A mutation in the FOXE3 gene causes congenital primary aphakia in an autosomal recessive consanguineous Pakistani family.

Abstract

Aphakia is the complete absence of any lens in the eye, either due to surgical removal of the lens as a result of a perforating wound or ulcer, or due to a congenital anomaly. The purpose of this study was to elucidate the molecular genetics for a large consanguineous Pakistani family with a clear aphakia phenotype.
The initial homozygosity screening of the family was extended to all the known autosomal recessive cataract loci in order to exclude the possibility of surgical cataract removal leading to aphakia. The screening was performed using polymorphic nucleotide repeat markers, followed by DNA sequencing of a possible candidate gene, the forkhead box protein E3 gene (FOXE3). The identified mutation was counter-checked by a diagnostic restriction enzyme digest of all the family members, and an analysis of the normal population.
The initial homozygosity screening of 13 known autosomal recessive loci resulted in negative LOD (logarithm of odds) scores. The aphakia phenotype suggested a mutation in FOXE3 close to the AR-locus 1p34.3-p32.2, and sequence analyses revealed the nonsense mutation c.720C>A, changing cysteine 240 to a stop codon. Segregation in the family was shown by diagnostic restriction enzyme digest, and marker analysis of another aphakia family from Madagascar carrying the same mutation excluded the presence of a founder mutation. Clinical re-examination of the family was not possible due to the escalating security concerns and internal displacement of the population in this region of Pakistan which has prevailed for many months.
FOXE3 is responsible for the early developmental arrest of the lens placode, and the complete loss of a functional FOXE3 protein results in primary aphakia. It can also be deduced that this mutation is quite primitive in origin since the same mutation is responsible for the same phenotypic outcome in two families of geographically different descent.

