A preliminary result of three-dimensional microarray technology to gene analysis with endoscopic ultrasound-guided fine-needle aspiration specimens and pancreatic juices.

Abstract

Analysis of gene expression and gene mutation may add information to be different from ordinary pathological tissue diagnosis. Since samples obtained endoscopically are very small, it is desired that more sensitive technology is developed for gene analysis. We investigated whether gene expression and gene mutation analysis by newly developed ultra-sensitive three-dimensional (3D) microarray is possible using small amount samples from endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) specimens and pancreatic juices.
Small amount samples from 17 EUS-FNA specimens and 16 pancreatic juices were obtained. After nucleic acid extraction, the samples were amplified with labeling and analyzed by the 3D microarray.
The analyzable rate with the microarray was 46% (6/13) in EUS-FNA specimens of RNAlater storage, and RNA degradations were observed in all the samples of frozen storage. In pancreatic juices, the analyzable rate was 67% (4/6) in frozen storage samples and 20% (2/10) in RNAlater storage. EUS-FNA specimens were classified into cancer and non-cancer by gene expression analysis and K-ras codon 12 mutations were also detected using the 3D microarray.
Gene analysis from small amount samples obtained endoscopically was possible by newly developed 3D microarray technology. High quality RNA from EUS-FNA samples were obtained and remained in good condition only using RNA stabilizer. In contrast, high quality RNA from pancreatic juice samples were obtained only in frozen storage without RNA stabilizer.

Full text

Page 1

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010, 29:36
http://www.jeccr.com/content/29/1/36
Open Access
RESEARCH
A preliminary result of three-dimensional
microarray technology to gene analysis with
endoscopic ultrasound-guided fine-needle
aspiration specimens and pancreatic juices
BioMed Central
© 2010 Nonogaki et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Research
Koji Nonogaki1, Akihiro Itoh1, Hiroki Kawashima1, Eizaburo Ohno1, Takuya Ishikawa1, Hiroshi Matsubara1, Yuya Itoh1,
Yosuke Nakamura1, Masanao Nakamura1, Ryoji Miyahara2, Naoki Ohmiya1, Masatoshi Ishigami1, Yoshiaki Katano1,
Hidemi Goto1 and Yoshiki Hirooka*2
Abstract
Background: Analysis of gene expression and gene mutation may add information to be different from ordinary
pathological tissue diagnosis. Since samples obtained endoscopically are very small, it is desired that more sensitive
technology is developed for gene analysis. We investigated whether gene expression and gene mutation analysis by
newly developed ultra-sensitive three-dimensional (3D) microarray is possible using small amount samples from
endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) specimens and pancreatic juices.
Methods: Small amount samples from 17 EUS-FNA specimens and 16 pancreatic juices were obtained. After nucleic
acid extraction, the samples were amplified with labeling and analyzed by the 3D microarray.
Results: The analyzable rate with the microarray was 46% (6/13) in EUS-FNA specimens of RNAlater® storage, and RNA
degradations were observed in all the samples of frozen storage. In pancreatic juices, the analyzable rate was 67% (4/6)
in frozen storage samples and 20% (2/10) in RNAlater® storage. EUS-FNA specimens were classified into cancer and
non-cancer by gene expression analysis and K-ras codon 12 mutations were also detected using the 3D microarray.
Conclusions: Gene analysis from small amount samples obtained endoscopically was possible by newly developed
3D microarray technology. High quality RNA from EUS-FNA samples were obtained and remained in good condition
only using RNA stabilizer. In contrast, high quality RNA from pancreatic juice samples were obtained only in frozen
storage without RNA stabilizer.
Background
The microarray is the advanced technology that is useful
for comprehensive gene expression profiling. Microarray
analysis has the possibility of identifying subsets of genes
that may be especially useful markers for cancer diagnosis
[1,2]. The Olympus Co.Ltd. (Tokyo, Japan) has developed
a novel microarray technology, the three dimensional
(3D) microarray system in cooperation with PamGene
International, B.V. (BJ's-Hertogenbosch, The Nether-
lands). This technology involves the use of a multi-porous
3D substrate and flow-through hybridization technique
with pumping sample solution rapidly and semi-automat-
ically (Figure 1). Unlike conventional microarrays that use
a 2D substrate such as a slide glass, the 3D microarray
binds a huge amount of probe DNA molecules onto a
solid 3D structure substrate (Figure 2) as previously
described [3,4].
Recently, detailed, global, genomic analyses have lead to
a better understanding of the pathogenesis of pancreatic
tumors. This has opened up avenues for the development
* Correspondence: hirooka@med.nagoya-u.ac.jp
2 Department of Endosocpy, Nagoya University Hospital, 65 Tsuruma-cho,
Showa-ku, Nagoya 4668550, Japan
Full list of author information is available at the end of the article

