the majority of VGLUT2 immunoreac-
tive nerve fibers in taste buds also express P2X2, suggest-
ing a gustatory origin. We confirmed this by examining
expression of VGLUTs in the geniculate ganglion, where
the majority of the cells innervate taste buds on the
Figure 4 Gel image of PCR products for VGLUT1 and 2 in genicu-
late and trigeminal ganglia. The geniculate ganglion (GG) and the
trigeminal ganglion (TG) both expressed VGLUT1 and 2.
Figure 5 VGLUT1 and 2 immunoreactivity in geniculate ganglion neurons. A-C: Laser scanning photomicrographs of VGLUT2 (red) and P2X2
(blue). D-F: VGLUT1 (green), VGLUT2 (red). Note that all P2X2-expressing neurons also express VGLUT2 and that VGLUT2 completely co-localizes with
VGLUT1.

Page 6

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 6 of 12
tongue and palate. Most VGLUT2-expressing geniculate
cell bodies also expressed P2X2, confirming that gusta-
tory fibers express VGLUT2. Our data confirm those of a
preliminary study showing expression of VGLUT1 and 2
but not 3 in nerve fibers associated with taste buds in
mice [41]. However, another study recently reported
immunohistochemical evidence for VGLUT expression
in the taste tissue of rats, but only VGLUT1 was detected
[42]. Further studies will be required to determine if this
is a species difference.
To determine which cell types would respond to gluta-
mate at concentrations expected for a neurotransmitter,
we performed calcium imaging studies on GFP-labeled
Type II and Type III taste cells. GAD67-GFP Type III cells
showed responses to glutamate at concentrations of 10
mM (55% of the stimulated cells) or 1 mM (48% of the
stimulated cells). In contrast, T1R3-GFP Type II cells
failed to respond to 1 mM glutamate and only 2 out of 77
cells responded to 10 mM glutamate. However, several
Type II cells responded to 100 mM glutamate, which is
the appropriate concentration to activate the umami taste
receptor, T1R1-T1R3 (isolated taste cells: [38]; chorda
tympani recordings: [13]). These results strongly suggest
that the neurotransmitter receptors for glutamate likely
reside in the Type III cells rather than the Type II cells.
However, we cannot exclude the possibility that other
Type II cells that do not express T1R3 may respond to low
concentrations of glutamate. Caicedo et al. [4] showed
Figure 6 Calcium responses to glutamate in Type II and Type III taste cells. A: In T1R3-GFP cells, only high concentrations of glutamate (100 mM)
elicit a calcium response. B: In GAD67-GFP cells, glutamate at 10 mM or 1 mM may elicit a calcium response. Type III cells possess voltage-gated cal-
cium channels and respond to high concentrations of KCl (55 mM). C: In GAD67-GFP cells, NBQX, a specific antagonist of AMPA/Kainate receptors
partially inhibited the response to 1 mM glutamate. D: Average effect of NBQX on responses to glutamate (One way repeated measures ANOVA with
a Tukey post test; **: P < 0.005; *: P < 0.05, n = 9 cells).

Page 7

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 7 of 12
that the responses to 1 mM glutamate are blocked by
CNQX, a specific AMPA/Kainate antagonist. When
injected into the lingual artery, CNQX also decreased
taste responses of the chorda tympani [43]. Our physio-
logical experiments using NBQX, another AMPA/Kain-
ate antagonist, confirm a role for AMPA/Kainate
receptors in Type III mouse taste cells. However, the
NBQX block was not complete, suggesting other recep-
tors may participate in the glutamate response of Type III
cells, as suggested by other investigators [44].One possi-
bility is the NMDA receptor, previously identified in
physiological studies of rat taste cells [45,46]. Although
our data suggest that the neurotransmitter receptors are
restricted to Type III taste cells, we cannot rule out the
possible role of mGluRs in Type II taste cells that signal
through the cAMP signaling cascade. Metabotropic glu-
tamate receptors belonging to Class II (mGluR 2 and 3)
and Class III (mGluR4) elicit decreases in cAMP [47],
which would not be detected in a Ca2+ imaging assay,
since Type II taste cells lack voltage-gated Ca2+ channels
[21,31]. In addition, we would not be able to detect the
presence of ionotropic GluRs that are not calcium perme-
able. However, NMDA receptors and kainate receptors
are all Ca2+ permeable, as are AMPA receptors lacking
GluR2 [48]. We were not able to identify GluR2 in pooled
RNA from circumvallate papillae (data not shown),
although some immunoreactivity was found for GluR2/3
in rat circumvallate taste buds [49].
