On the diversity of malaria parasites in African apes and the origin of Plasmodium falciparum from Bonobos.

Abstract

The origin of Plasmodium falciparum, the etiological agent of the most dangerous forms of human malaria, remains controversial. Although investigations of homologous parasites in African Apes are crucial to resolve this issue, studies have been restricted to a chimpanzee parasite related to P. falciparum, P. reichenowi, for which a single isolate was available until very recently. Using PCR amplification, we detected Plasmodium parasites in blood samples from 18 of 91 individuals of the genus Pan, including six chimpanzees (three Pan troglodytes troglodytes, three Pan t. schweinfurthii) and twelve bonobos (Pan paniscus). We obtained sequences of the parasites' mitochondrial genomes and/or from two nuclear genes from 14 samples. In addition to P. reichenowi, three other hitherto unknown lineages were found in the chimpanzees. One is related to P. vivax and two to P. falciparum that are likely to belong to distinct species. In the bonobos we found P. falciparum parasites whose mitochondrial genomes indicated that they were distinct from those present in humans, and another parasite lineage related to P. malariae. Phylogenetic analyses based on this diverse set of Plasmodium parasites in African Apes shed new light on the evolutionary history of P. falciparum. The data suggested that P. falciparum did not originate from P. reichenowi of chimpanzees (Pan troglodytes), but rather evolved in bonobos (Pan paniscus), from which it subsequently colonized humans by a host-switch. Finally, our data and that of others indicated that chimpanzees and bonobos maintain malaria parasites, to which humans are susceptible, a factor of some relevance to the renewed efforts to eradicate malaria.

Full text

Page 1

On the Diversity of Malaria Parasites in African Apes and
the Origin of Plasmodium falciparum from Bonobos
Sabrina Krief1., Ananias A. Escalante2.*, M. Andreina Pacheco2, Lawrence Mugisha3, Claudine Andre ´4,
Michel Halbwax5, Anne Fischer5¤, Jean-Michel Krief6, John M. Kasenene7, Mike Crandfield8, Omar E.
Cornejo9, Jean-Marc Chavatte10, Clara Lin11, Franck Letourneur12, Anne Charlotte Gru ¨ner11,12, Thomas F.
McCutchan13, Laurent Re ´nia11,12, Georges Snounou10,11,14,15,16*
1UMR 7206-USM 104, Eco-Anthropologie et Ethnobiologie, Muse ´um National d’Histoire Naturelle, Paris, France, 2School of Life Sciences, Arizona State University, Tempe,
Arizona, United States of America, 3Chimpanzee Sanctuary & Wildlife Conservation Trust (CSWCT), Entebbe, Uganda, 4Lola Ya Bonobo Bonobo Sanctuary, ‘‘Petites Chutes
de la Lukaya’’, Kimwenza–Mont Ngafula, Kinshasa, Democratic Republic of Congo, 5Max-Planck Institute for Evolutionary Anthropology, Leipzig, Germany, 6Projet pour la
Conservation des Grands Singes, Paris, France, 7Department of Botany, Makerere University, Kampala, Uganda; Makerere University Biological Field Station, Fort Portal,
Uganda, 8Research and Conservation Program, The Maryland Zoo in Baltimore, Baltimore, Maryland, United States of America, 9Emory University, Program in Population
Biology, Ecology, and Evolution, Atlanta, Georgia, United States of America, 10USM0307, Parasitologie Compare ´e et Mode `les Expe ´rimentaux, Muse ´um National d’Histoire
Naturelle, Paris, France, 11Laboratory of Malaria Immunobiology, Singapore Immunology Network, Agency for Science Technology and Research (A*STAR), Biopolis,
Singapore, 12Institut Cochin, Universite ´ Paris Descartes, CNRS (UMR 8104), Paris, France; INSERM U567, Paris, France, 13Laboratory of Malaria and Vector Research,
National Institute of Allergy and Infectious Diseases, National Institute of Health, Bethesda, Maryland, United States of America, 14INSERM UMR S 945, Paris, France,
15Universite ´ Pierre & Marie Curie, Faculte ´ de Me ´decine Pitie ´-Salpe ˆtrie `re, Paris, France, 16Department of Microbiology, National University of Singapore, Singapore
Abstract
The origin of Plasmodium falciparum, the etiological agent of the most dangerous forms of human malaria, remains