Page 2

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010,
29:36
Page 2 of 6
of novel diagnostic and individually tailored treatment
strategies [5-9]. Microarrays have traditionally been
applied to pancreatic tissue obtained from surgical resec-
tion, but in this report, we investigated whether gene
analysis by 3D microarray is possible using small samples
obtained endoscopically for the pancreatic lesions.
Methods
Samples
This study was approved by the Institutional Review
Board of Nagoya University Graduate School of Medi-
cine. Written informed consents were obtained from all
patients. Seventeen endoscopic ultrasound-guided fine-
needle aspiration (EUS-FNA) specimens, pancreatic ade-
nocarcinoma (n = 11), chronic pancreatitis (n = 3), auto-
immune pancreatitis (n = 2) and pancreatic endocrine
tumor (n = 1), and 16 pancreatic juices, pancreatic adeno-
carcinoma (n = 1), chronic pancreatitis (n = 10) and intra-
ductal papillary mucinous neoplasms (n = 5) were
obtained in Nagoya University hospital. EUS-FNA was
carried out and the obtained samples were immediately
frozen in liquid nitrogen and stored at -80°C or immersed
in RNAlater® (Ambion Inc., Austin TX, USA) at 4°C for 16
hours and then stored at -20°C. Pancreatic juices samples
were obtained by endoscopic retrograde cholangiopan-
creatography (ERCP) and immediately frozen in liquid
nitrogen and stored at -80°C or mixed with 10 volume of
RNAlater® at 4°C for 16 hours and then stored at -20°C.
The endoscope and needles used for EUS-FNA was GF-
UCT 240 and NA-200H-8022 (22 gauge) (Olympus Co.
Ltd. Tokyo Japan). The endoscope and catheters used for
ERCP was JF-260V and PR-109-Q-1 (Olympus Co. Ltd.
Tokyo Japan).
Total RNA/DNA extraction
Both total RNA and genomic DNA were simultaneously
extracted from the same sample by ISOGEN (NIPPON
GENE Inc., Tokyo, Japan). EUS-FNA specimens were
pounded in a mortar with liquid nitrogen before extrac-
tion of the nucleic acids. Pancreatic juices stored by freez-
ing at -80°C were diluted with 10 volumes of PBS and
centrifuged by 2000 rpm for 10 minutes. The obtained
pellets were used for nucleic acid extraction. Pancreatic
juices stored by RNAlater® were centrifuged by 2000 rpm
for 10 minutes. The obtained pellets were used for
nucleic acid extraction. The concentration of the
obtained nucleic acids was estimated by measuring the
optical density (OD) at 260 nm using a Nanodrop (Nano-
drop Inc., Wilmington, DE, USA) and their quality was
checked by electrophoresis using a Bioanalyzer (Agilent
Inc., Santa Clara, CA, USA).
Gene expression analysis
The 0.1-2 μg of total RNA derived from each sample was
amplified as aRNA by Eberwine's method using a Mes-
sage Amp™ aRNA kit (Ambion Inc.) and labeled with bio-
tin-16-UTP (Roche Inc.) [10].
Hybridization and image analysis were performed using
a 3D microarray (PamChip) and FD10 microarray system
developed by the Olympus Corporation. The microarray
was set up with 60 mer oligo DNA probes of 60 genes:
human gene related cancer, pancreatic enzyme, β-actin
(ACTB) and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) as house keeping genes and lambda DNA
(LAMD) and renilla luciferase gene (pRL-TK) as negative
controls. Each probe sequence was designed by Novus-
gene Inc. Hybridization, washing and fluorescence detec-
tion were performed semi-automatically in the FD10. The
50 ng of each labeled aRNA was dissolved in 3XSSPE,
including 0.5% Lauryl sarcosine and applied on Pamchip
and hybridization was performed at 42°C for 1.5 hours.
After the hybridization reaction, the Pamchip was
washed and fluorescent signals were amplified using an
enzymatic reaction kit (TSA™ Kit #22, Invitogen Inc.,
Figure 1 Schematic description of newly developed 3D microar-
ray technology. (a) The 3D microarray (PamChip) with the four array
format (left), an array with a diameter of 45 mm (middle), and a set of
oligo DNA probes immobilized with 120 μm diameter (right). (b) The
partial top (left) and cross section view (right) of multi-porous substrate
within PamChip. (c) FD10 microarray system with functions of hybrid-
ization, washing, fluorescence imaging and image analysis, which are
integrated and performed semi-automatically.
??????
? m
a
bc
???? ? m
60
??????
Figure 2 Comparison between 3D microarray (left) and conven-
tional 2D microarray (right).
Probe
Spot
Glass Slide
Sample nucleic acid
multi-porous 3D substrate
Sample nucleic acid
Probe
Spot