Using RT-PCR performed on pooled taste buds from
fungiform and circumvallate papillae, and immunohis-
tochemistry on sections of circumvallate taste tissue, we
have now identified specific Kainate receptors involved in
the glutamate response of Type III cells. RT-PCR prod-
ucts for GluR7, KA1 and KA2 were detected only in taste
papillae and immunohistochemistry showed that an anti-
body directed against GluR6/7 specifically labels a subset
of Type III taste cells. Since GluR6 was not detected in
taste buds by RT-PCR, GluR7 is the likely GluR expressed
in these taste cells. In the Kainate family of iGluRs, the
GluR5-7 subunits constitute the low-affinity subunits and
the KA1 and KA2 subunits constitute the high affinity
subunits. The KA1 and KA2 subunits fail to form a func-
tional homomeric receptor but create a functional chan-
nel when they form heteromeric receptors with GluR5-7
(for a review, see [39]). Interestingly, in HEK cells trans-
fected with homomeric GluR7 or heteromeric GluR7/
KA1 or GluR7/KA2, the EC50 value in response to gluta-
mate application is in the 6 mM range [50], which is con-
sistent with the levels of glutamate required to activate
Type III cells in our physiological experiments. GluR7 has
been studied in hippocampal mossy fiber synapses where
it forms heteromeric receptors with GluR6 and KA1 and
KA2. As in taste cells, it forms a low affinity, Ca2+ perme-
able channel where, when activated, it modulates the
release of the presynaptic transmitter [51].
The presence of VGLUTs in gustatory nerve fibers
innervating taste cells clearly indicates that glutamate is
stored in vesicles in the close vicinity of taste cells, where
it could modulate the activity of Type III taste cells via
activation of GluR7. Interestingly, omega shaped images
of clear vesicles, likely representing exocytotic release of
transmitter, have been observed in nerve fibers abutting
taste buds [52]. Type II "receptor" cells respond to taste
stimulation by release of ATP, which activates purinergic
receptors on afferent nerve fibers [23] and adjacent taste
cells [24,53]. In response, Type III cells release 5-HT, nor-
epinephrine and possibly additional transmitters [30,53]
to modulate Type II cells and activate nerve fibers,
although the identity of the transmitter at the afferent
synapse between Type III taste cells and nerve fibers is
not known. These transmitters may activate the VGLUT-
Figure 7 Gel image of PCR products for Kainate receptors in taste
tissues. PCR products for GluR7, KA1 and KA2 were observed in pooled
taste buds from fungiform (FF) and circumvallate (CV) papillae but not
in non taste epithelium (NT). Brain (BR) was used as a control. Bands are
for the expected size for GluR5 (549 bp), GluR6 (498 bp), GluR7 (441 bp),
KA1 (487 bp) and KA2 (210 bp). Left lane indicates a 100-bp ladder.

Page 8

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 8 of 12
expressing afferent nerve fibers, which in turn would
release glutamate to selectively modulate Type III taste
cells. Excess glutamate and ATP would then be removed
from the taste bud via transporters [9] and degradative
enzymes [20] expressed in Type I taste cells. The role of
the glutamate modulation is unclear, but Type III cells are
the only taste cells that are responsive to multiple taste
stimuli [54,55]. We speculate that if glutamate is released
from nerve fibers, this VGLUT-mediated circuit may par-
ticipate in the broad tuning of the Type III taste cells as
well as to modulate the release of the Type III cell trans-
mitters.
Conclusions
The principal finding in this study is that gustatory affer-
ent nerve fibers, rather than taste receptor cells, possess
the machinery for vesicular release of glutamate in taste
buds. Further, we show that a potential target of gluta-
mate released from nerve fibers is the Kainate receptor
GluR7, expressed selectively in a subset of Type III taste
cells. We speculate that glutamate may be involved in a
signalling circuit in taste buds to modulate transmitter
release from Type III taste cells.