controversial. Although investigations of homologous parasites in African Apes are crucial to resolve this issue, studies have
been restricted to a chimpanzee parasite related to P. falciparum, P. reichenowi, for which a single isolate was available until
very recently. Using PCR amplification, we detected Plasmodium parasites in blood samples from 18 of 91 individuals of the
genus Pan, including six chimpanzees (three Pan troglodytes troglodytes, three Pan t. schweinfurthii) and twelve bonobos
(Pan paniscus). We obtained sequences of the parasites’ mitochondrial genomes and/or from two nuclear genes from 14
samples. In addition to P. reichenowi, three other hitherto unknown lineages were found in the chimpanzees. One is related
to P. vivax and two to P. falciparum that are likely to belong to distinct species. In the bonobos we found P. falciparum
parasites whose mitochondrial genomes indicated that they were distinct from those present in humans, and another
parasite lineage related to P. malariae. Phylogenetic analyses based on this diverse set of Plasmodium parasites in African
Apes shed new light on the evolutionary history of P. falciparum. The data suggested that P. falciparum did not originate
from P. reichenowi of chimpanzees (Pan troglodytes), but rather evolved in bonobos (Pan paniscus), from which it
subsequently colonized humans by a host-switch. Finally, our data and that of others indicated that chimpanzees and
bonobos maintain malaria parasites, to which humans are susceptible, a factor of some relevance to the renewed efforts to
eradicate malaria.
Citation: Krief S, Escalante AA, Pacheco MA, Mugisha L, Andre ´ C, et al. (2010) On the Diversity of Malaria Parasites in African Apes and the Origin of Plasmodium
falciparum from Bonobos. PLoS Pathog 6(2): e1000765. doi:10.1371/journal.ppat.1000765
Editor: L. David Sibley, Washington University School of Medicine, United States of America
Received September 4, 2009; Accepted January 13, 2010; Published February 12, 2010
This is an open-access article distributed under the terms of the Creative Commons Public Domain declaration which stipulates that, once placed in the public
domain, this work may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose.
Funding: This study was financially supported by the Museum National d’Histoire Naturelle (Paris, France), the Fyssen Foundation and a Leakey grant to SK. AAE
was supported by an R01 grant (GM080586) from the US National Institutes of Health. The US NIH intramural program supported TFM. LR, ACG, CL and GS were
supported by INSERM and the Agency for Science, Technology and Research (A*STAR), Singapore. The funders had no role in study design, data collection and
analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: Ananias.Escalante@asu.edu (AAE); georges.snounou@upmc.fr or gsnounou@gmail.com (GS)
. These authors contributed equally to this work.
¤ Current address: African Insect Science for Food and Health, Nairobi, Kenya
Introduction
Malaria infections have influenced the development of human
civilizations, and have shaped the genetic make-up of current
human populations. There are four globally distributed Plasmo-
dium protozoan parasites that are responsible for malaria in
humans (P. falciparum, P. vivax, P. malariae and P. ovale). Molecular
phylogenetic analyses have demonstrated that these four
parasites are not monophyletic [1,2], indicating that they
independently colonised hominids [3–6]. The timing of their
appearance in Homo sapiens, however, remains unresolved. This is
of some importance to current efforts to control malaria, because
it will affect how observed patterns of genetic diversity in the
parasite populations are interpreted. For example, several
evolutionary genetic approaches rely on reliable phylogenetic
information to detect putative adaptive genetic variation, thereby
identifying genes that might be involved in pathogenesis or in the
evasion of host immune responses. Addressing these issues is a
PLoS Pathogens | www.plospathogens.org1 February 2010 | Volume 6 | Issue 2 | e1000765