Page 3

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010,
29:36
Page 3 of 6
Carlsbad, CA, USA). The CCD images were automati-
cally taken by the FD10 and each image was analyzed by
the original analysis software. Hierarchical clustering by
UPGMA methods and the Welch t statistic were per-
formed using Spotfire Decision Site Functional Genomics
ver.8.0 (Spotfire Inc., PaloAlto, CA, USA).
Gene mutation analysis (K-ras codon 12/13)
The 50 ng of genomic DNA were amplified by Ex-taq
polymerase (TaKaRa, Kyoto, Japan) and labeled by PCR
with fluorescent (FITC) labeled primers. PCR was per-
formed under conditions of 94°C:1 min, 55°C:2 min,
72°C:1 min. (35 cycles). The forward and the reverse
primer sequence is GACTGAATATAAACTTGTGG and
CTATTGTTGGATCATATTCG, respectively. Hybridiza-
tion and Image analysis were performed using FD10,
according to the procedure by Maekawa et al [11].
Results
Sample preparation
Both total RNA and genomic DNA were extracted from
each EUS-FNA specimen (See Table S1, Additional file 1)
and pancreatic juice (See Table S2, Additional file 2). In
EUS-FNA specimens, the weight of each specimen was in
the range from 10 to 200 mg. The average amounts of
obtained total RNA were 4.92 ± 3.09 μg (n = 4) (260/
280:1.68 ± 0.26) at frozen storage and 2.51 ± 3.49 μg (n =
13) (260/280:1.70 ± 0.14) at RNAlater® storage, respec-
tively. In each of the frozen samples of pancreatic juices,
pellets were formed in gel-like form. On the other hand,
in each of the RNA later-storage samples of pancreatic
juices, white pellet were formed. The average amounts of
obtained total RNA were 3.94 ± 3.98 μg (n = 6) (260/
280:1.63 ± 0.23) at frozen storage and 0.44 ± 0.66 μg (n =
10) (260/280:1.55 ± 0.31) at RNAlater® storage, respec-
tively. Only small total RNA could be obtained by sam-
ples of RNAlater® storage.
The quality and degradation of total RNA was checked
by electrophoresis. In EUS-FNA specimens, RNA degra-
dations were observed in all the samples of frozen stor-
age. On the other hand, in RNAlater® stored samples, 5 of
13 samples showed both bands of 16 s and 28 s rRNA. In
pancreatic juice samples, almost all sample of frozen stor-
age showed two bands of rRNA, but in RNAlater® stored
samples, almost all samples showed RNA degradations.
After the treatment with DNase, the 0.1-2 μg of total
RNA was amplified using Eberwine's method. The aver-
age of aRNA amplifications in EUS-FNA specimens were
129 ± 99 and 252 ± 253 fold in frozen and RNAlater® stor-
age, respectively. In pancreatic juices samples, 298 ± 142
and 235 ± 149 in frozen and RNAlater® storage, respec-
tively. The RNA sample with good quality confirmed by
electrophoresis showed efficient aRNA amplification
