Production of hydrogen sulfide by two enzymes associated with biosynthesis of homocysteine and lanthionine in Fusobacterium nucleatum subsp. nucleatum ATCC 25586.
ABSTRACT Fusobacterium nucleatum produces a large amount of the toxic metabolite hydrogen sulfide in the oral cavity. Here, we report the molecular basis of F. nucleatum H(2)S production, which is associated with two different enzymes: the previously reported Cdl (Fn1220) and the newly identified Lcd (Fn0625). SDS-PAGE analysis with activity staining revealed that crude enzyme extracts from F. nucleatum ATCC 25586 contained three major H(2)S-producing proteins. Two of the proteins with low molecular masses migrated similarly to purified Fn0625 and Fn1220. Their kinetic values suggested that Fn0625 had a lower enzymic capacity to produce H(2)S from L-cysteine (approximately 30%) than Fn1220. The Fn0625 protein degraded a variety of substrates containing betaC-S linkages to produce ammonia, pyruvate and sulfur-containing products. Unlike Fn0625, Fn1220 produced neither pyruvate nor ammonia from L-cysteine. Reversed-phase HPLC separation and mass spectrometry showed that incubation of L-cysteine with Fn1220 produced H(2)S and an uncommon amino acid, lanthionine, which is a natural constituent of the peptidoglycans of F. nucleatum ATCC 25586. In contrast, most of the sulfur-containing substrates tested, except L-cysteine, were not used by Fn1220. Real-time PCR analysis demonstrated that the fn1220 gene showed several-fold higher expression than fn0625 and housekeeping genes in exponential-phase cultures of F. nucleatum. Thus, we conclude that Fn0625 and Fn1220 produce H(2)S in distinct manners: Fn0625 carries out beta-elimination of L-cysteine to produce H(2)S, pyruvate and ammonia, whereas Fn1220 catalyses the beta-replacement of L-cysteine to produce H(2)S and lanthionine, the latter of which may be used for peptidoglycan formation in F. nucleatum.
-
Citations (0)
-
Cited In (0)
Page 1
Production of hydrogen sulfide by two enzymes
associated with biosynthesis of homocysteine and
lanthionine in Fusobacterium nucleatum subsp.
nucleatum ATCC 25586
Yasuo Yoshida,1Shuntaro Ito,1,2Masaharu Kamo,3Yuichiro Kezuka,4
Haruki Tamura,1Kazushi Kunimatsu2and Hirohisa Kato1
Correspondence
Yasuo Yoshida
yasuoy@iwate-med.ac.jp
1Department of Pathogenesis and Control of Oral Disease, Iwate Medical University School of
Dentistry, Morioka, Japan
2Department of Conservative Dentistry and Oral Rehabilitation, Iwate Medical University School of
Dentistry, Morioka, Japan
3Department of Oral Biology, Iwate Medical University School of Dentistry, Morioka, Japan
4Department of Structural Biology, Iwate Medical University School of Pharmacy, Yahaba, Japan
Received 21 February 2010
Revised12 April 2010
Accepted 19 April 2010
Fusobacterium nucleatum produces a large amount of the toxic metabolite hydrogen sulfide in the
oral cavity. Here, we report the molecular basis of F. nucleatum H2S production, which is
associated with two different enzymes: the previously reported Cdl (Fn1220) and the newly
identified Lcd (Fn0625). SDS-PAGE analysis with activity staining revealed that crude enzyme
extracts from F. nucleatum ATCC 25586 contained three major H2S-producing proteins. Two of
the proteins with low molecular masses migrated similarly to purified Fn0625 and Fn1220. Their
kinetic values suggested that Fn0625 had a lower enzymic capacity to produce H2S from
L-cysteine (~30%) than Fn1220. The Fn0625 protein degraded a variety of substrates containing
bC–S linkages to produce ammonia, pyruvate and sulfur-containing products. Unlike Fn0625,
Fn1220 produced neither pyruvate nor ammonia from L-cysteine. Reversed-phase HPLC
separation and mass spectrometry showed that incubation of L-cysteine with Fn1220 produced
H2S and an uncommon amino acid, lanthionine, which is a natural constituent of the
peptidoglycans of F. nucleatum ATCC 25586. In contrast, most of the sulfur-containing
substrates tested, except L-cysteine, were not used by Fn1220. Real-time PCR analysis
demonstrated that the fn1220 gene showed several-fold higher expression than fn0625 and
housekeeping genes in exponential-phase cultures of F. nucleatum. Thus, we conclude that
Fn0625 and Fn1220 produce H2S in distinct manners: Fn0625 carries out b-elimination of
L-cysteine to produce H2S, pyruvate and ammonia, whereas Fn1220 catalyses the b-replacement
of L-cysteine to produce H2S and lanthionine, the latter of which may be used for peptidoglycan
formation in F. nucleatum.