Page 2

matter of great importance for P. falciparum, the parasite
responsible for a substantial proportion of the global malaria
mortality and morbidity [7]. It is now generally accepted that P.
falciparum underwent a population expansion in humans [4,6,8–
11], though how, when and from where humans first acquired P.
falciparum, is less well established. Suggestions of a host-switch
fromachimpanzee parasite
albeit without resolving the likelihood or timing of this event
[4,10,12].
The accuracy and robustness of conclusions derived from
comparative analyses (phylogenetic or genomics) will be signif-
icantly enhanced if data from all of the evolutionary close
parasites were to be included. In the context of parasites of
humans, this data would be best obtained from Plasmodium species
that infect our nearest relatives, the African Apes, because two of
the parasite species, P. reichenowi and P. rodhaini, that have been
reported in Pan and Gorilla are morphologically very similar to P.
falciparum and P. malariae respectively, while the third, P. schwetzi,
corresponds to P. vivax or P. ovale [13,14]. Studies of the malaria
parasites of African Apes have been limited to few observations
made mainly in the 1920s–1950s, and very little is known of their
natural history. Nonetheless, it is known that chimpanzees are
susceptible to infection by the four parasite species of humans,
while humans have been infected with P. rodhaini and P. schwetzi
[13,14]. The origin and evolutionary history of the malaria
parasites in chimpanzees and gorillas are speculative [13,14]
mainly because the molecular data has been restricted to
sequences derivedfroma
[3,4,8,15,16] until very recently [12]. In another recent
publication, a novel parasite lineage close to, but distinct from,
P. reichenowi was reported from chimpanzees sampled in Gabon
[17]. This raises the important question as to whether Plasmodium
species close to P. falciparum, other than the two described so far,
occur in non-human higher primates.
We were afforded a rare opportunity to analyze blood samples
collected independently from chimpanzees and bonobos for the
presence of Plasmodium parasites. Such a collection of fresh isolates
would provide sequence data for improved phylogenetic analyses.
Here we report on our findings of a genetically diverse set of
Plasmodium parasites found in some of the samples we analyzed,
and we discuss the insights they have provided into the origin of
the Plasmodium falciparum.
receivedrecentsupport,
single
P. reichenowi
isolate
Results
Blood samples were obtained from 49 chimpanzees, Pan
troglodytes, in Uganda and the Democratic Republic of the Congo
(DRC), and from 42 bonobos, Pan paniscus, in the DRC. Blood
smears were not made available, so the presence and level of
Plasmodium parasites were assessed solely by a highly sensitive PCR
assay, where a small fragment of the small subunit ribosomal RNA
(ssrRNA) genes is amplified using oligonucleotides that target
sequences conserved in all known Plasmodium species [18].
Parasites were detected in 18 animals: 3/3 Pan t. schweinfurthii
living wild in Kibale National Park in Uganda, and in 3/8 Pan t.
troglodytes and 12/42 Pan paniscus cared for in sanctuaries in the
DRC. Parasitaemias were quite low (,100 parasites per ml of
blood), consistent with previous observations of naturally infected
apes [13,14].
We opted to conduct our analyses on the DNA purified directly
from the blood samples, because whole genome amplification
could lead to artefactual recombination between DNA molecules
from different strains or species of parasites, should any be present
in a given sample. Given the low parasite densities in the samples
and the limited blood volumes available, efforts were directed at
characterizing a small number of genes that have been used in
recent phylogenetic analyses. Specifically, we targeted the
mitochondrial genome using oligonucleotide primers that corre-
spond to sequences conserved in Plasmodium. Since we were
particularly interested in lineages related to P. falciparum, we used
oligonucleotides based on sequences from P. falciparum to target
two nuclear genes: dihydrofolate reductase-thymidylate synthase
(dhfr-ts), and the gene encoding the merozoite surface protein 2
(msp2) because this gene is not known to have orthologues outside
P. falciparum and P. reichenowi [15]. We specifically targeted the
block 3 of msp2, because we hypothesized that the extensive
polymorphisms observed for this region in P. falciparum might also
occur in orthologous genes that could be present in closely related
species, and this could provide an indication of genetic diversity in
these parasites.
In order to minimize artefacts, nearly all the sequences obtained
for the dhfr-ts and the msp2 block 3 fragments were derived from
duplicate amplifications. The mitochondrial genome sequences
were also derived from duplicate amplification of a single 5800 bp
fragment, which spans nearly the complete mitochondrial genome
of ca. 6 kb. This avoided any ambiguities in a final assembly of
overlapping fragments that might arise from a sample with
multiple parasite lineages. Indeed, it was not possible to combine
the dhfr-ts, msp2 and mitochondrial data sets in the subsequent
phylogenetic analyses, because mixed infections were common in
our samples. Finally, we are confident that cross-contamination
during amplification was highly unlikely because similar sequences
for the different chimpanzee parasite lineages were derived from
samples collected independently in Uganda or the DRC, and then
processed in France or in the USA, respectively. Successful
amplification was not achieved for all the genes targeted from each
sample, and this was particularly noted for the samples from the
bonobos. Nonetheless, the sequence data obtained revealed a rich
diversity of species and strains (Table S1), in particular for the
individual samples collected from the two Pan troglodytes subspecies.
Sixteen near-complete mitochondrial genomes that coalesce in
six distinct lineages were obtained from 12 of the 18 samples
positive for Plasmodium (Fig. 1). All our phylogenetic analyses lead
to identical topologies (see Methods), and only the Bayesian
phylogenetic tree is reported (Fig. 1). Two lineages shared a recent
common ancestor either with the P. malariae clade (two bonobos) or
with the P. vivax clade (one chimpanzee from Uganda and one
Author Summary
Chimpanzees and gorillas are known to have malaria
parasites (genus Plasmodium) similar to those that infect
humans. It is likely that detailed molecular studies of these
parasites will help understand important aspects of the
malaria disease and of immune defences in humans, and
could then guide the development of novel control
measures. However, few studies of parasites in African
Apes have been conducted to date. Here we present the
results of a survey of malaria parasites in chimpanzees and
bonobos, our closest relatives. In chimpanzees, we
identified two new parasite species closely related to P.
falciparum, the most dangerous of the parasites in
humans. We also found that bonobos harbour malaria
parasites including P. falciparum. Phylogenetic analyses of
these parasites strongly suggested that P. falciparum
evolved in bonobos, and that it was introduced into
humans from bonobos at a later date. Overall, our findings
have substantially altered our perception of the origin of
malaria parasites in humans.
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org2February 2010 | Volume 6 | Issue 2 | e1000765

