Comparative genomics identifies candidate genes for infectious salmon anemia (ISA) resistance in Atlantic salmon (Salmo salar).

Abstract

Infectious salmon anemia (ISA) has been described as the hoof and mouth disease of salmon farming. ISA is caused by a lethal and highly communicable virus, which can have a major impact on salmon aquaculture, as demonstrated by an outbreak in Chile in 2007. A quantitative trait locus (QTL) for ISA resistance has been mapped to three microsatellite markers on linkage group (LG) 8 (Chr 15) on the Atlantic salmon genetic map. We identified bacterial artificial chromosome (BAC) clones and three fingerprint contigs from the Atlantic salmon physical map that contains these markers. We made use of the extensive BAC end sequence database to extend these contigs by chromosome walking and identified additional two markers in this region. The BAC end sequences were used to search for conserved synteny between this segment of LG8 and the fish genomes that have been sequenced. An examination of the genes in the syntenic segments of the tetraodon and medaka genomes identified candidates for association with ISA resistance in Atlantic salmon based on differential expression profiles from ISA challenges or on the putative biological functions of the proteins they encode. One gene in particular, HIV-EP2/MBP-2, caught our attention as it may influence the expression of several genes that have been implicated in the response to infection by infectious salmon anemia virus (ISAV). Therefore, we suggest that HIV-EP2/MBP-2 is a very strong candidate for the gene associated with the ISAV resistance QTL in Atlantic salmon and is worthy of further study.

Full text

Page 1

ORIGINAL ARTICLE
Comparative Genomics Identifies Candidate Genes
for Infectious Salmon Anemia (ISA) Resistance
in Atlantic Salmon (Salmo salar)
Jieying Li & Keith A. Boroevich & Ben F. Koop &
William S. Davidson
Received: 19 December 2009 /Accepted: 4 March 2010 /Published online: 16 April 2010
# The Author(s) 2010. This article is published with open access at Springerlink.com
Abstract Infectioussalmonanemia(ISA)hasbeendescribed
as the hoof and mouth disease of salmon farming. ISA is
caused by a lethal and highly communicable virus, which can
have a major impact on salmon aquaculture, as demonstrated
by an outbreak in Chile in 2007. A quantitative trait locus
(QTL) for ISA resistance has been mapped to three micro-
satellite markers on linkage group (LG) 8 (Chr 15) on the
Atlantic salmon genetic map. We identified bacterial artificial
chromosome (BAC) clones and three fingerprint contigs from
the Atlantic salmon physical map that contains these markers.
We made use of the extensive BAC end sequence database to
extend these contigs by chromosome walking and identified
additional two markers in this region.TheBAC end sequences
were used to search for conserved synteny between this
segment of LG8 and the fish genomes that have been
sequenced. An examination of the genes in the syntenic
segments of the tetraodon and medaka genomes identified
candidates for association with ISA resistance in Atlantic
salmon based on differential expression profiles from ISA
challenges or on the putative biological functions of the
proteinstheyencode.Onegeneinparticular,HIV-EP2/MBP-2,
caught our attention as it may influence the expression of
several genes that have been implicated in the response to
infectionbyinfectioussalmonanemiavirus(ISAV).Therefore,
wesuggest thatHIV-EP2/MBP-2isa verystrongcandidate for
the gene associated with the ISAV resistance QTL in Atlantic
salmon and is worthy of further study.
Keywords Infectious salmon anemia.Atlantic salmon.
Disease resistance.Comparative genomics
Introduction
Infectious salmon anemia (ISA) is a highly communicable
viral disease that affects salmonids. ISA can be particularly
devastating to marine-farmed Atlantic salmon with cumula-
tive mortalities ranging up to 100% in some instances. ISA
was first recognizedasanewdisease entityinAtlanticsalmon
in 1984 in Norway (Thorud and Djupvik 1988), and since
then, outbreaks have occurred in Scotland, the Faroe Islands,
Denmark, Maine, and eastern Canada (see Kibenge et al.
2004 for details). ISA has also recently had a major negative
impact on salmon production in Chile (Godoy et al. 2008).
Such is the threat to salmon aquaculture that ISA is on the
European Union list of the most dangerous fish diseases.
The causative agent of ISA is infectious salmon anemia
virus (ISAV), which is classified as a member of the
Orthomyxoviridae and the only species in the genus
Isavirus (Falk et al. 1997; Rimstad and Mjaaland 2002).
The biochemical events involved in the infection and
replication of ISAV are similar (Eliassen et al. 2000;
Rimstad and Mjaaland 2002; Hellebo et al. 2004) but not
identical (Falk et al. 1997; Krossoy et al. 2001) to what has
been observed in their relatives, the influenza viruses. The
genome of ISAV resembles that of influenza virus A as it is
composed of eight linear single-stranded, negative-sense
Electronic supplementary material The online version of this article
(doi:10.1007/s10126-010-9284-0) contains supplementary material,
which is available to authorized users.
J. Li:K. A. Boroevich:W. S. Davidson (*)
Department of Molecular Biology and Biochemistry,
Simon Fraser University,
8888 University Drive,
Burnaby, BC, Canada V5A 1S6
e-mail: wdavidso@sfu.ca
B. F. Koop
Department of Biology, University of Victoria,
Victoria, BC, Canada V8W 3N5
Mar Biotechnol (2011) 13:232–241
DOI 10.1007/s10126-010-9284-0