(Table S1, Additional file 1 and Table S2, Additional file
2).
Gene Expression Analysis
We optimized the technique of enzymatic hybridization
signal amplification by applying TSA technology to the
3D structure of our microarray [12]. As a result, fluores-
cent molecules accumulated at the surface of the multiple
pores, and approximately 1000-fold signal amplification
was realized when compared with the conventional
microarray method. Each hybridization was performed
with only 50 ng of aRNA labeled with biotin.
The samples with two-bands of rRNAs in electrophore-
sis and with an efficient rate of aRNA amplification (over
300-fold) were analyzable on the microarray hybridiza-
tion showing sufficient signal intensity on most of the
spots. However, the other samples did not hybridize on
the microarray at all. The analyzable rate with the
microarray was 46% (6/13) in EUS-FNA specimens of
RNAlater® storage. In pancreatic juices, analyzable rate
was 67% (4/6) in frozen storage samples and 20% (2/10) in
RNAlater® storage. After each hybridization, hybridiza-
tion images were automatically taken by the CCD camera
integrated in the FD10, and original image analysis soft-
ware calculated the fluorescence intensity of each spot
and subtracted the background value. Six of those data
from EUS-FNA specimens and six data from the pancre-
atic juice previously obtained were applied to hierarchical
clustering analysis using Spotfire DecisionSite Functional
Genomics http://www.spotfire.com/ with 25 genes,
which showed sufficient signal intensity in most of the
samples.
In the gene expression analysis, the samples were classi-
fied into two clusters, EUS-FNA samples and pancreatic
juice samples (pellets after centrifugation), by the 1st clus-
tering (Figure 3, line A). The cluster of the EUS-FNA
Figure 3 Hierarchical cluster of the human 25 genes expression
pattern in 12 pancreatic samples. FNA, EUS-FNA specimens (n = 6);
PJ, pancreatic juice samples (n = 6); PC, pancreatic cancer (n = 5); CP,
chronic pancreatitis (n = 3); IPMC, intraductal papillary mucinous ade-
nocarcinoma (n = 1); IPMA, intraductal papillary mucinous adenoma (n
= 2); PET, pancreatic endocrine tumor (n = 1). Each color scale repre-
sents the signal intensity of each gene. Some genes that significantly
contributed to the dividing of clusters (p < 0.005) were noted at the
bottom of the panel. Line A shows the boundary of the gene expres-
sion pattern between EUS-FNA and pancreatic juice. Line B shows the
boundary of cancer or non-cancer in the EUS-FNA specimens.
A
B
MUC1
ACTB
ELA2B
CDKN2A
Low signal intensity
High signal intensity
Diagnosis
PC
Sample
FNA
11
6
PCFNA
12
PCFNA
5
PCFNA
16
CPFNA
17
PET FNA
14
IPMA PJ
1
PCPJ
5
CPPJ
13
IPMC PJ
6
IPMAPJ
4
CP PJ
ALP1
CCND1
FHIT
CD44
No.

