Critical function of death-associated protein 3 in T cell receptor-mediated apoptosis induction.

Abstract

Death-associated protein 3 (DAP3) is crucial for promoting apoptosis induced by various stimulations. This report demonstrates that DAP3 is also important for T cell receptor (TCR)-mediated apoptosis induction in immature thymocytes. Enforced expression of DAP3 accelerated the negative selection in developing thymocytes, using the reaggregate thymus organ culture system. In addition, expression of DAP3 accelerated TCR-mediated apoptosis induction in DO11.10 cells. We also demonstrated that DAP3 translocates into the nucleus during TCR-mediated apoptosis in a Nur77 dependent manner. It is concluded that DAP3 is critical for TCR-mediated induction of apoptosis at the downstream of Nur77.

Full text

Page 1

Instructions for use
Title
Critical function of death-associated protein 3 in T cell
receptor-mediated apoptosis induction
Author(s)
Tosa, Noriko; Iwai, Atsushi; Tanaka, Taku; Kumagai, Tomoka;
Nitta, Takeshi; Chiba, Satoko; Maeda, Masahiro; Takahama,
Yousuke; Uede, Toshimitsu; Miyazaki, Tadaaki
Citation
Biochemical and Biophysical Research Communications,
395(3): 356-360
Issue Date2010-05-07
Doc URLhttp://hdl.handle.net/2115/43099
Right
Typearticle (author version)
Additional
Information
There are other files related to this item in HUSCAP. Check the
above URL.
Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP

Page 2

Critical function of death associated protein 3 in T cell
receptor-mediated apoptosis induction

Noriko Tosaa, Atsushi Iwaib, Taku Tanakac, Tomoka Kumagaic, Takeshi Nittad,
Satoko Chibab, Masahiro Maedae, Yousuke Takahamad, Toshimitsu Uedec, Tadaaki
Miyazakib,*

aInstitute for Animal Experimentation, Hokkaido University Graduate School of
Medicine, North-15, West-7, Kita-ku, Sapporo, Hokkaido, 060-8638, JAPAN;
bDepartment of Bioresources, Hokkaido University Research Center for Zoonosis
Control, Sapporo, Hokkaido, North-20, West-10, Kita-ku, Sapporo, Hokkaido,
001-0020, JAPAN;
cDivision of Molecular Immunology, Hokkaido University
Institute for Genetic Medicine, Sapporo, Hokkaido, North-15, West-7, Kita-ku,
Sapporo, Hokkaido, 060-0815, JAPAN; dDivision of Experimental Immunology,
Institute for Genome Research, University of Tokushima, 3-18-15 Kuramoto,
Tokushima, 770-8503, JAPAN;
eImmuno-Biological Laboratories Company
Limited, 1091-1 Naka, Fujioka, Gunma, 375-0005, JAPAN.

* Correspondence should be addressed to Tadaaki Miyazaki, Department of
Bioresources, Hokkaido University Research Center for Zoonosis Control,

Page 3

North-20, West-10, Kita-ku, Sapporo, Hokkaido 001-0020, JAPAN; Phone:
+81-11-706-7314, Fax: +81-11-706-7314, E-Mail: miyazaki@czc.hokudai.ac.jp

Abstract

Death associated protein 3 (DAP3) is crucial for promoting apoptosis induced by
various stimulations. This report demonstrates that DAP3 is also important for T cell
receptor (TCR)-mediated apoptosis induction in immature thymocytes. Enforced
expression of DAP3 accelerated the negative selection in developing thymocytes, using
the reaggregate thymus organ culture system. In addition, expression of DAP3
accelerated TCR-mediated apoptosis induction in DO11.10 cells. We also demonstrated
that DAP3 translocates into the nucleus during TCR-mediated apoptosis in a Nur77
dependent manner. It is concluded that DAP3 is critical for TCR-mediated induction of
apoptosis at the downstream of Nur77.