Page 2

RNA segments with a total size of 14.3 kb, which encode at
least ten proteins, nine of which are structural (Falk et al.
2004; Kibenge et al. 2004).
Although vaccination is used successfully in Atlantic
salmon farming to control many bacterial diseases, effective
vaccines against viral diseases have proved more difficult to
produce. An alternative strategy is to identify quantitative
trait loci (QTL) affecting resistance to the viruses and to
make use of this information in a marker assisted selection
breeding program. Gjoen et al. (1997) showed that there is
a genetic component to ISA resistance in Atlantic salmon
and estimated the narrow-sense heritability to be 0.19. A
preliminary study using amplified fragment length poly-
morphisms and a multistage testing strategy identified
several putative QTL (Moen et al. 2004a), and it was
subsequently shown by the addition of microsatellite
markers that a major QTL is located on linkage group
(LG) 8 in the Atlantic salmon genetic map (Moen et al.
2004b). The recent integration of the linkage map and
karyotype (Phillips et al. 2009) showed that LG8 corre-
sponds to chromosome (Chr) 15, and this nomenclature will
be used hereafter. Further investigation confirmed the
presence of the QTL for ISA resistance on Chr15 in
Atlantic salmon and showed that this QTL explains a
significant fraction (32–47%) of the additive genetic
variation of the trait (Moen et al. 2007). However, a
transmission disequilibrium test and combined linkage
disequilibrium/linkage analysis revealed that the QTL
markers were not in a population-wide association with
ISA resistance, highlighting the need for finer mapping and/
or the use of salmon genomic resources to identify the gene
and the functional polymorphism itself.
Over the past decade, many genomic resources have
been developed for Atlantic salmon, much of them through
the Norwegian Salmon Genome Project, the Genomic
Research on Atlantic Salmon Project (GRASP), and their
successor, Consortium for Genomic Research on All
Salmonids Project (cGRASP). These include the construc-
tion of a bacterial artificial chromosome (BAC) library
(CHORI-214; Thorsen et al. 2005), a physical map
comprising ∼4,300 contigs based on Hind III fingerprinting
of 223,781 BACs in Ng et al. (2005), 207,869 BAC end
sequences that cover ∼3.5% of the genome sequence and
linkage maps with ∼1,600 markers (Danzmann et al. 2008;
Moen et al. 2008; Lorenz et al. 2009). More than half of the
genetic markers are microsatellites or SNPs derived from
BAC end sequences, and these have recently been used to
integrate the linkage map, the physical map, and the
Atlantic salmon karyotype (Phillips et al. 2009). In
addition, ∼495,000 ESTs have been generated (Rise et al.
2004; Adzhubei et al. 2007; Koop et al. 2008) and used to
construct microarrays for expression studies (Rise et al.
2004; von Schalburg et al. 2008; Koop et al. 2008). These
genomic resources have been amalgamated and are publicly
accessible at www.asalbase.org.
In the absence of a sequence for the genome of the Atlantic
salmon, we wondered if it would be feasible to link these
salmon genomic resources associated with ISA to the
sequenced genomes of other teleosts, in particular those of
the pufferfish (Tetraodon nigroviridis), medaka (Oryzias
latipes), zebrafish (Danio rerio), and three-spined stickleback
(Gasterosteus aculateus), in the manner illustrated by
Sarropoulou et al. (2008) for the commercially important fish
species: Sparus aurata, Dicentrarchus labrax, and Oreochro-
mis spp. This approach has been used successfully to identify
candidate genes for QTL in the blind Mexican cavefish,
Astyanax mexicanus, based on conservation of synteny with
zebrafish (Gross et al. 2008). Here, we report the results of a
search for candidate genes associated with the ISA resistance
QTL in Atlantic salmon using comparative genomics.
Materials and Methods
Design of Oligonucleotide Hybridization Probes
and Polymerase Chain Reaction Primers
Prior to probe and primer design, the sequences of the
microsatellite markers and their flanking regions were first
masked for repetitive DNA using the Repeat Masker
program on the University of Victoria cGRASP website
(http://lucy.ceh.uvic.ca/repeatmasker/cbr_repeatmasker.py).
Then, the masked sequences were used as the input to
design oligonucleotide probes (40 mers) and corresponding
complementary primers (20 mers) using OLIGO 4.0
software (Rychlik and Rhoads 1989). The oligonucleotides
were designed such that they had a GC content of 50% or
higher, with a Tm of the probe at least 55°C. The probes
and primers used in this study are listed in Table 1.
Identification of BACs Containing Specific Microsatellites
and their Assignment to Fingerprint Contigs
We screened the CHORI-214 Atlantic salmon BAC library
(Thorsen et al. 2005) with the 40-mer probes designed from
the flanking sequences of the microsatellite markers
(Table 1). The 40 mers were end-labeled with
using T4 polynucleotide kinase and hybridized to six BAC
filters at a time as described by Johnstone et al. (2008).
Briefly, prehybridization was carried out in 5× saline–
sodium citrate buffer (SSC), 0.5% sodium dodecyl sulfate
(SDS), and 5× Denhardt’s solution at 65°C for 3 h, and then
the32P-labeled probes were added and incubated overnight.
The filters were washed three times, each for 1 h at 50°C in
1× SSC and 0.1% SDS. The filters were wrapped in
Saran™ wrap and exposed to phosphor screens that were
32PγATP
Mar Biotechnol (2011) 13:232–241233

Page 3

subsequently scanned using the Typhoon Imaging System
and visualized using ImageQuant software, giving an image
of the32P-labeled hybridization-positive BACs containing
the microsatellite markers. The hybridization-positive BAC
clones were picked from the library, cultured in 5 mL LB
media containing chloramphenicol (50 µg/mL) overnight at
37°C shaking at 250 rpm, and made into glycerol stocks for
subsequent polymerase chain reaction (PCR) verification
that they did indeed contain the appropriate microsatellite
marker. The PCR reaction mixture contained 1 μL of 10×
PCR buffer containing MgCl2(QIAGEN), 1 μL of 2 mM
dNTPs, 0.5 μL of 10 μM 40-mer probe, 0.5 μL of 10 μM
complementary primer, 0.15 μL of Taq DNA polymerase
(QIAGEN), and 6.8 μL of dH2O. A small amount of BAC
clone glycerol stock was added into the PCR reaction mix
as template. The PCR conditions comprised 95°C for 5 min
followed by 35 cycles of 95°C for 45 s, 65°C for 45 s and
72°C for 2 min, and then 72°C for 10 min. PCR products
were separated by electrophoresis through a 1.3% agarose
gel with 1× TAE, stained with ethidium bromide, and
visualized using a UV trans-illuminator (Alpha Innotech).
Hybridization and PCR-positive BACs for the microsatel-
lite markers were matched to fingerprint contigs within the
Atlantic salmon physical map (Ng et al. 2005 as shown on
www.asalbase.org).
Construction of Minimum Tiling Paths for BAC Contigs
and Chromosome Walking
The construction of minimum tiling paths for fingerprint
contigs followed the procedure outlined in Quinn et al.
(2008). The approach to probe and primer design for
chromosome walking was as described above except that
the program used was Primer3 Input (version 0.4.0; http://
frodo.wi.mit.edu/primer3/) instead of OLIGO 4.0. The
probes and corresponding complementary primers were
designed to produce a PCR product of approximately
200 bp. BAC library screening and PCR testing for
confirmation of true positives followed the procedure
described above. Two fingerprint contigs were considered
joined if a BAC from one contig was confirmed to be a true
positive of a probe from another contig.
Linkage Mapping
Linkage analysis was carried out using the two Atlantic
salmon SALMAP mapping families as previously described
(Danzmann et al. 2008; Phillips et al. 2009). The most
recent version of the merged female Atlantic salmon
genetic map can be seen on www.asalbase.org.
Comparative Genome Analysis
A freely accessible Web-based database, ASalBase (www.
asalbase.org), has been built to display the Atlantic salmon
linkage map, physical map, and associated information
such as BAC end sequences (Boroevich et al. 2008). This
website provides a rich resource for comparative genomic
analysis using the Atlantic salmon BAC end sequences.
BAC end sequences (207,869) with an average length of
666 bp (∼3.5% of the genome) are shown on this site. After
masking the BAC end sequences using the Repeat Masker
program on the University of Victoria cGRASP website
(http://lucy.ceh.uvic.ca/repeatmasker/cbr_repeatmasker.py),
they were subjected to a BLASTx sequence similarity
search against the tetraodon, medaka, stickleback, and
zebrafish (Ensembl release 53 protein databases). These
comparisons enabled us to identify putative regions of the
genomes of these four fish that are syntenic with the
Atlantic salmon ISA QTL region.
Primer namesNucleotide sequences
BHMS130F and probe
BHMS130R
BHMS177F and probe
BHMS177R
BHMS553R and probe
BHMS553F
Ssa0130ECIGF and probe
Ssa0130ECIGR
Ssa0821BSFUF
Ssa0821BSFUR
S0076B01T7F and probe
S0076B01T7R
Ssa0578BSFUF
Ssa0578BSFUR
AAAACACTCTAATGGTTGTGTCAGTCAGAGACAACCCTCC
TGTCAGTCTGCTAAACACTG
TTATCTGGGATCACTGATTAGAGCTGTTCATCTGGCTGTG
CTTTCCATTTCCTCCCCCAG
GAGTGCTAACTTCAAGGCTTCTCCACTAATAGTCTGAAGG
CTGTAAACATCACAGGCG
CAGTTAGGTGAGGGGGTTAGGGGAAAATGTCAAGGCAAAG
GGACACACCTACTCATTCCA
TAACGAATGACAGCTTGCTA
AGCCTTTTTCAAAGAATGTG
GTAGTGGGACTCAGGTGGTATGCTATTTCCCTTCCCAATA
GTACAGACTGTGGGTTGAGG
TTGAAACCCTTTCTGTGATT
CTGACTCTGGCATGTACAAA
Table 1 Oligonucleotide probes
and primers used for screening
the Atlantic salmon BAC library
The oligonucleotide probe also
acted as one of the PCR primer
pairs for checking the
hybridization-positive BACs
234Mar Biotechnol (2011) 13:232–241