Full text

Page 1

A mutation in the FOXE3 gene causes congenital primary aphakia
in an autosomal recessive consanguineous Pakistani family
Iram Anjum,1,2 Hans Eiberg,3 Shahid Mahmood Baig,1 Niels Tommerup,2,3 Lars Hansen2,3
1Human Molecular Genetics Laboratory, Health Biotechnology Division, National Institute for Biotechnology & Genetic
Engineering (NIBGE), Faisalabad, Pakistan; 2The Wilhelm Johannsen Centre for Functional Genome Research, ICMM, Panum
Institute, University of Copenhagen, Blegdamsvej 3b, DK-2200 Copenhagen N, Denmark; 3Section IV, Department of Cellular and
Molecular Medicine, The Panum Institute, University of Copenhagen, Blegdamsvej 3b, DK-2200 Copenhagen N, Denmark
Purpose: Aphakia is the complete absence of any lens in the eye, either due to surgical removal of the lens as a result of
a perforating wound or ulcer, or due to a congenital anomaly. The purpose of this study was to elucidate the molecular
genetics for a large consanguineous Pakistani family with a clear aphakia phenotype.
Methods: The initial homozygosity screening of the family was extended to all the known autosomal recessive cataract
loci in order to exclude the possibility of surgical cataract removal leading to aphakia. The screening was performed using
polymorphic nucleotide repeat markers, followed by DNA sequencing of a possible candidate gene, the forkhead box
protein E3 gene (FOXE3). The identified mutation was counter-checked by a diagnostic restriction enzyme digest of all
the family members, and an analysis of the normal population.
Results: The initial homozygosity screening of 13 known autosomal recessive loci resulted in negative LOD (logarithm
of odds) scores. The aphakia phenotype suggested a mutation in FOXE3 close to the AR-locus 1p34.3-p32.2, and sequence
analyses revealed the nonsense mutation c.720C>A, changing cysteine 240 to a stop codon. Segregation in the family was
shown by diagnostic restriction enzyme digest, and marker analysis of another aphakia family from Madagascar carrying
the same mutation excluded the presence of a founder mutation. Clinical re-examination of the family was not possible
due to the escalating security concerns and internal displacement of the population in this region of Pakistan which has
prevailed for many months.
Conclusions: FOXE3 is responsible for the early developmental arrest of the lens placode, and the complete loss of a
functional FOXE3 protein results in primary aphakia. It can also be deduced that this mutation is quite primitive in origin
since the same mutation is responsible for the same phenotypic outcome in two families of geographically different descent.
Primary congenital aphakia is a rare congenital disorder
that has been classified histologically into primary and
secondary forms. Primary aphakia appears due to the early
developmental arrest of the lens placode leading to the
complete absence of the lens, while secondary aphakia is
observed in cases where the lens is formed initially but is
subsequently resorbed perinatally (OMIM 610256). The
phenotypic outcome is quite diverse in these two forms
because of the different stages of onset. In primary aphakia,
the missing lens formation leads to severe congenital eye
malformations, including aplasia of the interior eye segment,
whereas secondary aphakia leads to less severe ocular defects.
Primary congenital aphakia is known to be caused by
mutations in the forkhead box protein E3 (FOXE3) gene in
both humans and mice [1-6]. FOXE3 is a member of the
forkhead family of genes; more than 40 FOX genes are known
in the human genome and they are transcription factors
characterized by an 80–100 amino acid DNA binding
Correspondence to: Lars Hansen, Section IV, Department of Cellular
and Molecular Medicine, The Panum Institute, University of
Copenhagen, Blegdamsvej 3, DK-2200 Copenhagen N, Denmark;
Phone: +45 35327825; FAX: +45 35327845; email: lah@sund.ku.dk
forkhead motif. The human FOXE3 maps to chromosome
1p33, and was initially named FREAC-8 (forkhead-related
activator 8) or FKHL12 (forkhead, drosophila, homolog-like
12) [7]. The Fox proteins exhibit very high functional
diversity, and are involved in very early key developmental
processes, including the formation of the notochord and the
establishment of the body axis, carnio-pharyngeal
development, hair development, hearing, and speech and
language [8], and several Fox proteins have been shown to be
expressed during eye development [9]. The function of
FOXE3 in lens development has been extensively studied in
mice where homozygous null mutations result in congenital
aphakia with the absence of lens development [1,2,10,11]. In
humans, homozygous FOXE3 mutations have been associated
both with recessive inherited congenital primary aphakia [3,
4], and the dominant inheritance of ocular dysgenesis,
cataracts and Peters’ anomaly [5,6]. Here, we report the
characterization of a FOXE3 mutation identified in a
consanguineous Pakistani family that results in primary
congenital aphakia.
METHODS
Biologic sample: A large inbred family with congenital
primary aphakia was ascertained from a remote village of
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>
Received 19 January 2010 | Accepted 24 March 2010 | Published 30 March 2010
© 2010 Molecular Vision
549