Page 4

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010,
29:36
Page 4 of 6
sample was further classified into cancerous or non-can-
cerous clusters by the 2nd clustering (Figure 3, line B).
Conversely, the cluster of pancreatic juice samples were
not clearly classified as cancerous and non-cancerous
cluster. The genes, ALP1, MUC1, CCND1, CDK2 and
FHIT significantly contributed to the 1st clustering
between the EUS-FNA samples and the pancreatic juice
samples (p < 0.05). On the other hand, in the EUS-FNA
samples, the gene, CDK2A, CD44, S100A4 and MUC1
were specifically related to the 2nd clustering between
cancer and non-cancer (p < 0.05).
Gene mutation analysis (K-ras codon 12/13)
PCR amplification and gene mutation analysis for K-ras
(codon12/13) were successful in the case of the samples
with good quality total RNA. We extracted the total RNA
and DNA from the same specimens in this study. When
one nucleic acid could not be successfully prepared and
analyzed, the other nucleic acid also could not be used.
The degradation of the nucleic acid seems to be
depended on the condition of sample storage after EUS-
FNA or collecting pancreatic juices. All of the analyzable
pancreatic cancer samples showed a specific mutation of
K-ras codon12 with a single base change from GGT (Gly)
to GAT (Asp) (See Table S3, Additional file 3), which is
the most frequent mutation, as previously reported [13].
Additionally, one of the analyzable chronic pancreatitis
samples showed a mutation from GGT (Gly) to GTT
(Val), which is also frequent in pancreatic cancer as previ-
ously reported. No mutation could be detected in the
samples of autoimmune pancreatitis and pancreatic
endocrine tumor.
Disscussion
DNA microarrays can analyze plural gene expression
changes at the same time. It is useful for the early detec-
tion of pancreatic cancer, evaluation of malignant poten-
tial and drug efficacy. There are some articles about the
identification of genes that show chemosensitivity to
anti-cancer drugs, such as gemcitabine and 5FU in the
pancreatic cancer cell line [14,15]. Gene expression pro-
filing would especially help to predict the effectiveness of
chemotherapy. This time, we inspected whether gene
expression analysis by 3D microarray was possible using
small amount samples obtained endoscopically.
In EUS-FNA specimens, the sample storage method
using RNAlater® seemed to improve the quality of the
total RNA when compared with the method using liquid
nitrogen storage. Since pancreatic tissues have large
amounts of digestive enzymes, i.e., protease and/or
nuclease, nucleic acids could easily be degraded. Further-
more, since EUS-FNA specimens are long and thin, they
may be easily broken down by digestive enzymes. On the
other hand, a reagent such as an RNase inhibitor included
in RNAlater® may be easy to instill into the tissues and/or
their cell components for the same reason. Therefore,
EUS-FNA specimens may be suitable for storage with
RNAlater® for RNA preparation. In our investigation, the
analyzable rate was lower than 50% for EUS-FNA speci-
mens of RNAlater® storage (46%). For further improve-
ment, it will be very important to take as many cell-rich
EUS-FNA specimens as possible. Actually, specimens
that we couldn't obtain from contained much fibrotic tis-
sue or blood instead of cells (data not shown). After EUS-
FNA, confirmation of the cell component by microscopic
observation and preservation of only cell-rich part with
RNAlater® cutting off from the obtained specimens will be
efficient before RNA preparation.
In pancreatic juice samples, total RNA and DNA were
obtained in good quality and quantity from the directly
frozen samples. RNAlater® storage could not improve
quality of nucleic acid in pancreatic juice. All those sam-
ples involved white pellet. We suspected that the compo-
nent of white pellet was a contrast agent contained in the
pancreatic juice samples. To confirm it, we mixed RNAl-
ater® and the contrast agent Urografin®, and the white pel-
lets like in RNAlater®-stored samples were observed
immediately. Furthermore, the volume of the white pel-
lets appeared were almost the same as that of Urografin®.
The contrast agent is difficult to be dissolved, therefore,
when it is mixed with different solution such as RNAl-
ater®, its composition changes and the contrast agent may
precipitate. If we use RNAlater® for pancreatic juice stor-
age, we have to remove the supernatant containing a con-
trast agent such as Urografin®, for example, by performing
centrifuge. After then, only the precipitation including
pancreatic cells should be stored with RNAlater®. Further-
more, control experiments with RNase inhibitors other
than RNAlater® to exclude the possible vehicle effects will
be needed. Pancreatic juice is an ideal specimen for pan-
creatic cancer biomarkers discovery, because it is an
exceptionally rich source of proteins released from pan-
creatic cancer cells [16-18]. Gene analysis of pancreatic
juice deserves further investigation to determine its util-
ity as a tool for the evaluation of pancreatic lesions.
It may be presumed that FNA samples and pancreatic
juice samples were classified into different clusters
because the cell population is different in the two kinds of
samples. The gene expression data obtained in this study
succeeded in classifying cancer and non-cancer in the
EUS-FNA samples. However, the pancreatic juice sam-
ples were not classified as any particular cluster. One of
the reasons may be that the pancreatic juice samples were
composed of various kinds of diagnostic samples.
Patient-tailored medicine can be defined as the selec-
tion of specific therapeutics to treat disease in a particu-
lar individual based on genetic, genomic or proteomic