INTRODUCTION
Hydrogen sulfide (H2S) is a gas with the smell of rotten
eggs and is one of the predominant volatile sulfur
compounds primarily responsible for halitosis (Tonzetich,
1971). Oral malodour appears to be associated with an
increase in the number of H2S-producing micro-organisms
among tongue biofilm microflora (Washio et al., 2005). It
has been demonstrated that, in vitro, H2S damages
epithelial cells (Morhart et al., 1970) and increases the
permeability of oral mucosa (Ng & Tonzetich, 1984). More
recently, it was reported that H2S is associated with the
modification and release of haemoglobin in erythrocytes
(Kurzban et al., 1999; Yoshida et al., 2002), endotoxin-
induced inflammation (Li et al., 2005), and apoptosis of
aorta smooth muscle cells (Yang et al., 2004) and human
gingival fibroblasts (Yaegaki et al., 2008). An increasing
amount of evidence is demonstrating that extremely low
concentrations of H2S are highly toxic to tissues and host
cells, although most sufferers perceive halitosis primarily as
a cosmetic problem. When considering the toxicity of H2S,
it is of interest that the amount of H2S in periodontal
pockets (Persson, 1992) is much higher than the levels of
this compound that are normally associated with the
aetiology of periodontitis (Ratcliff & Johnson, 1999).
Abbreviation: PLP, pyridoxal 59-phosphate.
Microbiology (2010), 156, 2260–2269
DOI 10.1099/mic.0.039180-0
2260039180G2010 SGMPrinted in Great Britain
Page 2
Fusobacterium nucleatum, the most abundant Gram-
negative bacterium isolated from dental plaque biofilms
(Moore & Moore, 1994), is a central species in biofilm
development and a pathogen in human infections,
including gingivitis and periodontitis (Kolenbrander et
al., 2002). This micro-organism is also known to be one of
the most active oral bacteria in terms of H2S production
(Claesson et al., 1990; Persson et al., 1990; Pianotti et al.,
1986). Interestingly, multiple forms of H2S-producing
enzymes with large variations in electrophoretic mobility
were found among several strains of F. nucleatum
(Claesson et al., 1990). The cdl gene in F. nucleatum subsp.
polymorphum ATCC 10953 encodes a 33 kDa protein that
produces H2S from L-cysteine (Fukamachi et al., 2002).
The precise mechanism of H2S production by this enzyme
remains to be elucidated, although the protein was
predicted to have bC–S lyase activity, catalysing the a,b-
elimination of L-cysteine to produce H2S, pyruvate and
ammonia. The amino acid sequence of the Cdl protein of
strain ATCC 10953 shows little identity with bC–S lyase
proteins in several micro-organisms (Fukamachi et al.,
2002). No genes encoding H2S-producing enzymes, other
than cdl, have been identified in F. nucleatum so far.
In this study, a 47 kDa protein showing a high identity to
bC–S lyase, which is encoded by the fn0625 gene, was
purified from F. nucleatum subsp. nucleatum ATCC 25586,
and then characterized. We also purified a 33 kDa protein
encoded by the cdl homologue (fn1220) of strain ATCC
25586 to evaluate its enzymic properties. In the process of
characterizing the enzymic properties of Fn0625 and
Fn1220, it was discovered that these enzymes produce
H2S in distinct manners.
METHODS
Bacterial strains and culture conditions. F. nucleatum subsp.
nucleatum ATCC 25586 and subsp. polymorphum ATCC 10953 were
obtained from the RIKEN BioResource Center (Tsukuba, Japan). The
strains were grown anaerobically at 37 uC in Columbia broth (Difco).
Escherichia coli strains DH5a (Invitrogen) and BL21 (Promega) were
used for DNA manipulation and protein purification, respectively,
and were grown aerobically in 26 TY broth (Difco) at 37 uC. When
required, 100 mg ampicillin ml21was added to the media.