Page 2

Pakistan (Basti Moza Kotla Mosa, District Bahawalpur, South
Punjab) having many affected individuals. The mode of
inheritance as evident from the segregation of disease alleles
in the pedigree was autosomal recessive. Venous blood
samples were collected from fifteen members of the family,
depending on their availability and willingness to participate
in the study. Genomic DNA was extracted following the
standard phenol:chloroform method.
STS marker analysis: All known autosomal recessive cataract
loci were enlisted (Table 1) and initially screened using two
or more STS (Sequence-Tagged-Site) marker systems for
each locus in order to exclude the possibility of cataract
involvement in the phenotype. A 3-primer STS marker
protocol was developed for the fragment analyses using
ABI3130XL and GeneMapper 3.0 technology (Applied
Biosystems, Foster City, CA). The 3-primer labeling system
uses a FAM labeled primer (FAM-TGA CCG GCA GCA
AAA TT), and the identical primer sequence was added 5′ to
one of the genome specific PCR primers. All oligonucleotides
were purchased from TAG Copenhagen (Copenhagen,
Denmark). Briefly, for the 3-primer protocol, the primer
concentrations were: FAM-primer 0.8 μM, forward extended
primer 0.1 μM, and reverse primer 0.25 μM applying standard
PCR conditions using Ampliqon III Taq polymerase
(Ampliqon, Copenhagen, Denmark). The PCR conditions
were as follows: pre-denaturation 95 °C, 10 min; then 30
cycles 95 °C, 1 min; 60 °C (or specific annealing temperature
tested by temperature gradient), 1 min; 72 °C, 1 min followed
TABLE 1. LIST OF AUTOSOMAL RECESSIVE CATARACT LOCUS AND STS MARKERS.
Locus position
1p34.3-p32.2
1q21.1
3p22–24.2
6p24.2
9q13-q22
14q24.3
16q22.1
19q13
19q13.33
20p12.1
22q11.23
22q12.1
21q22.3
Markers selected
D1S255, D1S2892, D1S197
D1S442, D1SGJA5-GJA8*
D3S1298
D6S470, D6S1034
D9S768, D9S152
D14S986, D14S1025, D14S1047, D14S273
D16S3019, D16S3086, D16S421, D16S3107, D16S3095
D19S416
D19S246
D20S860
D22S421
D22S315, D22S1167
D21S1411, D21S1890, D21S1885
Gene
Unknown
GJA8 (CX50)
Unknown
GCNT2
CAAR
CHX10
HSF4
Unknown
LIM2
BFSP1
CRYBB3
CRYBB1
CRYAA
Ethnicity
Pakistan
South India
Arab
Arab
Pakistan
Turkey, UAE
Pakistan, China, Tunisia
Pakistan
Iraqi Jewish
India
Reference
[13]
[14]
[15]
[16]
[17]
[18]
[17,19]
[20]
[21]
[22]
[23]
[24]
[25]
Israel
Jewish Persian
TABLE 2. PCR SEQUENCING PRIMERS FOR FOXE3.
Forward primer
FOXE3_ex1.1f TGTCCATATAAAGCGGGTCG
FOXE3_ex1.2f TTCTCTGGCTTCCCTGCC
FOXE3_ex1.3f AAGCCGCCCTACTCGTACAT
FOXE3_ex1.4f TTCATCACCGAACGCTTTGC
FOXE3_ex1.5f AAGGGCAACTACTGGACGCT
FOXE3_ex1.6f TCTGTTCAGCGTCGACAG
Reverse primer
FOXE3_ex1.1r ATGTACGAGTAGGGCGGCTT
FOXE3_ex1.2r TCGGTGATGAAGCGGTAGAT
FOXE3_ex1.3r TCGTTGAGCGTGAGATTGTG
FOXE3_ex1.4r AGGAAGCTGCCGTTGTCGAA
FOXE3_ex1.5r TAGCTCCGGCTGCAGGTT
FOXE3_ex1.6r CAGGTCGCACAGGTGCC
PCR length
298 bp
272 bp
170 bp
185 bp
267 bp
351 bp
TABLE 3. STS MARKERS USED FOR FINE MAPPING OF THE HOMOZYGOUS REGION AT 1P33.
STS marker
D1S496
D1S2729
D1S255
D1S2892
D1S2130
FOXE3
D1S2720
D1S197
D1S2652
D1S2890
Physical position chromosome 1 (hg18)
35,179,917
36,843,493
37,422,301
39,963,503
41,590,073
47,654,331 - 47,656,311
47,680,375
50,523,064
55,239,419
57,645,988
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
550