Page 4

Results and Discussion
Identification of BACs Containing the Genetic Markers
Associated with the ISA Resistance QTL
The results from QTL mapping of ISA resistance in
Atlantic salmon identified three microsatellite markers,
BHMS177, BHMS553, and BHMS130, most closely
associated with this trait (Moen et al. 2007). These
microsatellites are tightly linked spanning, approximately
4.3 cM from 30.4 to 34.7 cM on Chr15 of the integrated
female map (Phillips et al. 2009; www.asalbase.org). We
noted that the marker Ssa0130ECIG also mapped to this
region. We designed oligonucleotide probes from the
flanking regions of these four microsatellite markers
(Table 1) and used them to screen the CHORI-214 Atlantic
salmon BAC library (Thorsen et al. 2005). The
hybridization-positive BACs were examined by PCR using
the primers that amplify the four microsatellite markers
(Table 1). BACs which gave amplification products of the
expected size are listed in Table 2 along with the four
fingerprint contigs of the physical map (Ng et al. 2005;
www.asalbase.org) to which they belong, namely, contigs
1180, 386, 1907, and 620. Contig 620 contains a micro-
satellite marker, Ssa0821BSFU, derived from a BAC end
sequence. Ssa0812BSFU was mapped in the Atlantic
salmon SALMAP mapping families (Danzmann et al.
2008) to Atlantic salmon Chr15 at position 30.4 cM of
the integrated female map, which is consistent with the
mapping of the other markers listed above.
Construction of Minimum Tiling Paths and Chromosome
Walking in the ISA Resistance QTL Genomic Region
We made use of the extensive BAC end sequence database
and designed PCR primers from BACs in contigs 1180,
386, 1907, and 620. This allowed us to construct minimum
tiling paths for these contigs. We then attempted to carry
out chromosome walking by screening the BAC library
with oligonucleotide probes designed from BAC end
sequences of BACs that were at the ends of the contigs.
This proved very difficult, primarily because of the
repetitive nature of the Atlantic salmon genome (de Boer
et al. 2007); however, the probe derived from the T7 end
sequence of BAC S0076B01, which is in contig 620,
hybridized to several BACs from contig 1907 (Table 2),
indicating that contigs 620 and 1907 overlap one another.
When we examined the putative syntenic regions of these
four contigs on the medaka genome using www.asalbase.
org, we noted that contig 227 was adjacent to contig 1907.
Contig 227 contains the BAC end sequence-derived genetic
marker Ssa0578BSFU. Using the Atlantic salmon SALMAP
mapping families, we mapped Ssa0578BSFU to 34.7 cM
on Chr15, which is at one end of the ISA resistance QTL
region.
Comparative Genomic Analyses
We used the BAC end sequences from contigs 1180, 386,
1907, 620, and 227 to carry out similarity searches against
the genomic sequences of tetraodon (T. nigroviridis),
medaka (O. latipes), stickleback (Gasterosteus aculeatus),
and zebrafish (D. rerio) (Ensembl release 53). Table 3
provides a summary of the results. It appears that this
region of Chr15 in Atlantic salmon shares extensive
synteny with LG14 of tetraodon, LG24 of medaka,
LGXVIII of stickleback, and LG20 of zebrafish. It should
be noted that in the comparisons of Atlantic salmon with
tetraodon, medaka, and stickleback, there appears to be a
discontinuity between contigs 227 and 1180, although the
linkage group is conserved in all cases. This is illustrated
for medaka in Fig. 1. Similarly, the comparison of the
Atlantic salmon and zebrafish suggests that some rearrange-
ments have occurred in these genomes, but their nature is
Table 2 BACs, and the contigs to which they have been assigned (Ng
et al. 2005), that were positive by hybridization and PCR confirmation
for genetic markers in the Atlantic salmon ISA QTL region (Moen et
al. 2007)
Markers Positive BACs Contig
BHMS130S0019O02
S0026I01
S0123H01
S0006L24
S0036K05
S0045L14
S0353K21
S0819O15
S0835A07
S0848I03
S0881C19
S0927L15
S0933B05
S0941O10
S0958C23
S0092G24
S0076B01
S0143G23
S0228D13
S0824B12
S0928O23
S0939C19
S0960I24
S0038H22
1180
1180
1180
Singleton
386
386
1907
620
620
620
620
620
620
620
Not fingerprinted
620
620
1907
1907
1907
1907
Not fingerprinted
Not fingerprinted
227
BHMS553
BHMS177
Ssa130ECIG
Ssa0821BSFU
S0076B01T7
Ssa0578BSFU
Mar Biotechnol (2011) 13:232–241235