Methods
Animals
All experimental procedures were approved by the Ani-
mal Care and Use Committees of the UC Denver School
of Medicine and Colorado State University. Adult trans-
genic mice in which either the TRPM5 or the T1R3 pro-
moter drives the expression of Green Fluorescent Protein
(GFP) were used to identify Type II taste cells (both in
C57/BL6 background). Breeding pairs were provided by
Robert Margolskee and expression of GFP in Type II taste
cells was validated by Clapp et al. [21]. Mice expressing
GFP from the GAD67 promoter (in C57/BL6 back-
ground) were used to identify Type III taste cells. These
mice were purchased from Jackson Laboratory (Bar Har-
Figure 8 GluR7 immunoreactivity in taste tissues of TRM5-GFP and GAD67-GFP mice. The expression of GluR7 is shown in circumvallate (CV)
papillae in mice expressing GFP (green) under the control of the TRPM5 promoter (A-D) or under the GAD67 promoter (E-H). The GluR7 is co-localized
with a subset of GAD67-GFP cells but not with TRPM5-GFP cells suggesting that GluR7 is expressed in a subset of Type III cells. The overlay represents
a maximum intensity projection obtained from a z series stack of images, so that the labelled taste cells are not in the same layer.
Table 1: Number of cells expressing GluR7 in TRPM5-GFP and GAD67-GFP circumvallate taste buds
Number of GFP cellsNumber of GluR7 cellsNumber of co-localized cells
TRPM5 2951610
GAD67 12510286

Page 9

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 9 of 12
bor, ME) and the expression of GFP in taste tissue was
validated by DeFazio et al. [31]. For RT-PCR experiments,
C57/BL6 mice were used.
Solutions
Tyrode's solution contained the following (in mM): 140
NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 HEPES, 10 glucose, and
1 Na pyruvate, adjusted to pH 7.4 with NaOH. High K+
solution was used to discriminate Type III cells from
other cell types and contained the following (in mM): 90
NaCl, 55 KCl, 1 MgCl, 1 CaCl2, 10 HEPES, 10 glucose,
and 1 Na pyruvate. Ca2+/Mg2+ free Tyrode's solution con-
tained 1 mM BAPTA. Monosodium glutamate (1 mM, 10
mM and 100 mM, Sigma, St. Louis, MO) was used as a
stimulus. The concentration of NaCl in Tyrode's was
adjusted in these solutions in order to maintain the initial
140 mM concentration of Na+. A specific AMPA/Kainate
receptor antagonist (2,3-Dioxo-6-nitro-1,2,3,4-tetrahyd-
robenzoquinoxaline-7-sulfonamide disodium salt or
NBQX) was used at the concentration of 16-40 μM and
mixed with 1 mM glutamate.
Taste cell isolation
Circumvallate taste cells were isolated using the protocol
of Béhé et al. [56]. Briefly, mice were killed with CO2 and
cervical dislocation. An enzyme cocktail consisting of 0.7
mg/ml collagenase B (Roche, Indianapolis, IN), 3 mg/ml
Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin
inhibitor (Sigma, St. Louis, MO) dissolved in Tyrode's
was injected beneath the epithelium of the tongue. After
incubation for 40 minutes in Ca2+ free Tyrode's, the epi-
thelium was gently separated from the underlying con-
nective tissue and placed in Ca2+ free Tyrode's containing
1 mM BAPTA for 10 min. Taste buds were removed by
gentle suction with a fire-polished pipette and placed in
an Eppendorf tube containing 200 μl RNAlater (Qiagen,
Valencia, CA) for the RT-PCR experiments, or plated
onto cover slips coated with poly-L-lysine (Sigma, St.
Louis, MO) for the calcium imaging experiments.
The geniculate and trigeminal ganglia were dissected
from surrounding tissues and placed in RNAlater for the
RT-PCR experiments or in fixative for the immunohis-
tochemistry experiments.
RT-PCR
RNA pooled from isolated fungiform and circumvallate
taste buds was extracted according to manufacturer's
instructions using the RNeasy Micro kit from Qiagen
(Valencia, CA), including a two hour DNase I treatment
at room temperature for removal of genomic DNA.
Reverse transcription was performed using the iScript
cDNA Synthesis kit from Biorad (Hercules, CA). Control
reactions lacking the reverse transcriptase enzyme were
used to detect potential DNA contamination. Two micro-
liters of cDNA were added to the PCR reaction (Qiagen
Taq PCR Core kit, Valencia, CA). PCR conditions
included an initial 5 min. denaturation step followed by
35 cycles of 30s denaturation at 95°C, 30s annealing at
60°C, and 45s extension at 72°C; concluding with a 7 min.
final extension step. To validate the PCR, we included
cDNA from whole brain (Clontech, Mountain View, CA),
non-taste lingual epithelium and a no template control
(water). The non-taste lingual epithelium was removed
from the area surrounding the circumvallate papillae.