Keywords: apoptosis / death associated protein 3 / negative selection / Nur77 / T
cell receptor /
Abbreviations: IFN, interferon; NR box, nuclear receptor-interacting domain; WT,
wild-type; DN, dominant-negative form; RTOC, reaggregate thymus organ culture;
FADD, FAS-associated death domain protein

Page 4

Introduction

Negative selection is a quite important event for acquisition of self-tolerance by
elimination of self-reactive thymocytes [1, 2]. During T cell development, immature
CD4+CD8+ thymocytes undergo negative selection events based on the specificities of
the αβT cell receptor (TCR) complexes.
Death-associated protein 3 (DAP3) is ubiquitously expressed in various tissue
including the immune system, such as in the thymus of human and mice [3, 4]. DAP3 is
a GTP-binding protein that has been identified as a positive mediator in interferon
(IFN)-γ-induced cell death [5]. The gene of DAP3 encodes for a 46 kDa protein with a
potential P-loop motif, a potential nuclear receptor-interacting domain (NR box), and a
putative cleavage site for the N-terminal mitochondrial targeting sequence [5-7]. It has
been reported that mitochondrial DAP3 regulates cellular senescence though an
oxidative stress response [8]. Moreover, DAP3 is reportedly phosphorylated in an
Akt-dependent manner, correlating with the suppression of DAP3-facilitated apoptosis
in anoikis [9], and IFN-β promoter stimulator 1 (IPS-1) binds DAP3, resulting in
induced anoikis by caspase activation [10]. Although the accumulating evidence shows
that DAP3 plays roles in apoptosis induction, the role of DAP3 in thymocyte
development is still unknown.
An orphan nuclear receptor, Nur77, belonging to the steroid/thyroid hormone receptor

Page 5

superfamily, is a transcription factor responsible for inducing apoptosis [11]. Nur77 is
activated by various kinds of stimulation for apoptosis induction, and TCR stimulation
is known to be a potent activator of Nur77 transcription [12, 13]. A previous report
indicated that thymocytes from transgenic mice that express a dominant-negative form
of Nur77 (DN-Nur77) are protected from negative selection, and conversely transgenic
mice that express wild-type Nur77 exhibit promoted negative selection [14]. Therefore,
Nur77 is assumed to be an important factor in the development of thymocytes.
This study demonstrates the physiological importance of DAP3 on negative selection
of immature thymocytes. The data indicate that DAP3 is a critical factor for induction of
apoptosis induced by TCR stimulation at the downstream of Nur77.

Material and Methods

Antibodies
The specific antibodies used in this study, anti-DAP3 (Clone 10; BD Biosciences, San
Jose, CA), anti-Crk (clone 22; BD Biosciences), anti-Hsp60 (Clone LK-1; StressGen,
Victoria BC, Canada), anti-nucleoporin p62 (clone 53; BD Biosciences), anti-Nur77
(clone 12.14; BD Biosciences), anti-mouse CD3 antibody (clone 145-2C11; BD
Biosciences) and anti-mouse CD28 antibody (BD Biosciences) were purchased from
commercially available products.

Page 6

Cell Culture
The T cell hybridoma, DO11.10 cells were kindly provided by Dr. Makoto Iwata
(Tokushima Bunri University), and were cultured in RPMI 1640 supplemented with
10% heat-inactivated FCS (Sigma, St Louis, MO), 50 µM 2-mercaptoethanol (2-ME).

Preparation of Viral Supernatants for Infection
The pBabe-DN-Nur77 was kindly provided by Dr. Nobutaka Suzuki (Takeda
Pharmaceutical, Osaka, Japan) [15]. The retroviral vectors derived from
pMRX-IRES-EGFP to express wild type DAP3 (WT-DAP3) or its dominant negative
form (DN-DAP3) in TRAIL signal were constracted as shown in Supplemental Fig. 1.
To obtain the information of the construction and packaging of other retroviral vectors
used in this study, please refer to the Supplemental Materials and Methods.

Reaggregate Thymus Organ Culture (RTOC) System
Analysis of the subpopulations of retrovirus-infected thymocytes using the RTOC
system were carried out as described elsewhere [16]. Please refer to Supplemental
Materials and Methods for the detailed procedures for the use of this system.

Isolation of each population of thymocytes
CD4+CD8+ double positive cells were purified from freshly isolated thymocytes of

Page 7

C57BL/6 mice (5 weeks of age; Japan SLC, Hamamatsu, Japan) by the panning method
[17], and the other populations of thymocytes were prepared by using a magnetic cell
sorting system (MidiMACS Separator; Miltenyi Biotec, Bergisch Gladbach, Germany)
according to the manufacturer’s protocols. All protocols for experiments on animals
were approved by Committee on Animal Experimentation, Graduate School of
Medicine, Hokkaido University.