Page 5

not immediately obvious. Another possibility is that the
resolution of the linkage map is imprecise because of the
nature of the SALMAP mapping families used for its
construction (seeDanzmann etal. 2008 for details).However,
it was both reassuring and satisfying to discover that there is
an apparent conservation of synteny among all of these
phylogenetically diverse fish genomes corresponding to this
segment of Chr15 in Atlantic salmon. Tetraodon has one of
themostcompactvertebrategenomes(Jaillonetal.2004), and
therefore, we decided to examine the region from 8,350k to
10,250k in tetraodon LG14 in more detail. We also examined
the region from 15,600k to 23,900k in medaka LG24. We
developed gene lists from these regions of the tetraodon and
medaka genomes using the BioMart tool from Ensembl
(Electronic Supplementary Material Tables 1 and 2). We
expected that these lists would contain one or more orthologs
of candidate genes that could explain the ISA resistance in
Atlantic salmon.
Comparison of QTL Gene Lists with Microarray Gene
Expression Lists from ISA-Infected and Uninfected
Atlantic Salmon
Several studies have examined the changes in gene
expression in Atlantic salmon tissues and cultured salmon
cells that result from exposure to ISA (Jørgensen et al.
2007, 2008; Kiling et al. 2007; McBeath et al. 2007;
Schiøtz et al. 2008; Workenhe et al. 2008, 2009). Although
we considered the results from all of these publications, we
concentrated on the recent work of Workenhe et al. (2009).
Our rationale was that this study used the most compre-
hensive microarray (i.e., the cGRASP 16,000 cDNA array
described by von Schalburg et al. 2008) to examine the
changes that occur in the macrophage/dendritic-like cell
line TO infected with a either a low pathogenic or a highly
pathogenic strain of ISA at 24 and 72 h post infection. We
first compared the complete catalog of differentially
BHMS313A
Ssa401UoS
BHMS546
BHMS553
BHMS177
Ssa0821BSFU
Ssa0130ECIG
Ssa0578BSFU
BHMS130
Omy301UoG
Ssa197DU
Atlantic salmon Chr15
Ctg386
Ctg1907


Ctg227
Ctg1180
Medaka LG24
15,000 k
25,000 k
3,500 k
2,500 k
0
17
23
31.4
34.7
45
53
Ctg620
Unit= centi-Morgan
Fig.1 Schematic representation
of the genetic map of Atlantic
salmon Chr15 (LG8) showing
the ISA QTL region identified
by Moen et al. (2004a, 2007)
and the corresponding syntenic
regions of medaka LG24
Table 3 Regions of fish genomes that are syntenic to the ISA QTL in Atlantic salmon based on similarity searches using the BAC end sequences
from contigs that contain genetic markers associated with ISA resistance (Moen et al. 2007)
ISA QTL markersMap positionContigTetraodon LG14Medaka LG24 Stickleback LGXVIII Zebrafish LG20
BHMS553
BHMS177
Ssa0130ECIG
Ssa0821BSFU
Ssa0578BSFU
BHMS130
30.4
30.4
30.4
30.4
34.7
34.7
386
1907
620
620
227
1180
9,450k–9,550k
9,550k–10,000k
9,970k–10,000k
9,970k–10,000k
10,200k–10,250k
8,350k–8,400k
15,600k–16,400k
15,600k–16,400k
23,300k–23,900k
23,300k–23,900k
23,700k–24,400k
2,700k–3,200k
13,200k–13,300k
15,800k–15,900k
12,700k–12,800k
12,700k–12,800k
16,000k–16,100k
2,500k–2,530k
39,500k–40,500k
29,700k–30,000k
29,500k–30,000k
29,500k–30,000k
26,200k–26,300k
56,400k–56,600k
236Mar Biotechnol (2011) 13:232–241

Page 6

regulated genes (Workenhe et al. 2009) with the list of
genes in the ISA resistance QTL putative syntenic region of
the tetraodon genome (LG14 position 8,350k–10,250 k) as
well as the corresponding region in the medaka genome
from 15,600k–24,400 k on LG24. The annotation of fish
genomes as well as the cDNAs on the cGRASP microarray
is an imprecise science as it is based on sequence
similarities primarily with mammalian genes. This is further
complicated by the relatively recent genome duplication in
the common ancestor of extant salmonids (Allendorf and
Thorgaard 1984). We therefore took a very liberal approach
when making our comparisons. For example, we consid-
ered galectin-3 and galectin-8 as being potential orthologs
of galectin-9 and included proteasome subunits irrespective
of them being classified as alpha or beta. The results of this
comparison are shown in Table 4. The tetraodon compar-
isons revealed 14 annotated genes that had a putative
ortholog identified as being differentially expressed from
the microarray experiments. These included four genes
classified as E3 ubiquitin-protein ligases (RNF8, RNF19B,
RNF217, and UBR7), three N-acetyl transferases (ESCO2,
NAT12, and NAT5), two tripartite motif-containing genes
(TRIM54 and TRIM67), two galectins (LGALS3 and
LGALS8), a single copy of a tetratricopeptide repeat
protein (TTC13), and two members of the proteasome
(26S protease regulatory subunit 4, PSMC1, and protea-
some subunit alpha type-6, PROS-27). We note that
galectin-9 was one of the four genes, along with 5-
lipoxygenase activating protein, cytochrome P450 2K4-I,
and annexin AI, which were sufficient for correct assign-
ment of individual salmon to early mortality, late mortality,
and uninfected groups (Jørgensen et al. 2008). Only three
of the 14 genes from the tetraodon selected gene list were
annotated in the corresponding region of the medaka
genome: TTC13, RNF217, and NAT5. The transcript
corresponding to TTC13 was increased 26.88-fold and
30.24 fold in TO cells infected with ISA at the 24 and
72-h post-infection time points, respectively. In contrast,
there was no significant increase in the abundance of
RNF217 transcripts in the TO cells after 24 h of infection,
but it rose 16.61-fold over that found in the control after
72 h of infection. The change in expression of NAT5 was
only observed in TO cells 72 h post infection with the
highly pathogenic ISAV isolate. We suggest that the genes
listed in Table 4, particularly TTC13, RNF217, and NAT5,
are worthy of further consideration as potential candidates
that could contain alleles that are causal for the ISA
resistance QTL. Furthermore, we suggest that they be
screened for polymorphisms that alter their expression
pattern as well as cause changes in their protein products.
Prediction of Candidate Genes for the ISA Resistance QTL
Based on Putative Functions of Their Protein Products
It is widely recognized that interferons and the products of
the genes they induce play a critical part in the innate
immunity system against viruses. Although more than 100
interferon-stimulated genes have been identified, to date,
Table 4 Genes, previously identified as being differentially expressed in ISA-infected salmon by microarray analysis from Workenhe et al. (2009), that
are annotated in the ISA QTL syntenic regions of the medaka and tetraodon genomes (Electronic Supplementary Material Tables 1 and 2, respectively)
Common nameTetraodon geneMedaka gene Fold increase at
24h post infection
Fold increase at
72h post infection
N-acetyltransferase (ESCO2)a
Tripartite motif-containing protein 67 (TRIM9-like protein)b
Tetratricopeptide repeat protein 13
E3 ubiquitin-protein ligase (RING finger protein 8)c
E3 ubiquitin-protein ligase (RING finger protein 19B)c
E3 ubiquitin-protein ligase (RING finger protein 217)c
N-acetyltransferase 12a
Galectin-3 (GALBP)d
Galectin-8 (Gal-8; PCTA-1)d
26S protease regulatory subunit 4 (P26s4 ATPase 1)e
Proteasome subunit alpha type-6 (PROS-27)e
Tripartite motif-containing protein 54 (MURF-3)b
N-acetyltransferase 5a
E3 ubiquitin-protein ligase UBR7 (N-recognin-7)c
ESCO2
TRIM67
TTC13
RNF8
RNF19B
RNF217
NAT12
LGALS3
LGALS8
PSMC1
PSMA6b
TRIM54
NAT5
UBR7
Not annotated
Not annotated
TTC13
Not annotated
Not annotated
RNF217
Not annotated
Not annotated
Not annotated
Not annotated
Not annotated
Not annotated
NAT5
Not annotated
Not significant
3.67–4.83
26.88
Not significant
Not significant
Not significant
Not significant
2.76–6.01d
2.76–6.01d
Not significant
Not significant
3.67–4.83
Not significant
Not significant
3.47f
5.40–14.4.1
30.24
16.61
16.61
16.61
3.47f
37.09–167.22
37.09–167.22
25.41
3.42–4.52
5.40–14.4.1
3.47f
16.61
The genes are listed in the order in which they occur in the tetraodon genome. Genes encoding proteins with the same function are identified by
the same superscript. We took a very liberal approach with annotation comparisons (e.g., we took galectin-3 and galectin-8 as being a potential
homolog of galectin-9 and proteasome subunits irrespective of them being alpha or beta). The fold increase results are with infection with a low
pathogenic ISAV isolate (RPC/NB-04-085-1) except forfN-acetyltransferase at 72 h post infection with a highly pathogenic ISAV isolate (NBISA01)
Mar Biotechnol (2011) 13:232–241 237