This tissue did not express α-gustducin or PLCβ2 in RT-
PCR, in contrast to taste tissue. Amplified sequences
were visualized by gel electrophoresis in 1% agarose gels
stained with GelRed (Biotium, Hayward, CA). Experi-
ments were repeated three independent times. PCR
products were purified with the Qiagen QIAquick PCR
Purification kit or QIAEX II Gel Extraction kit (Valencia,
CA) and sequences were determined using an ABI 3730
DNA Sequencer (Foster City, CA) in the UCDenver
sequencing core. Sequences were compared with those
published using NCBI BLAST. Primers listed in Table 2
were designed using IDT PrimerQuest and spanned at
least one intron to avoid amplification of genomic DNA.
Calcium Imaging
Isolated cells or small clusters of cells were used. Intracel-
lular Ca2+ measurements were obtained after loading
taste cells with ~2 μM fura-2 AM (Molecular Probes,
Invitrogen Corporation), as described previously [21].
Images were acquired with the CCD Sensicam QE cam-
era (COOKE Corporation) through a 40× oil immersion
objective lens of an inverted Nikon Diaphot TMD micro-
scope. Excitation wavelengths of 350 nm and 380 nm
were used with an emission wavelength ~510 nm. Cal-
cium levels were reported as F350/F380 versus time.
Images were captured every 5 seconds using Imaging
Workbench 5.2 (Indec Biosystems, Inc.). All solutions
were bath applied using a gravity flow perfusion system
(Automate Scientific Inc., San Francisco, CA) and lami-
nar flow perfusion chambers (RC-25F, Warner Scientific
Inc., Hamden, CT).
Immunohistochemistry
Mice were perfusion-fixed in 4% paraformaldehyde and
0.1 M Phosphate Buffer or in periodate-lysine-paraform-
aldehyde (PLP) fixative that contained 75 mM lysine, 10
mM sodium periodate, and 1.6% paraformaldehyde. Tis-
sues were postfixed (4°C, 3 hours) and cryoprotected in
20% sucrose-phosphate buffer (4°C, overnight). Fourteen
μm cryosections were collected and dried onto FisherPlus
slides overnight, then washed with phosphate-buffered
saline (PBS), blocked with 2% normal goat or donkey
serum before incubation in primary antibody. The spe-
cific primary antibodies used are listed in Table 3. The

Page 10

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 10 of 12
secondary antiserum used was Alexa 568 goat anti-rabbit
IgG (1:400; Molecular Probe, Invitrogen, CA) for GluR6/7
and VGLUT1, Alexa 568 goat anti-guinea pig (1:400;
Molecular Probe, Invitrogen, CA) for VGLUT2 and
VGLUT3 and DyeLight 647 donkey anti-rabbit (1:400,
Jackson ImmunoResearch Laboratories, PA) for P2X2. To
control for the non-specificity of the secondary antibody,
the primary antibodies were omitted in some sections; no
reactivity was observed in these preparations. As a con-
trol for the expression of VGLUT3, we used VGLUT3
knock out mice [33]. Any expression that was present in
both knockout and wildtype mice was considered to be
nonspecific. All primary antibodies have been previously
validated in other studies (Table 3). All images were col-
lected with an Olympus Fluoview confocal laser scanning
microscope (LSCM) FV300 (Olympus Corporation). For
each image, the channels were collected sequentially with
single-wavelength excitation and then merged to produce
the composite image using the software Fluoview 5.0.
Images were adjusted for brightness and gamma using
Photoshop 7. For some images, as indicated in the cap-
tions, digital filters (Photoshop Dust & Scratches,
Unsharp Mask) were used to eliminate pixel noise and to
enhance local contrast values.
Authors' contributions
Immunohistochemistry was done by AV, MT, LMS and DB. CBA carried out the
RT-PCR. AV carried out the calcium imaging experiments. AV, LMS and SCK
designed the experiments. AV and SCK wrote the manuscript. All authors read
and approved the manuscript.
Acknowledgements
We thank Dr. Tom Finger for helpful discussions and comments on the manu-
script, Daniel Sanculi for genotyping the mice and Dr. Robert Margolskee
(Monell Chemical Senses Institute, Philadelphia, PA) for providing the TRPM5-
GFP and T1R3-GFP mice. We also thank Drs. Rebecca Seal and Robert Edwards
(University of California, San Francisco) for providing VGLUT3 knockout tissue.