Page 5

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010,
29:36
Page 5 of 6
information. While individualized treatments have been
used in medicine for many years, advances in cancer
treatment have now generated a need to more precisely
define and identify those patients who will derive the
most benefit from new-targeted agents [19,20]. We suc-
ceeded in gene expression analysis and gene mutation
analysis using the small amount samples by the newly
developed 3D microarray system. The gene expression
analysis and gene mutation analysis requires only 2 days
and 4 hours after the isolation of samples to obtain data.
The 3D microarray has potential for providing detailed
information about the pancreatic lesions from small sam-
ples such as EUS-FNA specimens and pancreatic juices.
It is very difficult to correctly determine the detection
limit of microarray analysis for mRNA expression pattern
and mutation identification. However, from the view-
point of clinical use, we recommend that at least 0.1-2 ug
of total RNA will be sufficient for mRNA expression anal-
ysis. On the other hand, for gene mutation analysis, 50 ng
of genomic DNA were used for conventional PCR in this
study. The detection limit of mutant alleles by the 3D
microarray is estimated to be 16-25% of the total genomic
DNA as previously reported [11].
Conclusions
Gene analysis from small amount samples obtained
endoscopically was possible by newly developed 3D
microarray technology. High quality RNA from EUS-
FNA samples were obtained and remained in good condi-
tion only using RNA stabilizer. In contrast, high quality
RNA from pancreatic juice samples were obtained only in
frozen storage without RNA stabilizer.
Additional material
Abbreviations
3D microarray: three-dimensional microarray; EUS-FNA: endoscopic ultra-
sound-guided fine-needle aspiration; ERCP: endoscopic retrograde cholang-
iopancreatography;
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KN, AI, HG and YH made conception, designed and coordinated the study, col-
lected samples, analyzed data, carried out data interpretation, and drafted the
manuscript. HK, EO, TI, HM, YI, and YN collected samples and evaluated the
results. MN, RM, NO, MI and YK participated in the conception, analyzed data,
carried out data interpretation, design of study and in drafting of manuscript.
All authors read and approved the final manuscript
Acknowledgements
The authors thank Ms. Hiromi Sanuki and Ms. Hiroko Sakamoto (Corporate R&D
Center, Olympus Corporation) for their technical assistance.
Author Details
1Department of Gastroenterology, Nagoya University Graduate School of
Medicine, 65 Tsuruma-cho, Showa-ku, Nagoya 4668550, Japan and
2Department of Endosocpy, Nagoya University Hospital, 65 Tsuruma-cho,
Showa-ku, Nagoya 4668550, Japan
References
1. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP,
Coller H, Loh ML, Downing JR, Caligiuri MA, Bloomfield CD, Lander ES:
Molecular classification of cancer: class discovery and class prediction
by gene expression monitoring. Science 1999, 286:531-7.
2. Perou CM, Sørlie T, Eisen MB, Rijn M van de, Jeffrey SS, Rees CA, Pollack JR,
Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C,
Zhu SX, Lønning PE, Børresen-Dale AL, Brown PO, Botstein D: Molecular
portraits of human breast tumours. Nature 2000, 406:747-52.
3. Wu Y, de Kievit P, Vahlkamp L, Pijnenburg D, Smit M, Dankers M, Melchers
D, Stax M, Boender PJ, Ingham C, Bastiaensen N, de Wijn R, van Alewijk D,
van Damme H, Raap AK, Chan AB, van Beuningen R: Quantitative