Page 7

Mx is the only one that has been shown to possess antiviral
properties (Haller et al. 2007; Robertsen 2008). It has been
shown that ISA is a powerful inducer of key genes of the
type I interferon system in Atlantic salmon, including Mx,
but the virus is not inhibited by the interferon-dependent
pathway or the presence of Mx prior to infection (Kiling et
al. 2007). Therefore, we considered what is known about
resistance to viruses in other systems and if this information
could be applied to identifying candidate genes for ISA
resistance in Atlantic salmon. Several genes have been
identified with allelic variation that influences HIV infec-
tion and disease progression (Heeney et al. 2006). Among
these are the tripartite motif-containing protein TRIM5α;
cytokines such as IL-10; coreceptor/ligands such as CCR5,
CCL2, CCL7, CCL11, and DC-SIGN; and components of
the adaptive immune response, namely, subtypes of HLA-
A, HLA-B, and HLA-C. Similarly, it has recently been
shown that the host genetic background strongly influences
the response of influenza A virus infections in mice,
although the molecular basis for this phenomenon has yet
to be identified (Srivastava et al. 2009). As indicated in the
review article by Beutler et al. (2007), it is quite feasible to
consider mutations arising in the host that confer virus
resistance by affecting some of the key steps in viral entry
into a cell, its replication, and ultimately its assembly and
spread to other cells. In the case of ISA resistance in
Atlantic salmon, it is possible that the allele(s) associated
with the QTL is in a gene(s) that is not directly involved in
the interferon response pathways. Moreover, a significant
change in the expression of the gene may not be required
for the effect to be realized. Therefore, we searched the
BioMart gene lists from the ISA resistance QTL putative
syntenic regions of the tetraodon and medaka genomes and
identified some potentially interesting genes whose products
have been discussed in the context of naturally occurring
mutations associated with viral resistance (Heeney et al.
2006; Beutler et al. 2007). The list of seven potential ISA
resistance candidate genes we wish to consider is given in
Table 5.
HDDC2 (NS5A-TP2) is an HD domain-containing
protein that is induced by the non-structural 5A (NS5A)
protein of hepatitis C virus (Yang et al. 2004). The hepatitis
C virus NS5A plays multiple roles in virus infection
including viral replication and cellular signaling pathways
(see MacDonald and Harris 2004 for review). It has been
suggested that hepatitis C virus resistance to interferon
could be explained by the ability of NS5A to bind to and
inhibit the dsRNA-activated, interferon-induced kinase
PKR (Gale et al. 1997). We speculate that variation in
proteins that are induced by NS5A, or its equivalent in
other single-stranded RNA viruses such as ISA, may be
associated with differential responses to viral infection, and
thus, HDDC2 (NS5A-TP2) becomes a candidate for the
Atlantic salmon ISA resistance QTL.
Toll/interleukin-1 receptor-like protein 5 (TLR5) is a
member of the Toll-like receptor (TLR) family (Akira et al.
2006). Recognition of specific ligands by TLRs induces
MyD88-dependent signaling via the Toll–IL-1 receptor
pathways, which activate dendritic cells and help induce
their differentiation into antigen presenting cells (Takeda et
al. 2003). Single-stranded RNA serves as a physiological
ligand for TLR7 and TLR8 (Heil et al. 2004; Diebold et al.
2004). TLR5 is generally thought to be involved in
flagellated bacterial pathogen detection (Hayashi et al.
2001), and a novel transcript encoding a soluble form of
TLR5 was observed in the liver of Atlantic salmon during
Aeromonas salmonicida infection (Tsoi et al. 2007). We
speculate that a variant of TLR5 in Atlantic salmon may
have become a ligand for ISAV and that this could explain
the ISA resistance QTL that occurs in Atlantic salmon.
HIV-EP2 is a member of the metal-finger protein family
that binds to the human immunodeficiency virus type 1
enhancer (Nomura et al. 1991). HIV-EP2 is expressed at
high levels in T cells, and its expression is induced by
Table 5 Candidate genes for ISA resistance in the QTL syntenic regions of the tetraodon and medaka genomes based on the predicted functions
of gene products
Common gene nameTetraodon gene Medaka gene
HD domain-containing protein 2 (hepatitis C virus
NS5A-transactivated protein 2)
Toll-like receptor 5 Precursor (Toll/interleukin-1
receptor-like protein 3)
Transcription factor HIVEP2 (HIV-EP2; MHC-binding
protein 2)(MBP-2))
Interleukin-1 receptor-associated kinase 1-binding protein 1
NF-kappa-B inhibitor alpha (MHC complex enhancer-binding
protein MAD3)
Feline leukemia virus subgroup C receptor-related protein 1
Interleukin-20 receptor alpha chain Precursor
(cytokine receptor class-II member 8)
HDDC2 HDDC2
TLR5TLR5
HIVEP2 HIVEP2
IRAK1BP1
NFKBIA
Not annotated in syntenic region
Not annotated in syntenic region
FLVCR1
Not annotated in syntenic region
Not annotated in syntenic region
IL20RA
238Mar Biotechnol (2011) 13:232–241