Table 2: Accession number, DNA sequence, and product sizes of primers for Kainate receptor subunits and VGLUTs.
GeneAccession # Forward Primer (5'T3')Reverse Primer (5'T3')Product (bp)
GluR5NM_010348TGCCTAGGAGTCAGTTGTGTGCTTAGTGAGGTTGCAGTTCCTCTGTGT 549
GluR6 NM_010349GTGCCATCTTGGATTTGGTGCAGT ACATCAGAGCAGCATCAGTCGTCA498
GluR7NM_001081097 TCACACAGAGGAACTGCAACCTCATGATAACCGCATCCGTCTTGACCA441
KA1 NM_175481TGCTTCCTGCTTGGCTCTTGATAGGCATTCTGCTTTGGCACA 487
KA2 NM_008168TGATGCCAATGCGTCCATCTATGTTGAGGCTGCGCACAAA210
VGlut1 NM_182993ACCTGTTCTGGTTGCTTGTCTCCT GTTCATGAGCTTTCGCACGTTGGT398
VGlut2NM_080853 AGCCTGTCATGGGATATGGAGCAA ATTATCGCGTAGACGGGCATGGAT 360
VGlut3NM_182959TCACATCCTTGCCTGTCTATGCCATGAGGAACACATTCTGCCACTCCT 525
Table 3: Catalog number, dilution, source, immunogen and reference for the primary antibodies used
Antibody (catalog
number)
Rabbit anti-rat GluR6/7
(04-921)
Rabbit anti-rat
VGLUT1
(135303)
Guinea pig anti-rat
VGLUT2
(AB2251)
Rabbit anti-rat P2X2
(ARR-003)
Guinea pig anti-rat
VGLUT3
(AB5421)
Dilution
1:1001:500/1:1000 1:2000 1:10001:2000
Source
Millipore, MASynaptic systems,
Germany
Millipore, MAAlomone Labs, IsraelMillipore, MA
Immunogen
894-908 456-56017aa in C-terminal
region
457-472
Reference
[57][58][59][60][61]

Page 11

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 11 of 12
Funding for this research was received from the Ajinomoto Amino Acid
Research Program, and NIDCD grants RO1 DC007495 and P30 DC04657.
Author Details
1Department of Otolaryngology, University of Colorado, Denver, CO, USA,
2Department of Cell and Development Biology, University of Colorado, Denver,
CO, USA, 3Department of Biomedical Sciences, Colorado State University, Fort
Collins, CO, USA and 4Rocky Mountain Taste and Smell Center, University of
Colorado, Denver, CO, USA
References
1.Dingledine R, Conn PJ: Peripheral glutamate receptors: molecular
biology and role in taste sensation. J Nutr 2000, 130(4S
Suppl):1039S-1042S.
2.Roper SD: Signal transduction and information processing in
mammalian taste buds. Pflugers Arch 2007, 454(5):759-776.
3.Chaudhari N, Yang H, Lamp C, Delay E, Cartford C, Than T, Roper S: The
taste of monosodium glutamate: membrane receptors in taste buds. J
Neurosci 1996, 16(12):3817-3826.
4.Caicedo A, Jafri MS, Roper SD: In situ Ca2+ imaging reveals
neurotransmitter receptors for glutamate in taste receptor cells. J
Neurosci 2000, 20(21):7978-7985.
5.Caicedo A, Kim KN, Roper SD: Glutamate-induced cobalt uptake reveals
non-NMDA receptors in rat taste cells. The Journal of comparative
neurology 2000, 417(3):315-324.
6.Toyono T, Kataoka S, Seta Y, Shigemoto R, Toyoshima K: Expression of
group II metabotropic glutamate receptors in rat gustatory papillae.
Cell Tissue Res 2007, 328(1):57-63.
7. Toyono T, Seta Y, Kataoka S, Harada H, Morotomi T, Kawano S, Shigemoto
R, Toyoshima K: Expression of the metabotropic glutamate receptor,
mGluR4a, in the taste hairs of taste buds in rat gustatory papillae. Arch
Histol Cytol 2002, 65(1):91-96.
8.San Gabriel A, Maekawa T, Uneyama H, Torii K: Metabotropic glutamate
receptor type 1 in taste tissue. Am J Clin Nutr 2009, 90(3):743S-746S.