assessment of a novel flow-through porous microarray for the rapid
analysis of gene expression profiles. Nucleic Acids Res 2004, 32:e123.
4.Hokaiwado N, Asamoto M, Tsujimura K, Hirota T, Ichihara T, Satoh T, Shirai
T: Rapid analysis of gene expression changes caused by liver
carcinogens and chemopreventive agents using a newly developed
three-dimensional microarray system. Cancer Sci 2004, 95:123-30.
5. Jain KK: Role of pharmacoproteomics in the development of
personalized medicine. Pharmacogenomics 2004, 5:331-6.
6.Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, Mankoo P,
Carter H, Kamiyama H, Jimeno A, Hong SM, Fu B, Lin MT, Calhoun ES,
Kamiyama M, Walter K, Nikolskaya T, Nikolsky Y, Hartigan J, Smith DR,
Hidalgo M, Leach SD, Klein AP, Jaffee EM, Goggins M, Maitra A, Iacobuzio-
Donahue C, Eshleman JR, Kern SE, Hruban RH, Karchin R, Papadopoulos N,
Parmigiani G, Vogelstein B, Velculescu VE, Kinzler KW: Core signaling
pathways in human pancreatic cancers revealed by global genomic
analyses. Science 2008, 321:1801-6.
7. Brandt R, Grützmann R, Bauer A, Jesnowski R, Ringel J, Löhr M, Pilarsky C,
Hoheisel JD: DNA microarray analysis of pancreatic malignancies.
Pancreatology 2004, 4:587-97.
8.Kitoh H, Ryozawa S, Harada T, Kondoh S, Furuya T, Kawauchi S, Oga A,
Okita K, Sasaki K: Comparative genomic hybridization analysis for
pancreatic cancer specimens obtained by endoscopic
ultrasonography-guided fine-needle aspiration. J Gastroenterol 2005,
40:511-7.
9. Crnogorac-Jurcevic T, Efthimiou E, Capelli P, Blaveri E, Baron A, Terris B,
Jones M, Tyson K, Bassi C, Scarpa A, Lemoine NR: Gene expression
profiles of pancreatic cancer and stromal desmoplasia. Oncogene 2001,
20:7437-46.
10. Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD,
Eberwine JH: Amplified RNA synthesized from limited quantities of
heterogeneous cDNA. Proc Natl Acad Sci USA 1990, 87:1663-7.
11. Maekawa M, Nagaoka T, Taniguchi T, Higashi H, Sugimura H, Sugano K,
Yonekawa H, Satoh T, Horii T, Shirai N, Takeshita A, Kanno T: Three-
dimensional microarray compared with PCR-single-strand
conformation polymorphism analysis/DNA sequencing for mutation
analysis of K-ras codons 12 and 13. Clin Chem 2004, 50:1322-7.
12. Karsten SL, Van Deerlin VM, Sabatti C, Gill LH, Geschwind DH: An
evaluation of tyramide signal amplification and archived fixed and
frozen tissue in microarray gene expression analysis. Nucleic Acids Res
2002, 30:E4.
Additional file 1 Table S1: Summary of each EUS-FNA specimen and
obtained RNA/DNA information. In EUS-FNA specimens, RNA degrada-
tions were observed in all the samples of frozen storage. On the other hand,
in RNAlater® stored samples, 5 of 13 samples were in good conditions.
Additional file 2 Table S2: Summary of each pancreatic juice sample
and obtained RNA/DNA information. In pancreatic juice samples, almost
all sample of frozen storage were in good conditions, but in RNAlater®
stored samples, almost all samples showed RNA degradations.
Additional file 3 Table S3: Result of gene mutation analysis of K-ras
codon 12/13 (left: EUS-FNA specimens, right: Pancreatic juices). All of
the analyzable pancreatic cancer samples showed a specific mutation of K-
ras codon12 with a single base change from GGT (Gly) to GAT (Asp).
Received: 8 February 2010 Accepted: 25 April 2010
Published: 25 April 2010
This article is available from: http://www.jeccr.com/content/29/1/36© 2010 Nonogaki et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Journal of Experimental & Clinical Cancer Research 2010, 29:36