Page 3

from the DRC). Another lineage, found in the bonobo samples,
clustered with P. falciparum. One lineage from a DRC chimpanzee
shared a recent common ancestor with P. reichenowi, while the two
remaining lineages found in chimpanzees sampled in Uganda and
the DRC, were novel and formed a monophyletic group with
those of P. falciparum and P. reichenowi. For the sake of clarity, we
have used the name Laverania to refer to this monophyletic clade,
a generic name previously proposed to distinguish P. falciparum and
P. reichenowi from the other malaria parasite species (International
Commission on Zoological Nomenclature, Opinion 283). We
Figure 1. Phylogenetic tree of Plasmodium based on mitochondrial genomes. In the Bayesian phylogenetic tree presented, the values above
branches are posterior probabilities expressed as percentages. Maximum likelihood and Bayesian methods lead to identical phylogenies. The names
of the species that normally infect humans or chimpanzees are presented in bold. The sequence of the mitochondrial genomes derived from the Ape
samples were named (also presented in bold) according to the country in which an Ape was sampled (DRC or UG, which stand for the Democratic
Republic of Congo and Uganda, respectively), followed in parentheses by a single letter that indicates the particular Ape from which the sequence
was obtained, and a number when two or more distinct sequence were obtained from the sample. Theses names were colour-coded according to the
host species, indicated on the right, from which the sequences were derived (Pan t. troglodytes in blue; Pan t. schweinfurthii in red, and Pan paniscus in
green). The Laverania clade is highlighted in yellow, and the branches carrying the sequences from the two novel lineages are labelled as the new
species to which we propose they belong. The accession numbers of the sequences derived from the parasites found in chimpanzees and bonobos
are provided in Table S1, and those of the other species are provided in the Methods.
doi:10.1371/journal.ppat.1000765.g001
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org3February 2010 | Volume 6 | Issue 2 | e1000765

Page 4

hypothesized that the two new lineages in the Laverania clade
correspond to two distinct Plasmodium species. This hypothesis was
further supported by three other analyses. First, the extent of
divergence in the genetic distances between these two novel
Laverania lineages, as calculated from the mitochondrial genomes
(Table 1), is comparable to that observed between well-established
species in the rodent malaria clade, or between P. falciparum and P.
reichenowi. Second, the topology of the phylogenetic tree construct-
ed using dhfr-ts sequences from the same isolates reproduces that
obtained for the mitochondrial genome (Fig. 2). Indeed, it would
appear that an insert coding for eight amino acids is specific to the
Laverania lineages (P. falciparum, P. reichenowi and the two new
lineages), which further supports our conclusion that these lineages
form a monophyletic group. Finally, the samples that harboured
the two novel lineages and the P. reichenowi lineage, yielded msp2
block 3 sequences that could be grouped into five distinct allelic
families, of which one was similar to that previously published for
P. reichenowi (Fig. 3), while the other four were novel. By a way of
comparison, only two allelic families have been identified for the P.
falciparum msp2 block 3 despite extensive sampling.
Six of the eight bonobos positive for Plasmodium, harboured
parasites that yielded sequence data for dhfr-ts and/or msp2. The
msp2 and all the dhfr-ts sequences were indistinguishable from
known P. falciparum sequences. This confirmed that bonobos were
infected with P. falciparum, as had been indicated by the sequences
of the mitochondrial genomes derived from four of these six
bonobos (Fig. 1). Interestingly, we found significant differences in
the genetic diversity of the P. falciparum mitochondrial lineages
derived from bonobos as compared with that previously noted for
large set of mitochondrial P. falciparum lineages obtained from
human isolates collected worldwide [9]. Indeed, the P. falciparum
lineages in bonobos (n=4, p=0.0048) were ten times more
diverse that those found in humans (n=96, p=0.00034).
Furthermore, there were no fixed differences between the P.
falciparum from bonobos and those from humans. In other words,
the four mitochondrial P. falciparum haplotypes we obtained from
the bonobos had each a distinctive set of mutations such that none
of these haplotypes were represented in the extensive P. falciparum
mitochondrial haplotype database. This is clearly illustrated in the
mitochondrial genome haplotype network (Fig. 4). The P.
falciparum populations from bonobos and from humans, though
related, have undergone some level of differentiation. Moreover,
the haplotype network indicates that the four haplotypes from the
bonobo do not form a monophyletic group, which suggests a
scenario where bonobos and humans exchanged parasites in
relatively recent times.
Discussion
The sum of our knowledge on the Plasmodium parasites of
African Apes derives from observations, nearly all made before the
1960s, on fewer than 50 naturally infected animals captured
primarily in Cameroon, Sierra Leone or the Congo. Given the
highly protected status of African Apes, prospects to extend this
knowledge are restricted to molecular analyses of blood samples,
mainly collected during medical examination of Apes cared for in
sanctuaries, or upon recovery from poachers or villagers. The
results from three such surveys published this year [12,17,19] have
provided new glimpses into the diversity of malaria parasites in
chimpanzees, and have allowed testing of hypotheses concerning
the evolution of P. falciparum [12,17,19]. Here we present the
outcome of two further independent surveys, one of which is
distinguished by the inclusion of samples from bonobos and from
wild-living chimpanzees. The molecular data we present demon-
strate that the Pan genus naturally harbours a rich Plasmodium
fauna, including two novel lineages close to P. falciparum, one
related to P. vivax, and one related to P. malariae. Furthermore, it
brings to light the presence of a population of P. falciparum in
bonobos that appears to differ from those in humans. The
observations add new perspectives to the evolutionary hypotheses
formulated for the Plasmodium parasites of African Great Apes and
humans.
From a parasitological point of view, the fact that the three
samples collected from Eastern Chimpanzees (Pan t. schweinfurthii)
living wild in a community of 44 animals, were all positive and
harboured complex mixed strain/species infections (Table S1),
suggests that prevalence of infections under natural conditions of
transmission is high. This view is supported by our observations of
a similar level of parasite diversity in three of the eight Central
Chimpanzees (Pan t. troglodytes) that were independently sampled in
the DRC (Table S1). It would be interesting to establish whether
the other two chimpanzee subspecies, the Western Chimpanzee
(Pan t. verus) and the Nigeria-Cameroon Chimpanzee (Pan t.
vellerosus) also harbour the same parasite species. The bonobos
cared for in a sanctuary also had high parasite prevalence, with
Plasmodium detected via ssrRNA amplification in 12 of the 42
sampled (28.5%).
Table 1. Genetic distances between the mitochondrial lineages (ca. 5800 bp) from selected Plasmodium species.
Species P. ber.P. yoe. P. cha. P. fal.P. rei. P. bbr. (S1)P. bbr. (S2) P. rei.(S1)P. bco.
P. ber.
-
P. yoe.0.0132-
P. cha.0.03080.0286-
P. fal.0.07560.07470.0747-
P. rei.0.07660.07610.0773 0.0104-
P. bbr. (S1) 0.08500.08320.0839 0.0434 0.0430-
P. bbr. (S2) 0.08600.0834 0.08460.04410.0437 0.0036-
P. rei.(S3)0.07960.0785 0.0785 0.01660.01150.03900.0397-
P. bco. 0.08360.08150.08200.03390.03480.03900.03970.0293-
Species that infect rodents: P. ber = P. berghei; P. yoe. = P. yoelii; P. cha = P. chabaudi. Species that infect higher primates: P. fal = P. falciparum; P. rei = P. reichenowi
(S3 in brackets indicated the haplotype DRC (S3) identified in this study). The new species described in this study are: P. bbr. = P. billbrayi (haplotype DRC (S1), DRC (S2));
P. bcol = P. billcollinsi (haplotype DRC (I)).
doi:10.1371/journal.ppat.1000765.t001
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org4 February 2010 | Volume 6 | Issue 2 | e1000765