Page 3

by 8 cycles 95 °C, 1 min; 50 °C, 1 min; and 72 °C, 1 min. Total
PCR volumes were adjusted to 12 μl using 10–20 ng template
DNA. Two point LOD scores were calculated using the
LIPED program [12].
DNA sequencing of FOXE3: This gene consists of a single
exon and was sequenced for genomic variants by PCR
amplification using overlapping sets of primers (Table 2)
covering the coding region. This was followed by direct DNA
sequencing on ABI3130 XL using BigDye ver1.1 technology
(Applied Biosystems). The sequences were checked for
possible variants using ChromasPro (Technelysium Pty Ltd.,
Tewantin, Australia) by alignment to the reference sequences
(GenBank NM_012186 and NP_036318). The sequencing
primers were purchased from TAG Copenhagen, and the Taq
DNA polymerases from Qiagen (Hilden, Germany) and
Invitrogen (Carlsbad, CA). The PCR products were analyzed
Figure 1. Pedigree and haplotype
analysis of CT1. A: The pedigree of
family CT1 shows a high degree of
consanguinity in 7 generations. Two
haplotypes are represented in the
pedigree; the spouse CT1–14 carries the
identical mutation and shares the
identical haplotype distal to the FOXE3
gene. The two haplotypes are shown as
black or black and gray. Symbols: open
circles or squares
individuals, filled symbols represent
affected individuals and half filled
symbols represent
Restriction enzyme digests of all the
family members where DNA was
available demonstrate the segregation of
the mutation with the disease in the
family. The restriction enzyme DdeI
recognizes the mutation and cleaves the
204 bp band into two fragments of 131
bp and 73 bp. An additional 75 bp band
is observed in all individuals.
are healthy
carriers. B:
TABLE 4. LOD SCORE FOR FOXE3 MUTATIONS AND MARKERS.
STS marker θ
Order 0.0
D1S21302.40
c.720C>A6.62
D1S27201.60
Mut p=0.001
0.01
2.30
6.50
1.60
0.05
2.00
6.00
1.40
0.1
1.70
5.35
1.10
0.2
1.00
3.97
0.70
0.3
0.50
2.51
0.40
0.4
0.10
1.10
0.10
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
551

Page 4

by 2% agarose gel-electrophoresis, 1× TBE and the DNA was
stained with ethidium bromide.
Restriction enzyme digest: The mutation was counter-
confirmed using a restriction enzyme digest with DdeI (New
England Biolabs, Ipswich, MA) of the PCR product generated
by the primer pair FOXE3–1.6 (Table 2) under standard
conditions in a volume of 20 µl, and the cleaved products were
analyzed by 2% agarose gel-electrophoresis, 1× TBE and the
DNA was stained with ethidium bromide.
RESULTS AND DISCUSSION
All the available DNA samples for family CT1 were
genotyped for all possible autosomal recessive cataract loci
(Table 1) in order to rule out the possibility of cataract
involvement in the resulting aphakic eyes. Initial
homozygosity was traced on chromosome 1p33 by STS
markers D1S255, D1S2892, and D1S197. Haplotype analysis
based on more adjacent markers revealed several
polymorphisms throughout the family which helped to
identify a narrow conserved region around the FOXE3 gene
(Table 3 and Figure 1A). All the affected individuals
presented homozygous alleles except for individuals CT1–7
and CT1–8, whereas the phenotypically normal individuals
were either carriers of heterozygous alleles or homozygous.
Interestingly, part of the disease haplotype was even brought
in from outside the main kindred by CT1–14, suggesting that
either the carrier was related to the CT1 family, or that disease
carriers are highly prevalent in the region. Individual CT1–14
carried the identical disease haplotype proximal to the FOXE3
locus but a different haplotype distal to the FOXE3 locus
(Figure 1A), which suggested a recombination between the
FOXE3 locus and the marker D1S2130 (see Table 3). LOD
score calculations both for the FOXE3 mutation and the two
STS markers (Table 4) demonstrated positive LOD scores,
with a maximum of Z=6.62 at θ=0.0 for the FOXE3 mutation.
Sequencing of the coding region of FOXE3 in one
affected individual using overlapping primer pairs (Table 2)
revealed a C>A single base substitution (c.720C>A) leading
to a nonsense mutation in the cysteine 240 codon (p.Cys240X)
as the underlying genetic cause of the disease phenotype. The
restriction enzyme DdeI (recognition site 5′-CTNAG-3′) was
chosen to confirm the mutation which cleaves the wild type
allele of 204 bp into fragments of 73 bp and 131 bp,
respectively. Restriction enzyme cleavage of the family
demonstrated segregation of the mutation with the disease
trait, and carriers were heterozygote for the wild type and the
mutant alleles (Figure 1B) confirming the recessive mode of
inheritance adopted by mutation.
The identical mutation was first reported in an inbred
family from Madagascar [3]. Presenting the same underlying
mutation, both families share the same phenotype showing the
complete absence of the lens (Figure 2). Marker analyses were
set for one individual from each of the families to see if the
shared FOXE3 mutation originated from the same ancestral
founder. No informative SNPs were found in the nearby
vicinity of FOXE3 locus, and so several STS markers in the
region were analyzed in one affected person from each family.
The haplotype analysis demonstrated different haplotypes
segregating in the two families (Figure 3B). As a consequence,
it is very likely that the p.C240X mutation occurred
independently in the two families.
The expression of the FOXE3 gene is limited to the lens,
but mutations in FOXE3 result in various ocular phenotypes
leading either to dominant or recessive inheritance [3-6].
Figure 2. The individual CT1–11
showing complete congenital primary
aphakia.
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
552