Page 8

mitogen and phorbol ester treatment, suggesting that it is
involved in the regulation of T cell growth. The transcrip-
tion factor HIV-EP2 also binds to the enhancer of the major
histocompatibility complex (MHC) class I genes, and thus,
it is also known as MHC-binding protein 2 (MBP-2; van’t
Veer et al. 1992). Related enhancer motifs to those of MHC
and HIVoccur in the regulatory regions of immunoglobulin
genes, the β2microglobulin gene, the interferon β gene,
and the interleukin 2 receptor gene. Therefore, changes in
the structure of HIV-EP2/MBP-2 may influence the
expression of several genes that have been implicated in
the response to infection by ISAV. It is noteworthy that
three of the microsatellite markers associated with the ISA
resistance QTL (BHMS177, Ssa0821BSFU, and Ssa0130-
CIG) map to the syntenic region in the medaka genome
where HIV-EP2/MBP-2 occurs (Fig. 2). We suggest that
HIV-EP2/MBP-2 is a very strong candidate for the gene
associated with ISAV resistance in Atlantic salmon and that
it is definitely worthy of further study.
Complex signaling pathways link the recognition of
pathogens by TLRs and the activation of the transcription
factor NF-κβ which regulates the expression of genes
essential for host defense and inflammation (Akira et al.
2006). We identified two genes in the Atlantic salmon ISA
resistance QTL syntenic region of the tetraodon genome
that are part of the NF-κβ regulatory pathway, namely,
interleukin receptor-associated kinase 1 binding protein 1
(IRAK1BP1) and NF-κβ inhibitor alpha (NFKBIA; Li and
Verma 2002). We suggest that allelic variation in one of
these genes that are involved in modulating the NF-κβ
signaling pathway could be responsible for variation in ISA
resistance in Atlantic salmon. Thus, they are worthy of
further investigation.
As mentioned above, it is possible that a mutation in
Atlantic salmon could confer ISA resistance by affecting a
key step in viral entry into a cell. It was interesting,
therefore, to find feline leukemia virus subgroup C
receptor-related protein 1 (FLVCR1) in the ISA resistance
QTL syntenic region of the tetraodon genome. The
preferred receptor for the feline leukemia virus subgroup
C, a γ-retrovirus, is a transporter involved in the export of
heme (Tailor et al. 2003). We speculate that mutations in
the Atlantic salmon FLVCR1 ortholog may be associated
with ISA resistance.
The final gene that we identified as a possible candidate
associated with the ISA resistance QTL in Atlantic salmon
is interleukin-20 receptor alpha chain (IL20RA), which was
observed in the ISA resistance QTL syntenic region of the
medaka genome but not in the corresponding region of the
tetraodon genome. IL20RA encodes one of the hetero-
dimers of the IL-20R complex through which Signal
Transducer and Activator of Transcription activation occurs
when bound to IL-19, IL-20, or mda-7 (Dumoutier et al.
2001). We speculate that signaling through the IL-20R
complex may provide an alternative mechanism for
activating a host defense against ISA in Atlantic salmon.

Fig. 2 A screenshot from www.asalbase.org that shows the annotated
genes and transcripts from 23,300k–23,900k of medaka LG24 as well
as the Atlantic salmon BAC end sequences that align with them. This
region also contains one of the microsatellites, BHMS177, associated
with the ISA resistance QTL (Moen et al. 2007) and three additional
markers, Ssa0821BSFU, Ssa0130ECIG, and Ssa0578BSFU, that are
tightly linked to BHMS177 (Danzmann et al. 2008; Phillips et al.
2009)
Mar Biotechnol (2011) 13:232–241239