Page 5

Theparasitesrelated toP.vivax-likefoundinchimpanzeesfromthe
DRC and Uganda might correspond to the chimpanzee parasite P.
schwetzi.Preliminaryevidencefrompartialdhfrsequencesobtainedfor
the chimpanzees we sampled in Uganda suggests that these parasites
couldberelatedtoP.vivax(datanot shown).Unfortunately,atpresent
aP.schwetziisolateisnotavailableforcomparativemolecularanalysis.
Whether this species in Pan results from a past host switch from
humans into chimpanzee, or whether it corresponds to P. vivax
parasites recently reported in Equatorial Africa [20,21], remains a
matter of speculation. It might be that the dynamics of P. vivax and
related species in African hominids, including humans, are more
complex than previously thought.
The quartan malaria parasites, P. brasilianum in South American
primates and P. rodhaini in the chimpanzee, have long been
considered to be strains of P. malariae [13,14]. Thus, it was
interesting that the mitochondrial genomes of the parasites related
to P. malariae found in two bonobos conform a sister clade and
carry a six nucleotide insert that has not been observed for P.
malariae or the South American parasite P. brasilianum. This could
indicate that the parasites in bonobos might correspond to P.
rodhaini, a species that would then be distinct rather than
synonymous with P. malariae. Confirmation that this might indeed
be the case awaits further molecular data from a larger set of P.
malariae lineages from humans and Apes.
Three parasite lineages related to P. falciparum were found in
both the chimpanzees collected from DRC and those collected
from Uganda. One of these lineages clearly corresponds to P.
reichenowi. We propose that the other lineages may represent two
distinct Plasmodium species. Given the data from the near-complete
mitochondrial genome sequences, and the support from dhfr-ts and
msp2 sequences, we consider it reasonable to ascribe specific status
to the parasites in the two novel lineages observed in chimpanzees.
We propose to name the parasites of one of the novel lineages
Plasmodium billcollinsi Krief et al. n. sp., and those of the other
Plasmodium billbrayi Krief et al. n. sp., in honour of the distinguished
malariologists William E. Collins and ‘‘Bill’’ Robert Stow Bray
(1923–2008), respectively. The type material would be the
mitochondrial genome sequences (holotype and paratype), with a
distribution in Uganda and the DRC in Pan t. troglodytes and P. t.
schweinfurthii as hosts.
While we were finalizing this manuscript for submission, a
publication describing a novel lineage related to P. falciparum was
reported from two Pan troglodytes sampled in Gabon [17]. Based on
mitochondrial DNA sequences, the authors have also proposed
that this lineage be considered a new species, P. gaboni [17]. When
the mitochondrial sequence submitted for P. gaboni was compared
with the mitochondrial sequence presented here, it could be
concluded that P. gaboni and P. billbrayi shared a recent common
Figure 2. Phylogenetic analyses of the Laverania group based on the dhfr-ts. We report four dhfr-ts alleles, DRC (Sd1), DRC (Sd2) and DRC
(Sd3) derived from the sample collected from one Ape (Shegue), and DRC (Id) derived from a sample from another Ape (Itaito). The DRC (Sd1) allele
corresponds to the P. reichenowi sequence. In view of the similarity with the mitochondrial genome tree topology and the apparent lack of mixed
species infection in the two animals from which sequences were obtained, we tentatively considered that DRC (Sd2) and DRC (Sd3) originate from P.
billbrayi parasites, and DRC (Id) from P. billcollinsi (hence the quotation marks). Bayesian support for the nodes was inferred through a Monte Carlo
Markov chain model as implemented in Mr. Bayes, with 10,000,000 generations after a ‘‘burn-in’’ of 3,000,000 generations. Sampling was performed
every 100 generations. Mixing of the chains was properly checked after runs. Two phylogenies are presented for the gene encoding dhfr-ts. A.
Phylogeny A (1789 bp), which included the P. falciparum (XM_001351443) and P. reichenowi (GQ369533, this study) dhfr-ts sequences and the four
from parasites of Apes, reproduces the topology obtained from the mitochondrial genome. B. Phylogeny B (1690 bp aligned) uses rodent malarial
parasites P. berghei and P. yoelii as outgroups, differs from the mitochondrial phylogeny by placing the root of the Laverania group within P. billbrayi
alleles that are no longer monophyletic. We favour the phylogenetic hypothesis A over B since the latter is based on fewer base pairs and excludes an
area with phylogenetic information among the Laverania species; such an area is not found in rodent or any other Plasmodium species so it is
excluded from the phylogenetic analyses. Indeed, P. reichenowi (NC_002235 and DRC (Sd1)) cannot be clearly separated from P. falciparum indicating
that rodent malarias may be too distant to serve as a reliable out-group for dhfr-ts.
doi:10.1371/journal.ppat.1000765.g002
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org5 February 2010 | Volume 6 | Issue 2 | e1000765