Flow Cytometry
For the flow cytometric analysis, cells were stained with phycoerythrin (PE)-anti-CD4
(RM4-4; BD Biosciences) and Allo-phycocyanin (APC)-anti-CD8 (53-6.7; BD
Biosciences). For detection of apoptosis, DO11.10 cells were stained with
FITC-annexin V (Roche, Mannheim, Germany) or PE-annexin V (BD Biosciences), and
propidium iodide (PI; Sigma). Flow cytometric analysis was carried out by using
FACScan (Beckton Dickinson, Lincoln Park, NJ) and analyzed with CELLQuest
software (Becton Dickinson).

Semi-quantitative RT-PCRs
Total RNA was extracted from the thymocytes using TRIzol (Invitrogen, Carlsbad,
CA). The reactions of the reverse-transcription were performed by Superscript II RT
(Invitrogen) using random oligonucleotide hexamers. Each procedure was carried out

Page 8

according to the manufacturer's protocols. The following primer set for the mouse
DAP3 gene was used in this study: 5’- GCAAGACATGACTGGCTGAT -3’ and 5’-
TGTGGACAAGGGAGAGTTCC -3’.

Cell fractionation
Nuclear fractionation experiments were performed using the Nuclear/Cytosol
fractionation Kit (BioVision, Mountain View, CA). Fractionation experiments of the
cytosol and mitochondria fractions were carried out using an ApoAlert Cell
Fractionation kit (Clontech, Palo Alto, CA). Each procedure was performed in
accordance with the manufacturer’s instructions.

Results and discussion

DAP3 is critical for negative selection.
To understand DAP3 functioning on T cell development in the thymus, the DAP3
expression in each population of thymocytes was initially analyzed by RT-PCR analysis
(Fig. 1A). Here, DAP3 was shown to be expressed in CD4+CD8+ double positive cells,
CD4+ single positive cells, and in CD8+ single positive cells, but not in CD4-CD8-
double negative cells; CD4+CD8+ double positive cells are known to be screened
against autoreactivity during development in the thymus. The results suggest that DAP3

Page 9

is involved in the development of thymocytes in the negative selection in the thymus.
To investigate whether DAP3 expression is changed by TCR stimulation during
negative selection, an in vitro stimulation assay which mimics negative selection was
performed. Thymocytes were stimulated with anti-CD3 and anti-CD28 antibodies,
subsequently expression of DAP3 was analyzed by immunoblotting. As shown in Fig.
1B, the DAP3 expression in thymocytes was not significantly changed by anti-CD3 and
anti-CD28 antibody stimulation. These results suggest that DAP3 is expressed in
thymocytes throughout the negative selection.
Next, the functional role of DAP3 expression in CD4+CD8+ double positive cells was
investigated. Thymocytes expressing DAP3 by the infection of a retrovirus vector were
analyzed using an RTOC system. The RTOC system provides a model in which the
cellular interactions required for T cell development can be studied under controlled in
vitro conditions [18]. The DAP3-expressed retroviral vectors were infected to total
thymocytes which were isolated from mice, and then the thymocytes were cultured in
RTOC. Under this condition, retroviral infection occurs predominantly in the
CD4+CD8+ double positive subpopulation [16]. After culturing in RTOC, the
thymocytes were analysed by flow cytometry. The retrovirus infected cells were
detected by the fluorescence of the enhanced green fluorescent protein (EGFP) which is
carried with the retrovirus vector as a marker protein. The results show that the
population of CD4+CD8+ double positive cells expressing DAP3 by the infection of

Page 10

pMRX-IRES-EGFP -WT-DAP3 decreased significantly (P<0.005) when compared with
that of the empty vector, pMRX-IRES-EGFP (Fig. 1C, D). In addition, the number of
CD4+CD8+ double positive cells expressing DAP3 were dramatically lower when
compared with that of empty vector integrated cells, whereas the number of CD4+ single
positive cells and CD8+ single positive cells was not significantly changed (Fig. 1E).
These findings suggest that the expression of DAP3 enhances TCR-mediated induction
of apoptosis during negative selection.