Preparation of crude enzyme extracts. Each strain of F. nucleatum
was grown to an OD600of ~0.8. The cells were then harvested from
40 ml of culture and washed with PBS (0.12 M NaCl, 0.01 M
Na2HPO4, 5 mM KH2PO4, pH 7.5) three times. A 1.0 ml aliquot of
the cell suspension was lysed by ultrasonication and the supernatant
was centrifuged. The protein concentrations were determined using a
protein assay reagent (Bio-Rad) with BSA as a standard. The samples
were stored at 220 uC after adding an equal volume of 80% (v/v)
glycerol.
Visualization of enzymic activities. H2S production from L-
cysteine by crude or purified enzymes was visualized by SDS-PAGE
with renaturation to remove the reducing/denaturing agent, followed
by activity staining, as described recently (Yoshida et al., 2010).
Samples were electrophoresed at 10 mA per gel at 4 uC on 12.5% (w/v)
polyacrylamide gels (pH 8.8) with 0.1% SDS. To shift the gel from
noncatalytic to catalytic conditions, the gels were renatured slowly in
buffer by replacement of SDS with the detergents Triton X-100 and
Lubrol PX. To detect the positions of the enzymes, the gels were
incubated in visualizing solution (100 mM triethanolamine.HCl,
pH 7.6, 10 mM pyridoxal 59-phosphate (PLP), 0.5 mM bismuth
trichloride, 10 mM EDTA and 5.0 mM L-cysteine) at 37 uC (Claesson
et al., 1990).
Purification of recombinant proteins encoded by fn0625 and
fn1220. Recombinant enzymes encoded by fn0625 and fn1220 in F.
nucleatum ATCC 25586 were purified using the expression vector
pGEX-6P-1 (GE Healthcare), as previously described (Yoshida et al.,
2002). Briefly, each gene was amplified by PCR using primers
designed to incorporate a BamHI site at the 59 end and a SalI site at
the 39 end of each segment (Table 1). Following PCR amplification,
the products were digested with BamHI and SalI and ligated into
pGEX-6P-1, juxtaposing the gene fragment downstream from the
coding sequence for glutathione S-transferase and a PreScission
protease cleavage site. The recombinant E. coli clones were diluted
1/1000 in 26 YT (500 ml) and cultured at 37 uC until the OD600
reached 0.5–0.7. Protein expression was induced by the addition of
IPTG to a final concentration of 0.3 mM, and the temperature was
maintained at 37 uC. The cells were harvested by centrifugation after
2 h of induction, then they were sonicated in PBS, and the cell debris
was removed by centrifugation at 15000 r.p.m. and 4 uC. The
supernatant was loaded onto a 1 ml glutathione Sepharose 4B column
equilibrated with PBS. The resin was extensively washed with PBS,
equilibrated with PreScission protease buffer (50 mM Tris/HCl,
pH 7.0, 150 mM NaCl, 1 mM EDTA and 1 mM dithiothreitol), and
incubated with 80 U PreScission protease (GE Healthcare) for 12 h at
4 uC. Each enzyme was eluted in 2 ml PreScission protease buffer,
and then stored at 220 uC after adding an equal volume of 80%
glycerol. The protein concentrations were determined as previously
described (Pace et al., 1995). The purity of the samples was analysed
by SDS-PAGE.
Gel-filtration chromatography. The molecular masses of the
purified Fn0625 (54 mg) and Fn1220 (200 mg) proteins were
determined by gel-filtration chromatography with a Superdex 200
HR 10/30 column (GE Healthcare) at a flow rate of 0.25 ml min21in
PBS. In this procedure, the standard curve was produced using
molecular mass standards (Kit for Molecular Weights 12000–200000;
Sigma). The enzyme elution was monitored at 280 nm.
Enzyme assay. The activity levels of the purified products were
examined by measuring the rate of formation of pyruvate or H2S
(Yoshida et al., 2003). The reaction mixture (100 ml) contained
40 mM potassium phosphate buffer (pH 7.6), 1 nmol PLP, 10.9 (for
Fn0625) or 1.1 ng (for Fn1220) of the purified enzyme, and various
concentrations of substrate(s). To determine pyruvate production,
the reaction was terminated by adding 50 ml 4.5% trichloroacetic acid
after a 10 min incubation at 37 uC. The reaction mixture was
centrifuged, and 250 ml of the supernatant was added to 750 ml of
0.33 M sodium acetate (pH 5.2) containing 0.017% 3-methyl-2-
benzothiazolinone hydrazone. The reaction mixture was then
incubated at 50 uC for 30 min (Soda, 1968). The amount of pyruvate
was determined by measuring A335. Alternatively, to estimate H2S
production, a methylene blue formation assay was performed
following the method of Schmidt (1987), with minor modifications.