Page 6

ancestor (Fig. S1). However, the differences were of sufficient
importance (e.g. P. gaboni has a unique insert) to lead us to consider
P. gaboni as a possible other additional member of the Laverania
clade. Nonetheless, this assessment is at present mitigated by the
fact that the contiguous mitochondrial sequence provided for the
K isolate of P. gaboni (GenBank Accession No FJ895307) was
assembled from discontinuous fragments that were amplified
separately, hence the unavoidable gaps. Furthermore, if the
animal from which the sample was obtained harboured a mixed
infection, as did many of the chimpanzees that we sampled, the
different fragments used for assembly might have originated from
different species or lineages. Consequently, we opted not to
consider the P. gaboni mitochondrial sequence in our phylogenetic
analyses until such a time that the mitochondrial sequence from
this lineage is confirmed, a view also adopted by Rich et al. [12].
We are aware that the validity of a species described only by
sequences of one or more genes is open to debate, as this does not
conform to current acceptable criteria. It would have been
desirable to obtain some morphological data to provide a classical
description of a novel species. The description of a new Plasmodium
species is classically made after microscopic examination of
Giemsa-stained infected erythrocytes, most often showing all
asexual and sexual developmental stages. In some cases, it is
necessary to examine the form of the parasite in the insect vector
and/or during the hepatic stages, while for others differentiation
from known species requires establishing one or more biological
characteristics such as host specificity, the course of infection, or
the ability to breed true. In the case of Plasmodium parasites that
infect highly protected hosts (such as chimpanzees, gorillas and
orang-utans) invasive sampling is highly restricted. On rare
occasions it is possible to obtain a blood sample, but experimental
infections of such animals are now nearly universally legally
proscribed. Thus, the likelihood to obtain the morphological and
biological data required to define and name a novel Plasmodium
species for such hosts is highly remote. Furthermore, the presence
in a single sample of multiple species would make it difficult to
derive reliable conclusions from observations of a few blood
smears. This is further exacerbated when parasite levels are low
because this restricts microscopic examination to a few forms in
thick smears where parasite morphology is poorly preserved. In
our case, the six chimpanzees we sampled had low parasite loads,
and four of them had mixed species infections. Had we had the
opportunity to examine blood smears, a crescent-shaped gameto-
cyte distinctive of P. falciparum and P. reichenowi might have been
observed, but it would not have been possible to ascribe it with any
degree of confidence to any one of the lineages detected by PCR
amplification. Therefore, in the case of blood dwelling protozoan
parasites of African Apes or other protected species, molecular
data become the only accessible and reliable taxonomic features.
In our study, we have considered that the phylogenetic analysis
and genetic diversity comparisons based on the near-complete
mitochondrial genomes, combined and supported with similar
data from two nuclear genes, provided sufficient grounds to
propose the description of two new species. The fact that similar
sequence analyses correctly predict the specific status of well-
established Plasmodium species (Fig. 1 and Table 1), adds to our
confidence in the validity of P. billbrayi and P. billcollinsi as bona fide
species. We nonetheless consider that it would be worthwhile for
the community to agree on standardized parameters derived from
defined molecular data that could serve to describe Plasmodium
species for which no morphological or biological data are likely to
become available.
The findings we present in this manuscript advocate a
reappraisal of current views on the evolution and origin of P.
falciparum. When it was thought that P. reichenowi and P. falciparum
were unique among all primate malaria parasites, two hypotheses
for the origin of P. falciparum as a parasite of humans were
considered: co-speciation in their respective hosts, or a host switch
followed by independent evolution. Grounds for favouring one
hypothesis over the other shifted with time, as the weight of
evidence that could support one hypothesis over the other was
limited, principally by the availability of only a single P. reichenowi
isolate. Recent analyses of data from parasites sampled from eight
chimpanzees provided clear support for the host-switch scenario
[12]. The data we present further support this finding and provide
a more detailed account of the events leading to the origin of P.
Figure 3. Alignment of the msp2 block 3 sequences obtained from Pan troglodytes sp. The predicted amino acid sequence of one member
from each of the five msp2 block 3 allelic families uncovered from the Plasmodium parasites present in the chimpanzee samples. The alignment
(Clusal V, DNASTAR Lasergene MegAlign version 7.2.1) comparisons were made against the only known P. reichenowi msp2 block 3 sequence [15],
denoted ‘‘Pr’’ (Y14731). The msp2 block sequences obtained during our analysis were named according to the geographic origin of the samples
‘‘KNP’’ (Kibale National Park), followed by the sequence family (Pr for the P. reichenowi type in blue, and A to D for the others in black). Each distinct
sequence found within each family was assigned a sequential number. The origins, names and accession numbers of all the msp2 block 3 sequences
obtained in this study are provided in Table S1. In the alignment presented the representative sequences from the five allelic families that were
included are: KNP-Pr (Prmsp2-A1, GU075719), KNP-A (msp2-KNP-A1, GU075722), KNP-B (msp2-KNP-B, GU075724), KNP-C (msp2-KNP-C1, GU075725)
and KNP-D (msp2-KNP-D, GU075726). Stars (*) represent residue similarity and dashes (2) represent gaps.
doi:10.1371/journal.ppat.1000765.g003
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org6 February 2010 | Volume 6 | Issue 2 | e1000765