9. Lawton DM, Furness DN, Lindemann B, Hackney CM: Localization of the
glutamate-aspartate transporter, GLAST, in rat taste buds. Eur J
Neurosci 2000, 12(9):3163-3171.
10. Lindemann B, Ogiwara Y, Ninomiya Y: The discovery of umami. Chem
Senses 2002, 27(9):843-844.
11. Beauchamp GK: Sensory and receptor responses to umami: an
overview of pioneering work. Am J Clin Nutr 2009, 90(3):723S-727S.
12. Kinnamon SC, Vandenbeuch A: Receptors and transduction of umami
taste stimuli. Ann N Y Acad Sci 2009, 1170:55-59.
13. Damak S, Rong M, Yasumatsu K, Kokrashvili Z, Varadarajan V, Zou S, Jiang
P, Ninomiya Y, Margolskee RF: Detection of sweet and umami taste in
the absence of taste receptor T1r3. Science 2003, 301(5634):850-853.
14. He W, Yasumatsu K, Varadarajan V, Yamada A, Lem J, Ninomiya Y,
Margolskee RF, Damak S: Umami taste responses are mediated by
alpha-transducin and alpha-gustducin. J Neurosci 2004,
24(35):7674-7680.
15. Chung KM, Lee SB, Heur R, Cho YK, Lee CH, Jung HY, Chung SH, Lee SP,
Kim KN: Glutamate-induced cobalt uptake elicited by kainate receptors
in rat taste bud cells. Chem Senses 2005, 30(2):137-143.
16. Kim KN, Caicedo A, Roper SD: Glutamate-induced cobalt uptake reveals
non-NMDA receptors in developing rat taste buds. Neuroreport 2001,
12(8):1715-1718.
17. Lee SB, Lee CH, Kim SN, Chung KM, Cho YK, Kim KN: Type II and III Taste
Bud Cells Preferentially Expressed Kainate Glutamate Receptors in
Rats. Korean J Physiol Pharmacol 2009, 13(6):455-460.
18. Toyono T, Seta Y, Kataoka S, Kawano S, Shigemoto R, Toyoshima K:
Expression of metabotropic glutamate receptor group I in rat
gustatory papillae. Cell Tissue Res 2003, 313(1):29-35.
19. Pumplin DW, Yu C, Smith DV: Light and dark cells of rat vallate taste
buds are morphologically distinct cell types. The Journal of comparative
neurology 1997, 378(3):389-410.
20. Bartel DL, Sullivan SL, Lavoie EG, Sevigny J, Finger TE: Nucleoside
triphosphate diphosphohydrolase-2 is the ecto-ATPase of type I cells in
taste buds. The Journal of comparative neurology 2006, 497(1):1-12.
21. Clapp TR, Medler KF, Damak S, Margolskee RF, Kinnamon SC: Mouse taste
cells with G protein-coupled taste receptors lack voltage-gated
calcium channels and SNAP-25. BMC Biol 2006, 4:7.
22. Clapp TR, Yang R, Stoick CL, Kinnamon SC, Kinnamon JC: Morphologic
characterization of rat taste receptor cells that express components of
the phospholipase C signaling pathway. The Journal of comparative
neurology 2004, 468(3):311-321.
23. Finger TE, Danilova V, Barrows J, Bartel DL, Vigers AJ, Stone L, Hellekant G,
Kinnamon SC: ATP signaling is crucial for communication from taste
buds to gustatory nerves. Science 2005, 310(5753):1495-1499.
24. Huang YJ, Maruyama Y, Dvoryanchikov G, Pereira E, Chaudhari N, Roper
SD: The role of pannexin 1 hemichannels in ATP release and cell-cell
communication in mouse taste buds. Proc Natl Acad Sci USA 2007.
25. Romanov RA, Rogachevskaja OA, Bystrova MF, Jiang P, Margolskee RF,
Kolesnikov SS: Afferent neurotransmission mediated by hemichannels
in mammalian taste cells. Embo J 2007, 26(3):657-667.
26. Yang R, Crowley HH, Rock ME, Kinnamon JC: Taste cells with synapses in
rat circumvallate papillae display SNAP-25-like immunoreactivity. The
Journal of comparative neurology 2000, 424(2):205-215.
27. Huang YJ, Maruyama Y, Lu KS, Pereira E, Plonsky I, Baur JE, Wu D, Roper SD:
Mouse taste buds use serotonin as a neurotransmitter. J Neurosci 2005,
25(4):843-847.