Page 9

Conclusions
In the absence of a sequence for the Atlantic salmon
genome, we have taken a comparative genomics ap-
proach to identify candidate genes that may be associated
with the QTL for ISA that has been mapped to Chr 15
(Moen et al. 2004a, 2007). We recognize that we have
indulged in broad speculation in developing the list of
candidate genes given in Tables 4 and 5 but wish to point
out that even when a well-annotated genomic sequence
becomes available for Atlantic salmon, it will still be
necessary to identify candidate genes based on their
putative physiological functions and to test them in ISA-
resistant and susceptible families. Of course, having a
sequence of the Atlantic salmon genome should provide
additional genetic markers, which would allow finer
mapping of the QTL.
Acknowledgments
Canada, Genome British Columbia, and NSERC. We thank Evelyn
Davidson and Krzysztof Lubieniecki for the help with genotyping.
Funding for this work was provided by Genome
Open Access
Creative Commons Attribution Noncommercial License which per-
mits any noncommercial use, distribution, and reproduction in any
medium, provided the original author(s) and source are credited.
This article is distributed under the terms of the
References
Adzhubei AA, Vlasov AV, Hagen-Larsen H, Ruden TA, Laerdahl JK,
Høyheim B (2007) Annotated Expressed Sequence Tags (ESTs)
from pre-smolt Atlantic salmon (Salmo salar) in a searchable
data resource. BMC Genomics 8:209
Akira S, Uematsu S, Takeuchi O (2006) Pathogen recognition and
innate immunity. Cell 124:783–801
Allendorf FW, Thorgaard GH (1984) Tetraploidy and the evolution of
salmonids fishes. In: Turner BJ (ed) Evolutionary genetics of
fishes. Plenum Press, New York, pp 55–93
Beutler B, Eidenschenk C, Crozat K, Imler J-L, Takeuchi O,
Hoffmann JA, Akira S (2007) Genetic analysis of resistance to
viral infection. Nature Rev Immunol 7:753–766
Boroevich KA, Lubieniecki KP, Chow W, de Jong P, Schein J, Field
M, Moore R, de Boer JG, Koop BF, Davidson WS (2008)
Physical mapping and BAC-end sequence analysis of Atlantic
salmon BAC libraries. In: W282: large-insert DNA libraries and
their applications. Plant & Animal Genomes XVI Conference
(W282), San Diego, CA, 12–16 Jan 2008
Danzmann RG, Davidson EA, Ferguson MM, Gharbi K, Koop BF,
Hoyheim B, Lien S, Lubieniecki KP, Moghadam HK, Park J,
Phillips RB, Davidson WS (2008) Distribution of ancestral proto-
Actinopterygian chromosome arms within the genomes of 4R-
derivative salmonid fishes (Rainbow trout and Atlantic salmon).
BMC Genomics 9:557
de Boer JG, Yazawa R, Davidson WS, Koop BF (2007) Bursts and
horiozontal evolution of DNA transposons in the speciation of
pseudotetraploid salmonids. BMC Genomics 8:422
Diebold SS, Tsuneyasu K, Hemmi H, Akira S, Reis e Sousa C (2004)
Innate antiviral responses by means of TLR7-mediated recogni-
tion of single-stranded RNA. Science 303:1529–1531
Dumoutier L, Leemans C, Lejeune D, Kotenko SV, Renauld J-C
(2001) Stat activation by IL-19, IL-20 and mda-7 through IL-20
receptors of two types. J Immunol 167:3545–3549
Eliassen TM, Froystad MK, Dannevig BH, Jankowska M, Brech A,
Falk K, Romoren K, Gjoen T (2000) Initial events in infectious
salmon anemia virus infection: evidence for the requirement of a
low-pH step. J Virol 74:218–227
Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH (1997)
Characterization of infectious salmon anemia virus, an
orthomyxo-like virus isolated from Atlantic salmon (Salmo salar
L.). J Virol 71:9016–9023
Falk K, Aspehaug V, Vlasak R, Endresen C (2004) Identification and
characterization of viral structural proteins of infectious salmon
anemia virus. J Virol 78:3063–3071
Gale MJ, Korth MJ, Tang NM, Tan SL, Hopkins DA, Dever TE,
Polyak SJ, Gretch DR, Katze MG (1997) Evidence that hepatitis
C virus resistance to interferon is mediated through repression of
the PKR protein kinase by the nonstructural 5A protein. Virology
230:217–227
Gjoen HM, Refstie T, Ulla O, Gjerde B (1997) Genetic correlations
between survival of Atlantic salmon in challenge and field tests.
Aquaculture 158:277–288
Godoy MG, Aedo A, Kibenge MJ, Groman DB, Yason CV, Grothusen
H, Lisperguer A, Calbucura M, Avendanio F, Imilan M, Jarpa M,
Kibenge FS (2008) First detection, isolation and molecular
characterization of infectious salmon anemia virus associated
with clinical disease in farmed Atlantic salmon (Salmo salar) in
Chile. BMC Vet Res 4:28
Gross JB, Protas M, Conrad M, Scheid PE, Vidal O, Jeffrey WR,
Borowsky R, Tabin CJ (2008) Synteny and candidate gene
prediction using an anchored linkage map of Astyanax mexica-
nus. Proc Natl Acad Sci USA 105:20106–20111
Haller O, Staeheli P, Kochs G (2007) Interferon-induced Mx proteins
in antiviral host defense. Biochemie 89:812–818
Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Godltt DR, Eng
JK, Akira S, Underhill DM, Anderem A (2001) The innate
immune response to bacterial flagellin is mediated by Toll-like
receptor 5. Nature 410:1099–1103
Heeney JL, Dalgleish AG, Weiss RA (2006) Origin of HIV and the
evolution of resistance to AIDS. Science 313:462–466
Heil F, Hemmi H, Hochrein H, Ampenberger F, Kirschning C, Akira
S, Lipford G, Wagner H, Bauer S (2004) Species-specific
recognition of single-stranded RNA via Toll-like receptor 7 and
8. Science 303:1526–1529
Hellebo A, Vilas U, Falk K, Balzac R (2004) Infectious salmon
anemia virus specifically binds and hydrolyzes 4-O-acetylated
sialic acids. J Virol 78:3055–3062
Jaillon O, Aury JM, Brunet F et al (2004) Genome duplication in the
teleost fish Tetraodon nigroviridis reveals the early vertebrate
proto-karyotype. Nature 431:946–957
Johnstone KA, Lubieniecki KP, Chow W, Phillips RB, Koop BF,
Davidson WS (2008) Genomic organization and characterization
of two vomeronasal 1 receptor-like genes (ora1 and ora2) in
Atlantic salmon Salmo salar. Mar Genomics 1:23–31
Jørgensen SM, Hetland DL, Press CM, Grimholt U, Gjøen T (2007)
Effect of early infectious salmon anemia virus (ISAV) infection
on expression of MHC pathway genes and type I and II
interferon in Atlantic salmon (Salmo salar) tissues. Fish Shellfish
Immunol 23:576–588
Jørgensen SM, Afanasyev S, Krasnov A (2008) Gene expression
analyses in Atlantic salmon challenged with infectious salmon
anemia virus reveal differences between individuals with early,
intermediate and late mortality. BMC Genomics 9:179
Kibenge FSB, Munir K, Kibenge MJT, Joseph T, Moneke E (2004)
Infectious salmon anemia virus: causative agent, pathogenesis
and immunity. Anim Health Res Rev 5:65–78
240Mar Biotechnol (2011) 13:232–241