Page 5

Mutations in FOXE3 have been reported in 8 families so far,
including CT1 and a total of 7 different mutations have been
identified (Figure 3C). Four mutations characterized in
families with dominant inheritance are reported in
combination with Peters’ anomaly, cataract and other ocular
dysgenesis [4-6], and four families, including CT1, manifest
recessive inheritance in association with the more severe
phenotype primary aphakia [3,4].
All carriers in family CT1 were healthy as reported
previously for the three other recessive families [3,4]. This
suggests the pathogenic nature to be a null mutation with loss
of function rather than haploinsufficiency as suggested earlier
[4,5]. Unfortunately, it has not been possible to re-examine
the CT1 family after identification of the mutation as a result
of escalating security concerns, and internal displacement of
the population in the region of Pakistan where the family
resides.
FOXE3 is a single exon gene encoding a 319 amino acid
protein, and the recessive p.Cys240X mutation results in
premature termination of translation and a truncated protein
carrying the forkhead domain (Figure 3C). The very initial
expression of FOXE3 is observed in the lens-forming surface
ectoderm (E 9.5), and maintains its presence throughout lens
placode formation, and in later processes too as invagination
and separation from the ectoderm above. Later during the
development, the expression of FOXE3 is switched off from
the differentiating lens fiber cells, restricting itself to the
anterior lens epithelium (E 14.5) where its expression remains
confined throughout the life of the subject [2,4]. The complete
lack of a functional FOXE3 protein product may explain the
complete lack of lens development resulting in aphakia
observed both in association with the p.Cys240X mutation
found in two families as well as for the two other recessive
mutations (Figure 3C). Finally, it is noteworthy that all the
reported recessive families were consanguineous, and that
three out of four were of Pakistani descent.
ACKNOWLEDGMENTS
We thank the families for their participation, Annemette
Mikkelsen and Bjarke Thomsen who performed excellent
technical assistance. Thomas Rosenberg is thanked for
ophthalmological supervision and Sophie Valleix for making
marker analysis of the Madagascan family possible. The
Higher Education Commission of Pakistan is thankfully
acknowledged for funding Iram Anjum. The Wilhelm
Figure 3. Genotype analysis of the
FOXE3 mutation. A: DNA sequencing
chromatograms showing homozygote
mutant and carrier status for two
individuals. B: Microsatellite analysis
for one affected form of the Pakistani
and Madagascan families demonstrate
segregation of different haplotypes in
the two families which exclude an
ancestral origin for the mutation
p.Cys240X. C: Schematic presentation
of the FOXE3 protein. Recessive
inherited mutations (R) and dominant
mutations (D) are clearly denoted [3-6].
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
553