28. Kaya N, Shen T, Lu SG, Zhao FL, Herness S: A paracrine signaling role for
serotonin in rat taste buds: expression and localization of serotonin
receptor subtypes. Am J Physiol Regul Integr Comp Physiol 2004,
286(4):R649-658.
29. Yee CL, Yang R, Bottger B, Finger TE, Kinnamon JC: "Type III" cells of rat
taste buds: immunohistochemical and ultrastructural studies of
neuron-specific enolase, protein gene product 9.5, and serotonin. The
Journal of comparative neurology 2001, 440(1):97-108.
30. Huang YA, Maruyama Y, Roper SD: Norepinephrine is coreleased with
serotonin in mouse taste buds. J Neurosci 2008, 28(49):13088-13093.
31. DeFazio RA, Dvoryanchikov G, Maruyama Y, Kim JW, Pereira E, Roper SD,
Chaudhari N: Separate populations of receptor cells and presynaptic
cells in mouse taste buds. J Neurosci 2006, 26(15):3971-3980.
32. Santos MS, Li H, Voglmaier SM: Synaptic vesicle protein trafficking at the
glutamate synapse. Neuroscience 2009, 158(1):189-203.
33. Seal RP, Akil O, Yi E, Weber CM, Grant L, Yoo J, Clause A, Kandler K, Noebels
JL, Glowatzki E, et al.: Sensorineural deafness and seizures in mice
lacking vesicular glutamate transporter 3. Neuron 2008, 57(2):263-275.
34. Stone LM, Anderson C, Goldberg D, Kinnamon SC: Mouse taste buds
express vesicular glutamate transporter Type II. Chem Senses 2009,
34:A66.
35. Vandenbeuch A, Anderson C, Kinnamon SC: Differential sensitivity to
monosodium glutamate in Type II and Type III taste cells. Chem Senses
2009, 34:A71.
36. Ishida Y, Ugawa S, Ueda T, Yamada T, Shibata Y, Hondoh A, Inoue K, Yu Y,
Shimada S: P2X(2)- and P2X(3)-positive fibers in fungiform papillae
originate from the chorda tympani but not the trigeminal nerve in rats
and mice. The Journal of comparative neurology 2009, 514(2):131-144.
37. Fremeau RT Jr, Kam K, Qureshi T, Johnson J, Copenhagen DR, Storm-
Mathisen J, Chaudhry FA, Nicoll RA, Edwards RH: Vesicular glutamate
transporters 1 and 2 target to functionally distinct synaptic release
sites. Science 2004, 304(5678):1815-1819.
38. Maruyama Y, Pereira E, Margolskee RF, Chaudhari N, Roper SD: Umami
responses in mouse taste cells indicate more than one receptor. J
Neurosci 2006, 26(8):2227-2234.
39. Jane DE, Lodge D, Collingridge GL: Kainate receptors: pharmacology,
function and therapeutic potential. Neuropharmacology 2009,
56(1):90-113.
40. Li JL, Xiong KH, Dong YL, Fujiyama F, Kaneko T, Mizuno N: Vesicular
glutamate transporters, VGluT1 and VGluT2, in the trigeminal ganglion
neurons of the rat, with special reference to coexpression. The Journal
of comparative neurology 2003, 463(2):212-220.
41. Pereira E, Grant JA, Huang YA, Dong X, Roper SD: Glutamatergic and
catecholaminergic markers are present in fibers innervating mouse
taste buds. AChemS abstract # 142 2010:76.
42. Braud A, Boucher Y, Zerari-Mailly F: Vesicular glutamate transporters
localization in the rat lingual papillae. Neuroreport 21(1):64-67.
43. Vandenbeuch A, Braud A, Berteretche M-V, Lelievre M, Faurion A:
Monosodium glutamate and related pharmacological agents affect
Received: 11 February 2010 Accepted: 21 June 2010
Published: 21 June 2010
This article is available from: http://www.biomedcentral.com/1471-2202/11/77© 2010 Vandenbeuch et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
BMC Neuroscience 2010, 11:77

Page 12

Vandenbeuch et al. BMC Neuroscience 2010, 11:77
http://www.biomedcentral.com/1471-2202/11/77
Page 12 of 12
the taste response differentially at apical or basal part of the taste bud.
In European Chemoreception Research Organization Grenade, Spain; 2006.