Briefly, the reaction (200 ml) was incubated at 37 uC for 10 min, and
terminated by the addition of 20 ml of solution I (20 mM N9,N9-
dimethyl-p-phenylenediamine dihydrochloride in 7.2 M HCl) and
20 ml of solution II (30 mM FeCl3in 1.2 M HCl). After incubation for
30 min at room temperature, methylene blue formation was
examined spectrophotometrically at 670 nm using a standard curve,
which was made by measuring pyruvate in the reaction mixture
containing L-cysteine and bC–S lyase from Streptococcus anginosus
Two H2S-producing enzymes in F. nucleatum
http://mic.sgmjournals.org2261
Page 3
(Ito et al., 2008), since the enzyme produces equal amounts of
pyruvate and H2S from L-cysteine (Yoshida et al., 2003).
The kinetic parameters were computed from the Lineweaver–Burk
transformation of the Michaelis–Menten equation. The kcatvalues
were calculated using the Vmaxvalues and the molecular masses of the
enzymes.
The formation of ammonia as an end product was determined using
an Ammonia-testwako kit (Wako Pure Chemical), following the
manufacturer’s protocols.
Gas chromatography. To detect volatile sulfur compounds,
including H2S, methyl mercaptan, ethyl mercaptan, diethyl sulfide
and dimethyl sulfide, gas chromatography was performed as
described previously (Yoshimura et al., 2000) with minor modifica-
tions. The reaction mixture (0.1 ml) contained 13.7 mg recombinant
protein, 1 mM substrate, 10 mM PLP and 40 mM potassium
phosphate buffer (pH 7.6). The reaction mixture was incubated in
a 10 ml glass tube at 37 uC, followed by sealing with a silicone plug.
After a 10 min incubation, a sample (1 ml) of the vapour above the
reaction mixture in the tube was removed with a gas-tight syringe
without taking out the plug, and analysed by gas chromatography
(model GC-8A; Shimadzu) using a Teflon column packed with 20%
b,b9-oxydipropionitrile on an 80–100 mesh Chromosorb W AW-
DMCS-ST device (Shimadzu), fitted with a flame photometric
detector at 70 uC.
HPLC. The production of homocysteine, cysteine, cystathionine, S-
hydroxyethylcysteineand2-(2-aminoethylsulfanyl)ethanamine,
which were predicted end products in the reaction mixtures, were
investigated by reversed-phase HPLC. The reaction mixtures
contained the following reagents in a final volume of 100 ml:
40 mM potassium phosphate buffer (pH 7.6), 10 mM PLP, 1 mM
substrate(s), and 5.2 mg purified enzyme. After the mixtures had been
incubated for 2 h at 37 uC, the enzymes were removed using a
Microcon YM-10 filter (10 kDa cutoff; Amicon). The ultrafiltration
products were dansylated as previously described (Tapuhi et al.,
1981). Aliquots (20 ml) of each sample were applied onto an XTerra
RP18column (4.66150 mm; Waters) by injection. The dansylated
products were separated at a flow rate of 1.0 ml min21at 40 uC with
a mobile phase of 33.25/66.75 (v/v) methanol/water containing 0.6%
(v/v) glacial acetic acid and 0.008% (v/v) triethylamine. Excitation
and emission wavelengths of 350 and 530 nm, respectively, were used.
Liquid chromatography coupled with mass spectrometry (LC-
MS). The fractions collected from HPLC were analysed using an LC-
MS system consisting of an ion-trap mass spectrometer (HCT
Ultrasil; Bruker Daltonics) equipped with a capillary LC (Agilent 1100
system) and Chemistation software (Agilent). The chromatographic
analyses were performed with a reversed-phase Zorbax 300S-C18
column (150 mm60.3 mm; Agilent), and a gradient was applied of
15–50% (v/v) acetonitrile/water containing 0.1% (v/v) formic acid
for 20 min at a flow rate of 4 ml min21. Analyte ionization was
achieved by using positive electron spray ionization, a process that
mainly produces the protonated molecular mass ion (M+H)+. The
temperature of the ESI capillary was maintained at 300 uC. The
drying gas was introduced at a temperature of 300 uC and a flow rate
of 4 l min21. The nebulizer gas pressure was 10 p.s.i. (69 kPa). The
samples collected were evaporated to remove the solvent and then
dissolved in 0.1% formic acid in water. One microlitre of each sample
was injected into the capillary LC.