Page 6

Johannsen Centre for Functional Genome Research and the
Genome Group/RC-LINK which hosted the project. The
former is established by the Danish National Research
Foundation. RC-Link is supported by The Danish Medical
Research Council.
REFERENCES
1.Blixt A, Mahlapuu M, Aitola M, Pelto-Huikko M, Enerback S,
Carlsson P. A forkhead gene, FoxE3, is essential for lens
epithelial proliferation and closure of the lens vesicle. Genes
Dev 2000; 14:245-54. [PMID: 10652278]
2.Blixt A, Landgren H, Johansson BR, Carlsson P. Foxe3 is
required for morphogenesis and differentiation of the anterior
segment of the eye and is sensitive to Pax6 gene dosage. Dev
Biol 2007; 302:218-29. [PMID: 17064680]
3.Valleix S, Niel F, Nedelec B, Algros MP, Schwartz C, Delbosc
B, Delpech M, Kantelip B. Homozygous nonsense mutation
in the FOXE3 gene as a cause of congenital primary aphakia
in humans. Am J Hum Genet 2006; 79:358-64. [PMID:
16826526]
4.Iseri SU, Osborne RJ, Farrall M, Wyatt AW, Mirza G, Nurnberg
G, Kluck C, Herbert H, Martin A, Hussain MS, Collin JR,
Lathrop M, Nurnber P, Ragoussis J, Ragge NK. Seeing
Clearly: The Dominant and Recessive Nature of FOXE3 in
Eye Developmental Anomalies. Hum Mutat 2009;
30:1378-86.http://www.ncbi.nlm.nih.gov/sites/entrez?
cmd=Retrieve&db=PubMed&list_uids=18566966&dopt=A
bstract [PMID: 18566966]
5.Semina EV, Brownell I, Mintz-Hittner HA, Murray JC, Jamrich
M. Mutations in the human forkhead transcription factor
FOXE3 associated with anterior segment ocular dysgenesis
and cataracts. Hum Mol Genet 2001; 10:231-6. [PMID:
11159941]
6. Ormestad M, Blixt A, Churchill A, Martinsson T, Enerbäck S,
Carlsson P. Foxe3 haploinsufficiency in mice: a model for
Peters' anomaly. Invest Ophthalmol Vis Sci 2002;
43:1350-7. [PMID: 11980846]
7. Larsson C, Hellqvist M, Pierrou S, White I, Enerbäck S,
Carlsson P. Chromosomal localization of six human forkhead
genes, FREAC-1 (FKHL5), −3 (FKHL7), −4 (FKHL8), −5
(FKHL9), −6 (FKHL10), and −8 (FKHL12). Genomics 1995;
30:464-9. [PMID: 8825632]
8.Lehmann OJ, Sowden JC, Carlsson P, Jordan T, Bhattacharya
SS. Fox’s in development and disease. Trends Genet 2003;
19:339-344. [PMID: 8825632]
9.Moose HE, Kelly LE, Nekkalapudi S, El-Hodiri HM. Ocular
forkhead transcription factors: seeing eye to eye. Int J Dev
Biol 2009; 53:29-36. [PMID: 19123124]
10. Medina-Martinez O, Jamrich M. Foxe view of lens
development and disease. Development 2007; 134:1455-63.
[PMID: 17344231]
11. Medina-Martinez O, Brownell I, Amaya-Manzanares F, Hu Q,
Behringer RR, Jamrich M. Severe defects in proliferation and
differentiation of lens cells in Foxe3 null mice. Mol Cell Biol
2005; 25:8854-63. [PMID: 16199865]
12. Ott J. Estimation of the recombination fractions in human
pedigrees. Am J Hum Genet 1974; 26:588-97. [PMID:
4422075]
13. Butt T, Yao W, Kaul H, Xiaodong J, Gradstein L, Zhang Y,
Husnain T, Riazuddin S, Hejtmancik JF, Riazuddin SA.
Localization of autosomal recessive congenital cataracts in
consanguineous Pakistani families to a new locus on
chromosome 1p. Mol Vis 2007; 13:1635-40. [PMID:
17893665]
14. Ponnam SP, Ramesha K, Tejwani S, Ramamurthy B,
Kannabiran C. Mutation of the gap junction protein alpha 8
(GJA8) gene causes autosomal recessive cataract. J Med
Genet 2007; 44:e85. [PMID: 17601931]