DAP3 expression promotes TCR-mediated apoptosis.
To investigate whether the decrement in double positive cells determined by the RTOC
system were caused by apoptosis induced by TCR stimulation during the negative
selection, the effects of the DAP3 expression on the TCR-mediated apoptosis induction
in DO11.10 cells hybridomas were analyzed. The retroviral vectors which express wild
type DAP3 (WT-DAP3) or the dominant negative form of DAP3 (DN-DAP3) were
infected to DO11.10 cells, and then the cells were stimulated by anti-CD3 antibody.
After a 24 hour post-stimulation incubation period, the cells were stained by PI or
Annexin-V, and apoptotic cells were defined as Annexin-V+ cells (Fig. 2A). The results
show that the number of apoptotic cells induced by the expression of WT-DAP3 was
significantly (P<0.005) higher than that of the control cells after anti-CD3 antibody
stimulation (Fig. 2B). In addition, the number of apoptotic cells induced by the

Page 11

expression of DN-DAP3, was significantly (P<0.005) fewer than that of the WT-DAP3.
Different from this, the results of unstimulated cells indicate that only very few
apoptotic cells were detected in either WT-DAP3 or DN-DAP3 expressed cells,
suggesting that spontaneous induction of apoptosis was not affected by the enforced
expression of DAP3. These results indicate that DAP3 expression accelerates
TCR-mediated apoptosis induction.

DAP3 is moved into the nucleus by TCR stimulation.
The subcellular localization of DAP3 is mainly observed in mitochondria; however, a
previous report indicated that DAP3 is also functional in cytoplasm. Further, our own
preliminary data using the hepatocellular carcinoma cell line, Hep3B, suggested that
DAP3 is also localized in the nucleus during the progress of apoptosis induced by the
stimulation of TRAIL (data not shown). To fully elucidate this, the subcellular
localization of DAP3 in DO11.10 cells after anti-CD3 antibody stimulation was
analyzed. Anti-Crk, anti-Hsp60, and anti-nucleoporin p62 antibodies were used as
marker proteins for the cytosol fraction, the mitochondria fraction, and nucleus fraction,
respectively [19-21]. The results show DAP3 is detected in the cytosol and mitochondria
fraction, but only a little in the nucleus fraction in the cells before anti-CD3 antibody
stimulation (Fig. 3). The DAP3 expression was increased in the nucleus fraction 4 hours
after the anti-CD3 antibody stimulation. These data suggest that DAP3 translocated to

Page 12

the nucleus in DO11.10 cells after the anti-CD3 antibody stimulation.
It has been reported that Nur77, an orphan nuclear receptor, is required for
TCR-mediated apoptosis in immature thymocytes undergoing negative selection steps
[12, 13], and the subcellular localization of Nur77 in DO11.10 cells after anti-CD3
antibody stimulation was analyzed. As shown in Fig. 3, a little hyper-phosphorylated
Nur77 (80 kDa) and hypo-phosphorylated Nur77 (70 kDa) were slightly detected in the
cytosol and mitochondria fraction at 1 hour, and in the peak level at 2 hours after
anti-CD3 antibody stimulation. Hypo-phosphorylated Nur77 in the nucleus fraction was
detected at 2 hours as weak signals and peaked at 4 hours after stimulation. These
results indicate that the subcellular localization changes of Nur77 after anti-CD3
antibody stimulation closely resemble DAP3, suggesting that DAP3 is functionally
associated with Nur77 on TCR mediated apoptosis.

Nur77 is necessary for nuclear transport of DAP3.
The DN-Nur77 expressed retroviral vector was infected to DO11.10 cells, and the
retrovirus vector-integrated cells were selected in medium containing 2 µg/ml
puromycin. As shown in Fig. 4A, DN-Nur77 protein was well expressed in DO11.10
cells infected with the retrovirus vector. The retroviral vector infected DO11.10 cells
were then stimulated with anti-CD3 antibody. After 24 hours, the apoptotic cells were
evaluated by PI and Annexin V staining. In agreement with the findings of the previous