Page 10

Kiling Ø, Brundtland MI, Robertsen B (2007) Infectious salmon
anemia virus is a powerful inducer of key genes of the type I
interferon system of Atlantic salmon, but is not inhibited by
interferon. Fish Shellfish Immunol 23:378–389
Koop BF, von Schalburg KR, Leong J, Walker N, Lieph R, Cooper
GA, Robb A, Beetz-Sargent M, Holt RA, Moore R, Brahmbhatt
S, Rosner J, Rexroad CE III, McGowan CR, Davidson WS
(2008) A salmonid EST genomic study: genes, duplications,
phylogeny and microarrays. BMC Genomics 9:545
Krossoy B, Devold M, Sanders L, Knappskog PM, Aspehaug V, Falk
K, Nylund A, Koumans S, Endresen C, Biering E (2001) Cloning
andidentification oftheinfectioussalmonanemiahaemagglutinin.
J Gen Virol 82:1757–1765
Li Q, Verma IA (2002) NF-κβ regulation and the immune system. Nat
Rev Immunol 2:725–734
Lorenz S, Brenna-Hansen S, Moen T, Roseth A, Davidson WS,
Omholt SW, Lien S (2009) BAC-based upgrading and physical
integration of a genetic SNP map in Atlantic salmon. Anim
Genet 41:48–54. doi:10.1111/j.1365-2052.2009.01963.x
MacDonald A, Harris M (2004) Hepatitis C virus NS5A: tales of a
promiscuous protein. J Gen Virol 85:2485–2502
McBeath AJA, Snow M, Secombes CJ, Ellis AE, Collet B (2007)
Expression kinetics of interferon and interferon-induced genes in
Atlantic salmon (Salmo salar) following infection with infectious
pancreatic necrosis virus and infectious salmon anaemia virus.
Fish Shellfish Immunol 22:230–241
Moen T, Fjalestad KT, Munck H, Gomez-Raya L (2004a) A multi-stage
testing strategy for detection of quantitative trait loci affecting
disease resistance in Atlantic salmon. Genetics 167:851–858
Moen T, Hoyheim B, Munck H, Gomez-Raya L (2004b) A linkage
map of Atlantic salmon (Salmo salar) reveals an uncommonly
large difference in recombination rate between the sexes. Anim
Genet 35:81–92
Moen T, Sonesson AK, Hayes B, Lien S, Munck H, Meuwissen THE
(2007) Mapping of a quantitative trait locus for resistance against
infectious salmon anemia in Atlantic salmon (Salmo salar):
comparing survival analysis with analysis on affected/resistant
data. BMC Genet 8:53
Moen T, Hayes B, Baranski M, Berg PR, Kjoglum S, Koop BF,
Davidson WS, Omholt SW, Lien S (2008) A linkage map of the
Atlantic salmon (Salmo salar) based on EST-derived SNP
markers. BMC Genomics 9:223
Ng SH, Artieri CG, Bosdet IE, Chiu R, Danzmann RG, Davidson
WS, Ferguson MM, Fjell CD, Hoyheim B, Jones SJ, de Jong
PJ, Koop BF, Krzywinski MI, Lubieniecki K, Marra MA,
Mitchell LA, Mathewson C, Osoegawa K, Parisotto SE, Phillips
RB, Rise ML, von Schalburg KR, Schein JE, Shin H, Siddigui
A, Thorsen J, Wye N, Yang G, Zhu B (2005) A physical map
of the genome of Atlantic salmon, Salmo salar. Genomics
86:396–404
Nomura N, Zhao M-J, Nagase T, Maekawa T, Ishizaki R, Tabata S,
Ishii S (1991) HIV-EP2, a new member of the gene family
encoding the human immunodeficiency virus type 1 enhancer
binding protein. J Biol Chem 266:8590–8594
Phillips RB, Keatley KA, Morasch MR, Ventura AB, Lubieniecki KP,
Koop BF, Danzmann RG, Davidson WS (2009) Assignment of
Atlantic salmon (Salmo salar) linkage groups to specific chromo-
somes: conservation of large syntenic blocks corresponding to
whole chromosome arms in rainbow trout (Oncorhynchus
mykiss). BMC Genet 10:46
Quinn NL, Levenkova N, Chow W, Bouffard P, Boroevich KA,
Knight JR, Jarvie TP, Lubieniecki KP, Desany BA, Koop BF,
Harkins TT, Davidson WS (2008) Assessing the feasibility of GS
FLX pyrosequencing for sequencing the Atlantic salmon ge-
nome. BMC Genomics 9:404
Rimstad E, Mjaaland S (2002) Infectious salmon anemia virus: an
orthomyxovirus causing an emerging infection in Atlantic
salmon. APMIS 110:273–282
Rise ML, von Schalburg KR, Brown GD, Devlin RH, Mawer MA,
Kuipers N, Busby M, Beetz-Sargent M, Alberto R, Gibbs AR,
Hunt P, Shukin R, Zeznik JA, Nelson C, Jones SRM, Smailus
DE, Jones SJM, Schein JE, Marra MA, Butterfield YSN, Stott
JM, Ng SH, Davidson WS, Koop BF (2004) Development and
application of a salmonid EST database and cDNA microarray:
data mining and interspecific hybridization characteristics.
Genome Res 14:478–490
Robertsen B (2008) Expression of interferon and interferon-induced genes
in salmonids in response to virus infection, interferon-inducing
compounds and vaccination. Fish Shellfish Immunol 25:351–357
Rychlik W, Rhoads RE (1989) A computer program for choosing
optimal oligonucleotides for filter hybridization, sequencing and
in vitro amplification of DNA. Nucleic Acids Res 17:8543–8551
Sarropoulou E, Nousdili D, Magoulas A, Kotoulas G (2008) Linking
the genomes of nonmodel teleosts through comparative
genomics. Mar Biotechnol 10:227–233
Schiøtz BL, Jørgensen SM, Rexroad C, Gjøen T, Krasnov A
(2008) Transcriptomic analysis of responses to infectious
salmon anemia virus infection in macrophage-like cells. Virus
Res 136:65–74
Srivastava B, Blazejewska P, Heßmann M, Bruder D, Geffers R,
Mauel S, Gruber AD, Schughart K (2009) Host genetic
background strongly influences the response to influenza A virus
infections. PLoS ONE 4(3):e4857
Tailor CSD, Lavillette D, Marin M, Kabat D (2003) Cell surface
receptors for gammaretroviruses. Curr Top Microbiol Immunol
281:29–106
Takeda K, Kaisho S, Akira S (2003) Toll-like receptors. Annu Rev
Immunol 21:335–376
Thorsen J, Zhu B, Frengen E, Osoegawa K, de Jong PJ, Koop BF,
Davidson WS, Hoyheim B (2005) A highly redundant BAC
library of Atlantic salmon (Salmo salar): an important tool for
salmon projects. BMC Genomics 6:50
Thorud K, Djupvik HO (1988) Infectious anemia in Atlantic salmon
(Salmo salar L.). Bull Eur Assoc Fish Pathol 8:109–111
Tsoi S, Park KC, Kay HH, O’Brien TJ, Podor E, Sun G, Duglas SE,
Brown LL, Johnson SC (2007) Identification of a transcript
encoding a soluble form of toll-like receptor 5 (TLR5) in Atlantic
salmon during Aeromonas salmonicida infection. Vet Immunol
Immunopathol 109:183–187
Van’t Veer LJ, Lutz PM, Isselbacher KJ, Bernards R (1992) Structure
and expression of major histocompatibility complex-binding
protein 2, a 275-kDa zinc finger protein that binds to an enhancer
of major histocompatibility complex clas I genes. Proc Natl Acad
Sci USA 89:8971–8975
von Schalburg KR, Rise ML, Cooper GA, Brown GD, Gibbs RA,
Nelson CC, Davidson WS, Koop BF (2008) Fish and chips:
various methodologies demonstrate the utility of a 16,000-gene
salmonid microarray. BMC Genomics 6:126–144
Workenhe ST, Kibenge MJ, Wright GM, Wadowska DW, Groman DB,
Kibenge FS (2008) Infectious salmon anemia virus replication and
induction of alpha feron in Atlantic salmon erythrocytes. Virol J 5:36
Workenhe ST, Hori TS, Rise ML, Kibenge MJ, Kibenge FS (2009)
Infectious salmon anemia virus (ISAV) isolates induce distinct
gene expression responses in the Atlantic salmon macrophage/
dendritic-like cell line TO assessed using genomic techniques.
Mol Immunol 46:2955–2974
Yang Q, Cheng J, Liu Y, Hong Y, Wang JJ, Zhang SJ (2004) Cloning
and identification of NS5ATP2 gene and its spliced variant
transactivated by hepatitis C virus non-structural protein 5A.
World J Gastroenterol 10:1735–1739
Mar Biotechnol (2011) 13:232–241 241