Page 7

falciparum as a parasite of humans. When the tree topologies
derived from the dhfr-ts and mitochondrial sequences (Fig. 1 &
Fig. 2) are considered, the most parsimonious interpretation is that
P. falciparum belongs to a monophyletic group of malarial parasites
that have evolved in African Apes. We proceeded to estimate the
divergence time of the most recent common ancestor for the
Laverania clade. We agree that the use of molecular clocks is not
without pitfalls, even when good time points can be used for
calibration [22,23]. In the particular case of parasitic organisms,
an assumption of some level of host specificity (though not
necessarily co-speciation) is needed in order to use host evolution
for estimating the parasite mutation rates. Therefore, we estimated
times of divergence of the mitochondrial sequences using models
that allow the use of relaxed molecular clocks [24]. Although the
Homo/Pan divergence time has been commonly used as a point of
calibration for the falciparum-reichenowi divergence (e.g. [9,17]), we
excluded it in order to avoid circularity in the analyses. Thus, we
estimated the mutation rates under two previously used scenarios:
a), the Plasmodium spp. currently found in macaques radiated with
their primary hosts, the genus Macaca [5], and b) P. gonderi, a
parasite from African monkeys, and macaque parasites co-
diverged when Macaca branched from other Papionina [25]. It is
worth noting that neither of these two time points requires co-
speciation (i.e. where specific malarial parasites co-speciate with
specific non-human primate lineages generating phylogenies with
identical topologies), but simply that several malarial parasites
started their radiation with a major groups of non-human primates
allowing for extensive host-switches. Such timeframes can be
estimated even in the absence of good phylogenetic trees [26].
It is interesting that our time estimates (Table 2) that did not use
the Homo-Pan divergence as a calibration point, were not
substantially different from those estimated by others [9,17] who
used the P. falciparum - P. reichenowi divergence assuming co-
speciation with Homo-Pan. The estimates of the divergence times
for the Laverania clade members (Table 2) indicated that all the
four lineages might have originated between 6.0 and 19 million
years ago (Mya). Regardless of the wide confidence interval, this
time frame is consistent with the origin of the genus Pan, but it
clearly indicated that the Laverania lineages may have started to
diverge long before the divergence Pan-Homo [27]. In addition, the
phylogeny clearly indicates that the human parasite, P. falciparum,
is the only Homo parasite among several Pan species in the
Laverania clade. Given the phylogeny, a Pan host appears as an
ancestral characteristic of the lineage. Therefore, when both
phylogenies and estimated times of divergence are considered, a
co-evolutionary origin of P. falciparum as a parasite of humans can
Figure 4. Mitochondrial haplotype map for P. falciparum populations found in humans and in bonobos. The mitochondrial genomes
from parasite lines collected from humans [9] and of the four obtained from parasites in bonobos, DRC (A), DRC (C), DRC (E) and DRC (L), were used to
obtain the haplotype network presented. It was inferred under a median joining algorithm with posterior pruning using maximum parsimony criteria
as implemented in Network 4.1.1.2 [42]. The size of the circles is proportional to the haplotype frequency with each colour indicating which were
derived from P. falciparum collected from bonobos, and the geographical origin of the sequences from P. falciparum collected from humans.
doi:10.1371/journal.ppat.1000765.g004
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org7February 2010 | Volume 6 | Issue 2 | e1000765