Page 13

study, the results show that the population of apoptotic cells was significantly decreased
in DN-Nur77 expressed DO11.10 cells, by a comparison with empty vector infected
cells (Fig. 4B). Next, we investigated whether the translocation of DAP3 to the nucleus
is affected by the expression of DN-Nur77. As shown in Fig. 4C, the data showed that
the amount of nuclear localized DAP3 protein is significantly decreased by the
expression of DN-Nur77. These data suggested that translocation of DAP3 to the
nucleus depends on the activation of Nur77 during the course of TCR-mediated
apoptosis.
Recruitment of FAS-associated death domain (FADD) followed by activation of
caspase-8 is thought to be a major molecular mechanism on the DAP3-mediated
induction of apoptosis. However, previous studies have shown that FADD [22] and
caspase-8 [23] are not always necessary for negative selection of thymocytes. Thus,
these molecules can be ruled out in the molecular mechanism of the DAP3-mediated
signaling pathway for the induction of apoptosis against immature thymocytes induced
by TCR stimulation. In agreement with the previous observations, our data for
DN-DAP3 which lacks FADD binding domain also suggests that FADD independent
pathway is involved in DAP3 mediated acceleration of negative selection. As shown in
Fig. 2, although significantly lower induction of apoptosis was observed in the
DN-DAP3 expressed DO11.10 cells after the anti-CD3 antibody stimulation compared
with the WT-DAP3 expressed cells, DN-DAP3 did not inhibit the apoptosis by

Page 14

comparison with the empty vector infected cells. In addition, same results were obtained
using the DN-DAP3 expressed thymocytes in RTOC system (supplemental Fig. 2). In
conclusion, the data presented here suggest that there is an unknown pathway for
apoptosis induction mediated by DAP3 independent of the FADD and caspase-8
dependent pathway.
This report shows that Nur77 is crucial for nuclear translocation of DAP3 in the
apoptosis induced by TCR stimulation. It is known that DAP3 has a NR box-like
structure which is located close to the N-terminal side of the P-loop motif [7]. Therefore,
it is likely that Nur77 directly binds to DAP3 and transports DAP3 into the nucleus.
Although the data presented here suggest that nuclear translocation of DAP3 is
important for TCR induced apoptosis, molecular function of DAP3 in the nucleus for
apoptosis induction is still not clearly established. Further work is required for
understanding the physiological importance of the nuclear translocation of DAP3, and
the functional relationship between DAP3 and Nur77 in the induction of TCR-mediated
apoptosis.

References

[1] E. Palmer, Negative selection--clearing out the bad apples from the T-cell
repertoire, Nat. Rev. Immunol. 3 (2003) 383-391.

Page 15

[2] T.K. Starr, S.C. Jameson, K.A. Hogquist, Positive and negative selection of T
cells, Annu. Rev. Immunol. 21 (2003) 139-176.
[3] T. Berger, M. Brigl, J.M. Herrmann, V. Vielhauer, B. Luckow, D. Schlondorff, M.
Kretzler, The apoptosis mediator mDAP-3 is a novel member of a conserved
family of mitochondrial proteins, J. Cell Sci. 113 ( Pt 20) (2000) 3603-3612.
[4] T. Hirota, K. Obara, A. Matsuda, M. Akahoshi, K. Nakashima, K. Hasegawa, N.
Takahashi, M. Shimizu, H. Sekiguchi, M. Kokubo, S. Doi, H. Fujiwara, A.
Miyatake, K. Fujita, T. Enomoto, F. Kishi, Y. Suzuki, H. Saito, Y. Nakamura, T.
Shirakawa, M. Tamari, Association between genetic variation in the gene for
death-associated protein-3 (DAP3) and adult asthma, J. Hum. Genet. 49 (2004)
370-375.
[5] J.L. Kissil, L.P. Deiss, M. Bayewitch, T. Raveh, G. Khaspekov, A. Kimchi,
Isolation of DAP3, a novel mediator of interferon-gamma-induced cell death, J.
Biol. Chem. 270 (1995) 27932-27936.
[6] C.J. Morgan, C. Jacques, F. Savagner, Y. Tourmen, D.P. Mirebeau, Y. Malthiery,
P. Reynier, A conserved N-terminal sequence targets human DAP3 to
mitochondria, Biochem. Biophys. Res. Commun. 280 (2001) 177-181.
[7] S.M. Hulkko, H. Wakui, J. Zilliacus, The pro-apoptotic protein death-associated
protein 3 (DAP3) interacts with the glucocorticoid receptor and affects the
receptor function, Biochem. J. 349 Pt 3 (2000) 885-893.