44. Grant JA, Roper SD: Activation of synaptic glutamate receptors
stimulates mouse taste cells and induces serotonin release. AChemS,
abstract # 149 2010:77.
45. Bigiani A, Delay RJ, Chaudhari N, Kinnamon SC, Roper SD: Responses to
glutamate in rat taste cells. J Neurophysiol 1997, 77(6):3048-3059.
46. Lin W, Kinnamon SC: Physiological evidence for ionotropic and
metabotropic glutamate receptors in rat taste cells. J Neurophysiol
1999, 82(5):2061-2069.
47. Kim CH, Lee J, Lee JY, Roche KW: Metabotropic glutamate receptors:
phosphorylation and receptor signaling. J Neurosci Res 2008, 86(1):1-10.
48. Ozawa S: Ca2+-permeable AMPA receptors in central neurons. J Physiol
2009, 587(Pt 9):1861-1862.
49. Caicedo A, Zucchi B, Pereira E, Roper SD: Rat gustatory neurons in the
geniculate ganglion express glutamate receptor subunits. Chem Senses
2004, 29(6):463-471.
50. Schiffer HH, Swanson GT, Heinemann SF: Rat GluR7 and a carboxy-
terminal splice variant, GluR7b, are functional kainate receptor
subunits with a low sensitivity to glutamate. Neuron 1997,
19(5):1141-1146.
51. Pinheiro PS, Perrais D, Coussen F, Barhanin J, Bettler B, Mann JR, Malva JO,
Heinemann SF, Mulle C: GluR7 is an essential subunit of presynaptic
kainate autoreceptors at hippocampal mossy fiber synapses. Proc Natl
Acad Sci USA 2007, 104(29):12181-12186.
52. Endo Y: Exocytotic release of neurotransmitter substances from nerve
endings in the taste buds of rat circumvallate papillae. Arch Histol Cytol
1988, 51:489-494.
53. Huang YA, Dando R, Roper SD: Autocrine and paracrine roles for ATP and
serotonin in mouse taste buds. J Neurosci 2009, 29(44):13909-13918.
54. Tomchik SM, Berg S, Kim JW, Chaudhari N, Roper SD: Breadth of tuning
and taste coding in mammalian taste buds. J Neurosci 2007,
27(40):10840-10848.
55. Yoshida R, Miyauchi A, Yasuo T, Jyotaki M, Murata Y, Yasumatsu K,
Shigemura N, Yanagawa Y, Obata K, Ueno H, et al.: Discrimination of taste
qualities among mouse fungiform taste bud cells. J Physiol 2009, 587(Pt
18):4425-4439.
56. Behe P, DeSimone JA, Avenet P, Lindemann B: Membrane currents in
taste cells of the rat fungiform papilla. Evidence for two types of Ca
currents and inhibition of K currents by saccharin. J Gen Physiol 1990,
96(5):1061-1084.
57. Puller C, Haverkamp S, Grunert U: OFF midget bipolar cells in the retina
of the marmoset, Callithrix jacchus, express AMPA receptors. The
Journal of comparative neurology 2007, 502(3):442-454.
58. Panzanelli P, Fritschy JM, Yanagawa Y, Obata K, Sassoe-Pognetto M:
GABAergic phenotype of periglomerular cells in the rodent olfactory
bulb. The Journal of comparative neurology 2007, 502(6):990-1002.
59. Schnell SA, Wessendorf MW: Coexpression of the mu-opioid receptor
splice variant MOR1C and the vesicular glutamate transporter 2
(VGLUT2) in rat central nervous system. The Journal of comparative
neurology 2008, 508(4):542-564.
60. Casanovas A, Hernandez S, Tarabal O, Rossello J, Esquerda JE: Strong P2X4
purinergic receptor-like immunoreactivity is selectively associated
with degenerating neurons in transgenic rodent models of
amyotrophic lateral sclerosis. The Journal of comparative neurology 2008,
506(1):75-92.
61. Stella SL Jr, Li S, Sabatini A, Vila A, Brecha NC: Comparison of the
ontogeny of the vesicular glutamate transporter 3 (VGLUT3) with
VGLUT1 and VGLUT2 in the rat retina. Brain Res 2008, 1215:20-29.
doi: 10.1186/1471-2202-11-77
Cite this article as: Vandenbeuch et al., Evidence for a role of glutamate as
an efferent transmitter in taste buds BMC Neuroscience 2010, 11:77