Real-time quantitative PCR analysis. Overnight cultures of F.
nucleatum ATCC 25586 were diluted (1/50) in fresh Columbia broth.
The growth of cells incubated for 4, 6.5, 8.5, 12 and 24 h was
monitored by determining the OD600, and the cells collected at each
incubation point were used for RNA extraction. Total RNA was
isolated from the harvested cells using FastPrep Blue tubes (Bio 101).
Contaminating DNA was eliminated by digestion with RNase-free
DNase (Takara Bio). RNA (10 ng) was reverse transcribed into single-
stranded cDNA using each reverse primer listed in Table 1. Real-time
quantitative PCR amplification, detection and analysis were per-
formed using the Thermal Cycler Dice RealTime System (Takara Bio)
with SYBR Premix Ex Taq II (Takara Bio). Real-time PCR was carried
out in 25 ml reaction mixtures (16 SYBR Premix Ex Taq II, 22.5 pmol
of each forward and reverse primers and 2.5 ml of template). The
reaction conditions were 95 uC for 30 s followed by 40 cycles of 95 uC
for 5 s, and 60 uC for 30 s. At the end of each run, a dissociation
protocol (95 uC for 15 s, 60 uC for 30 s, and 95 uC for 15 s) was
performed to ensure that non-specific PCR products were absent.
Primers (Table 1) were designed using the Primer Express software
(version 3.0; Applied Biosystems). To estimate the initial amounts of
Table 1. Oligonucleotide primers used in this study
Designation Sequence (5§ to 3§)*
Purification of Fn0625
021709-0625-GST-Bam
021709-0625-GST-Sal
Purification of Fn1220
030209-FN1220-F-Bam
030209-FN1220-R-Sal
Real-time PCR
042109-Fn0625-F
042109-Fn0625-R
042109-Fn1220-F
042109-Fn1220-R
081909-fn0654-Real-F
081909-fn0654-Real-R
081909-fn2054-Real-F
081909-fn2054-Real-R
ATGGATCCGAAAAAGAAAAATTTTTAAAAGAATACTTAG
AAGTCGACTTATCTATCACTCCTTAATTTTTTATATTCAC
ATGGATCCTTAGCAAATTCTGTAATTGATTTAATTG
ATGTCGACTTCTTAAAACTTTTATAAATCACAAATATTAG
TCTATGTGGGTTGCAGATATGGAA
TGCCCCATGTTCTATTCTTTCTTT
TGCTTCATCTCCATTGCTTTCA
ATCATAAACTGCTGGAATACCACCTA
TGCTAAGACTGTTGTATGGAATGGA
ACATACTCCTATTGTTCCTTTTGCAA
CCCTGCTTCTGTTGACTTAACAAC
AGGTTTCTTCTGCCATCTTGGA
*Underlining indicates restriction endonuclease sites incorporated to facilitate cloning.
Y. Yoshida and others
2262Microbiology 156
Page 4
template in each sample, serial real-time PCR was performed using
purified genomic DNA. For each gene, a standard curve was plotted
using the log of the initial quantity of template against the threshold
cycle (i.e. the cycle at which the fluorescence rose above the
background level). In this way, differences in primer efficiency could
be accommodated. Relative changes in gene expression were indicated
as the difference (n-fold) relative to the values for calibrator cDNAs of
two constitutive housekeeping genes: fn0654, encoding a phospho-
glycerate kinase, and fn2054, encoding a glucose-6-phosphate
isomerase (Qi et al., 2005). The data reported were obtained from
three independent experiments.
RESULTS
Multiple enzymes produce H2S in F. nucleatum
The combination assay of SDS-PAGE and activity staining
previously demonstrated that Cdl was the only enzyme to
produce H2S from
L-cysteine in F. nucleatum subsp.
polymorphum ATCC 10953 (Fukamachi et al., 2002).