Page 6

Nonogaki et al. Journal of Experimental & Clinical Cancer Research 2010,
29:36
Page 6 of 6
13. Mu DQ, Peng YS, Xu QJ: Values of mutations of K-ras oncogene at codon
12 in detection of pancreatic cancer: 15-year experience. World J
Gastroenterol 2004, 10:471-5.
14. Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE: RNA interference
targeting the M2 subunit of ribonucleotide reductase enhances
pancreatic adenocarcinoma chemosensitivity to gemcitabine.
Oncogene 2004, 23:1539-48.
15. Ashida R, Nakata B, Shigekawa M, Mizuno N, Sawaki A, Hirakawa K,
Arakawa T, Yamao K: Gemcitabine sensitivity-related mRNA expression
in endoscopic ultrasound-guided fine-needle aspiration biopsy of
unresectable pancreatic cancer. J Exp Clin Cancer Res 2009, 28:83.
16. Rogers CD, Fukushima N, Sato N, Shi C, Prasad N, Hustinx SR, Matsubayashi
H, Canto M, Eshleman JR, Hruban RH, Goggins M: Differentiating
pancreatic lesions by microarray and QPCR analysis of pancreatic juice
RNAs. Cancer Biol Ther 2006, 5:1383-9.
17. Yoshida K, Ueno S, Iwao T, Yamasaki S, Tsuchida A, Ohmine K, Ohki R, Choi
YL, Koinuma K, Wada T, Ota J, Yamashita Y, Chayama K, Sato K, Mano H:
Screening of genes specifically activated in the pancreatic juice ductal
cells from the patients with pancreatic ductal carcinoma. Cancer Sci
2003, 94:263-70.
18. Tian M, Cui YZ, Song GH, Zong MJ, Zhou XY, Chen Y, Han JX: Proteomic
analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in
pancreatic juice from pancreatic ductal adenocarcinoma patients.
BMC Cancer 2008, 8:241.
19. Wulfkuhle JD, Edmiston KH, Liotta LA, Petricoin EF: Technology insight:
pharmacoproteomics for cancer--promises of patient-tailored
medicine using protein microarrays. Nat Clin Pract Oncol 2006, 3:256-68.
20. Mihaljevic AL, Esposito I, Michalski CW, Kleeff J, Friess H: Defining new
pancreatic tumour entities by molecular analysis. Pancreatology 2009,
9:334-9.
doi: 10.1186/1756-9966-29-36
Cite this article as: Nonogaki et al., A preliminary result of three-dimensional
microarray technology to gene analysis with endoscopic ultrasound-guided
fine-needle aspiration specimens and pancreatic juices Journal of Experimen-
tal & Clinical Cancer Research 2010, 29:36