15. Pras E, Pras E, Bakhan T, Levy-Nissenbaum E, Lahat H, Assia
EI, Garzozi HJ, Kastner DL, Goldman B, Frydman M. A gene
causing autosomal recessive cataract maps to the short arm of
chromosome 3. Isr Med Assoc J 2001; 3:559-62. [PMID:
11519376]
16. Pras E, Raz J, Yahalom V, Frydman M, Garzozi HJ, Pras E,
Hejtmancik JF. A nonsense mutation in the glucosaminyl (N-
acetyl) transferase 2 gene (GCNT2): association with
autosomal recessive congenital cataracts. Invest Ophthalmol
Vis Sci 2004; 45:1940-5. [PMID: 15161861]
17. Forshew T, Johnson CA, Khaliq S, Pasha S, Willis C, Abbasi
R, Tee L, Smith U, Trembath RC, Mehdi SQ, Moore AT,
Maher ER. Locus heterogeneity in autosomal recessive
congenital cataracts: linkage to 9q and germline HSF4
mutations. Hum Genet 2005; 117:452-9. [PMID: 15959809]
18. Ferda Percin E, Ploder LA, Yu JJ, Arici K, Horsford DJ,
Rutherford A, Bapat B, Cox DW, Duncan AMV, Kalnins VI,
Kocak-Altintas A, Sowden JC, Traboulsi E, Sarfarazi M,
McInnes RR. Human microphthalmia associated with
mutations in the retinal homeobox gene CHX10. Nat Genet
2000; 25:397-401. [PMID: 10932181]
19. Smaoui N, Beltaief O, BenHamed S, M'Rad R, Maazoul F,
Ouertani A, Chaabouni H, Hejtmancik JF. A homozygous
splice mutation in the HSF4 gene is associated with an
autosomal recessive congenital cataract. Invest Ophthalmol
Vis Sci 2004; 45:2716-21. [PMID: 15277496]
20. Riazuddin SA, Yasmeen A, Zhang Q, Yao W, Sabar MF,
Ahmed Z, Riazuddin S, Hejtmancik JF. A new locus for
autosomal recessive nuclear cataract mapped to chromosome
19q13 in a Pakistani family. Invest Ophthalmol Vis Sci 2005;
46:623-6. [PMID: 15671291]
21. Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E,
Geffen-Carmi N, Frydman M, Goldman B, Pras E. A
missense mutation in the LIM2 gene is associated with
autosomal recessive presenile cataract in an inbred Iraqi
Jewish family. Am J Hum Genet 2002; 70:1363-7. [PMID:
11917274]
22. Ramachandran RD, Perumalsamy V, Hejtmancik JF.
Autosomal recessive juvenile onset cataract associated with
mutation in BFSP1. Hum Genet 2007; 121:475-82. [PMID:
17225135]
23. Riazuddin SA, Yasmeen A, Yao W, Sergeev YV, Zhang Q,
Zulfiqar F, Riaz A, Riazuddin S, Hejtmancik JF. Mutations
in betaB3-crystallin associated with autosomal recessive
cataract in two Pakistani families. Invest Ophthalmol Vis Sci
2005; 46:2100-6. [PMID: 15914629]
24. Cohen D, Bar-Yosef U, Levy J, Gradstein L, Belfair N, Ofir R,
Joshua S, Lifshitz T, Carmi R, Birk OS. Homozygous
CRYBB1 deletion mutation underlies autosomal recessive
congenital cataract. Invest Ophthalmol Vis Sci 2007;
48:2208-13. [PMID: 17460281]
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
554

Page 7

25. Pras E, Frydman M, Levy-Nissenbaum E, Bakhan T, Raz J,
Assia EI, Goldman B, Pras E. A nonsense mutation (W9X) in
CRYAA causes autosomal recessive cataract in an inbred
Jewish Persian family. Invest Ophthalmol Vis Sci 2000;
41:3511-5. [PMID: 11006246]
Molecular Vision 2010; 16:549-555 <http://www.molvis.org/molvis/v16/a62>© 2010 Molecular Vision
The print version of this article was created on 25 March 2010. This reflects all typographical corrections and errata to the article
through that date. Details of any changes may be found in the online version of the article.
555