Despite these findings, SDS-PAGE analysis with renatura-
tion followed by activity staining, a method which was
recently developed (Yoshida et al., 2010), showed that
crude enzyme extracts from the same strain contained
multiple H2S-producing enzymes, including three major
proteins with non-uniform migration distances (Fig. 1a).
Similar protein bands associated with H2S production were
also observed in crude enzyme extracts from F. nucleatum
subsp. nucleatum ATCC 25586, although the protein with
the longest migration distance in strain ATCC 10953
appeared to be slightly smaller than the corresponding
protein in strain ATCC 25586.
Identification of Fn0625 and Fn1220 as H2S-
producing proteins in crude extracts of strain
ATCC 25586
Database analysis showed that the open reading frame
fn1220 in the genomic DNA of F. nucleatum subsp.
nucleatum ATCC 25586 (Kapatral et al., 2002) is a
homologue of the cdl gene in F. nucleatum subsp.
polymorphum ATCC 10953. The amino acid sequence
deduced from fn1220 in strain ATCC 25586 was 97%
identical to the cdl gene product in strain ATCC 10953.
Like the Cdl protein, Fn1220 showed no significant
homology with bC–S lyase, which catalyses the a,b-
elimination of L-cysteine to produce H2S, pyruvate and
ammonia. Instead, a database analysis demonstrated that
the amino acid sequence of Fn0625 was 29–40% identical
with the bC–S lyase proteins encoded by malY in E. coli
(Zdych et al., 1995), ytjE in Lactococcus lactis (Martinez-
Cuesta et al., 2006; Sperandio et al., 2005), hly in
Treponema denticola (Chu et al., 1995) and lcd in
streptococcal species (Ito et al., 2008; Yoshida et al.,
2003, 2008). To identify the Fn0625 and Fn1220 proteins in
the crude enzyme extracts of strain ATCC 25586, the
recombinant proteins were purified (Fig. 1a). The molecu-
lar masses of the denatured polypeptides were 47 and
33 kDa for the fn0625 and fn1220 products, respectively,
which agreed with the predicted molecular masses. In gel-
filtration chromatography, the purified Fn0625 and Fn1220
were eluted at retention volumes corresponding to
molecular masses of 84.0 and 65.4 kDa, respectively,
calculated using a standard curve made with several
standard proteins (Fig. 1b). These values were roughly
twice the theoretical molecular masses, suggesting that
both proteins are present as homodimers in solution. The
SDS-PAGE analysis with renaturation followed by activity
staining revealed that the two bands with long migration
distances in crude enzyme extracts from strain ATCC
25586 corresponded to the fn1220 and fn0625 products
(Fig. 1a). Identification of Cdl as the protein of lower
molecular mass in the crude extracts of strain ATCC 10953
Fig. 1. Analyses of crude enzyme extracts and purified proteins of
F. nucleatum. (a) SDS-PAGE analyses. Left panel: the gel was
stained with Coomassie brilliant blue. Right panel: after the gel had
been renatured, the enzymic activity was visualized by activity
staining. Lanes: 1, cell lysate from F. nucleatum subsp. poly-
morphum ATCC 10953; 2, cell lysate from F. nucleatum subsp.
nucleatum ATCC 25586; 3, purified Fn0625 of F. nucleatum
subsp. nucleatum ATCC 25586; 4, purified Fn1220 of F.
nucleatum subsp. nucleatum ATCC 25586. Five microlitres of
each sample was applied to the gel. Positions of molecular mass
markers are indicated. (b) Gel-filtration chromatography of purified
Fn0625 (top) and Fn1220 (bottom) on Superdex 200 HR10/30.
The elution volumes of molecular mass standards are shown as
triangles with the protein size in kDa.
Two H2S-producing enzymes in F. nucleatum
http://mic.sgmjournals.org 2263
Page 5
was also confirmed by comparing its electrophoretic
mobility to recombinant purified Cdl (data not shown).
Enzymic characterization of purified Fn0625
To evaluate the enzymic activity of Fn0625, the breakdown
of several substrates was determined by assaying for the
production of ammonia, pyruvate and sulfur-containing
compounds. Incubation of each substrate listed in Table 2
with purified Fn0625 consistently resulted in the produc-
tion of both ammonia and pyruvate. The sulfur-containing
compounds expected as end products in each reaction
mixture were also detected using gas chromatography or
HPLC with commercially available standards. Interestingly,
cysteine, which was predicted to form by b-elimination of
lanthionine, was not detected, probably because any
cysteine produced would be rapidly degraded into
ammonia, pyruvate and H2S. Indeed, gas chromatography
analysis confirmed that H2S was produced in the reaction
mixtures. Incubation of Fn0625 with S-(2-aminoethyl)-L-
cysteine, L-methionine or L-homocysteine did not produce
ammonia or pyruvate. These results suggested that the
fn0625 gene encodes a bC–S lyase that cleaves aC–N and
bC–S linkages in substrates, but has no cC–S activity.
The kinetic properties for the decomposition of the
substrates by Fn0625 were calculated from Lineweaver–
Burk plots, and are summarized in Table 2. The kcatand
kcat/Kmvalues of Fn0625 for L-cysteine were low compared
to those for other substrates, suggesting that the capacity of
Fn0625 to produce H2S was low.
Fn1220 produces H2S and lanthionine from L-
cysteine
The kinetic values of Fn1220 for L-cysteine were also
determined: Km, 1.04±0.07 mM; kcat, 0.244±0.01 s21;
and kcat/Km, 0.237±0.01 s21mM21. These values were
obtained by measuring the amounts of H2S produced using
a methylene blue formation assay, since incubation of the
purified Fn1220 with L-cysteine resulted in no production
of pyruvate or ammonia. This unexpected finding led to
the hypothesis that one or more byproducts, other than
pyruvate and ammonia, might be produced with H2S in
the reaction mixture. HPLC analysis showed that the
reaction of Fn1220 with L-cysteine yielded one product,
which was dansylated before injection (Fig. 2a). This
product was not observed in the reaction mixture
incubated with L-cysteine and Fn0625. The other peak
with the longest retention time, which was commonly
observed, was unidentified.
To determine the mass of the unknown dansylated product
using LC-MS, the peak was pooled from HPLC runs,
evaporated to remove the solvent (i.e. methanol, acetic acid
and triethylamine), and dissolved in distilled water. The
molecular mass of the dansylated product was 442.10 in the
MS spectrum, which corresponded to an [M+H]+ion of
dansylated lanthionine (Fig. 2b). Further confirmation of
the identity of the targeted metabolite was accomplished
using HPLC with commercially available lanthionine,
which was dansylated before injection (Fig. 2a).
Substrate specificity of Fn1220
To further understand the enzymic properties of Fn1220,
its substrate specificity was investigated. Incubation of
Fn1220 with several substrates that were degraded by
Fn0625 mostly failed to produce ammonia or pyruvate
(Table 3). However, these byproducts were produced when
L-cystathionine was used as a substrate. The production of
homocysteine, which is a sulfur-containing end product
generated by b-elimination of L-cystathionine, was con-
firmed using HPLC. Thus, of all the tested substrates, only
L-cystathionine was used as a substrate for the b-
elimination reaction by Fn1220. The Kmand kcatvalues
Table 2. Kinetic properties for the reactions catalysed by Fn0625 of F. nucleatum ATCC 25586
Substrate*End product
Km(mM)
kcat(s”1)
kcat/Km(s”1mM”1)
AmmoniaD
PyruvateD
Sulfur-containing
compound
L-Cysteine
L-Cystine
S-Ethyl-L-cysteine
S-Methyl-L-cysteine
L-Cystathionine
DL-Lanthionine
+
+
+
+
+
+
+
+
+
+
+
+
H2Sd
H2S
Ethyl mercaptand
Methyl mercaptand
Homocysteine§
Cysteine||
0.22±0.01
1.48±0.20
41.56±3.56
39.30±5.20
0.81±0.06
3.49±0.17
0.016±0.001
24.31±2.03
29.04±3.33
15.06±0.87
27.75±0.51
0.69±0.01
0.073±0.002
16.82±1.31
0.70±0.02
0.39±0.03
34.55±1.79
0.20±0.01
*No end products were detected from S-(2-aminoethyl)-L-cysteine, L-methionine or L-homocysteine.
DPlus sign indicates product detected.
dDetermined by gas chromatography.
§Determined by HPLC.
||Instead of cysteine, which was a predicted end product in the reaction, H2S was detected using gas chromatography.
Y. Yoshida and others
2264 Microbiology 156