Page 8

be confidently excluded. Consequently the hypothesis that P.
falciparum originated as a result of a host-switch between humans
and Apes becomes favoured. However, our data indicate more
complex scenarios that can only be addressed when data from
multiple isolates of the parasite lineages currently present in both
the hosts involved are included in the analyses.
The mitochondrial haplotype map (Fig. 4) provides evidence
that the sub-population of four P. falciparum parasites in bonobos
were genetically more diverse that of the extensive P. falciparum
population in humans available to date. The most parsimonious
interpretation of this line of evidence is that P. falciparum originated
as a human parasite via a host-switch from Pan paniscus. When the
human P. falciparum mitochondrial sequences alone are considered,
our estimate of the time to the most recent common ancestor
(TMRCA) was 78,000–330,000 years ago. While we cannot rule
out that the available sample of P. falciparum mitochondrial
genomes properly represent the genetic diversity of the species, this
time frame is consistent with one expected for a parasite
expanding early in human history. However, when considered
together, the two distinct P. falciparum populations of humans and
bonobos are estimated to have diverged from other members of
the Laverania clade between 1.0 and 3.1 Mya. This timeframe
coincides with the divergence of bonobo from the common
chimpanzee [28,29]. The estimated TMRCA of 0.4 to 1.6 Mya
for the P. falciparum found in bonobos coincides with the origin of
bonobos [28]. Taken together, our analyses indicate that P.
falciparum, as a species, has long been associated with Pan paniscus
and only subsequently switched into humans. The topology of the
mitochondrial haplotype network (Fig. 4) is consistent with this
interpretation and suggests that few lineages expanded in the
human population after this event. The parasites we obtained over
a short period from a single bonobo community probably
constitute a biased sample set. A reliable estimate of the timing
for the host-switch and the number of times this event might have
taken place would require the inclusion of sequences from a larger
set of P. falciparum parasites from bonobos from diverse locations.
Assuming that there was no sampling bias with respect to the P.
falciparum populations collected by others from humans, the limited
data from bonobo parasites we present here can be most
conservatively interpreted to support a single switching event,
though it does not allow excluding multiple events. It is also
possible that host switching still occurs today in areas where
humans and bonobos are in close epidemiological contact. The
presence of double or triple mutations associated with resistance to
pyrimethamine in the four dhfr sequences obtained for the P.
falciparum of bonobos is consistent with this, because these
mutations are common in P. falciparum collected in 2008 from
residents around Kinshasa [30]. At present, we cannot rule out the
possibility that these dhfr mutations might have been selected
independently in bonobos during the three months treatments
with BactrimTM(trimethoprim + sulfamethoxazole, two drugs that
target the same enzymes of the folate pathway as the antimalarial
combination of pyrimethamine and sulfadoxine) to which apes in
the sanctuary were occasionally subjected. Finally, it could be
speculated that the parasites in bonobos and in humans have
recombined sexually.
The scenario we propose for the origin of P. falciparum in
humans differs in several respects from a very recently formulated
hypothesis that proposed that this species originated from a single
transfer of P. reichenowi from chimpanzees to humans [12]. These
conclusions were based on the analysis of the genetic diversity and
tree topologies derived from fragments of the mitochondrial
cytochrome b gene (528 bp), the apicoplast caseinolytic protease
(316 bp), and the nuclear small subunit ribosomal RNA gene
(371 bp), obtained from eight Plasmodium-infected chimpanzees
(three from Pan t. verus, and five from Pan t. troglodytes). One
assumption was that these sequences were derived from a single
parasite specie, P. reichenowi, found in Pan troglodytes sp. This was a
fair supposition to make since these short sequences did not
provide sufficient resolution to distinguish their lineages from that
of the only known P. reichenowi isolate. However, when these partial
cytochrome b sequences are compared to the homologous region
in the mitochondrial genomes that we obtained, there are clear
indications that some might correspond to P. reichenowi, but also
that most cluster either with the P. billbrayi or the P. billcollinsi
lineages reported here (Fig. S1), which differ to such an extent
from P. reichenowi that they could be considered as distinct species.
Indeed this is evident on examination of the topology and branch
lengths in the phylogenetic tree presented for the cytochrome b
fragment (see Fig. 4 of [12]), where the eight isolates cluster into
three groups removed from P. reichenowi. Our data provides
evidence of a contrasting and more complex evolutionary scenario
where P. falciparum evolved as a species in bonobos (Pan paniscus)
where it was one of at least four parasite species that radiated in
the genus Pan before it switched into humans.
The infections of bonobos by P. falciparum were not associated
with any overt clinical signs, nor would the levels of parasitaemia
have allowed detection by microscopy, suggesting a state of
chronic malaria typical of infections in natural hosts. This is
consistent with previous observations, including some made on
splenectomised chimpanzees with high parasite levels [13,14], in
which chimpanzees experimentally infected with various parasite
species including P. falciparum showed few clinical signs whether at
peak parasitaemias or during the subsequent lengthy chronic
infections [13,14]. This minor impact on the health of chimpan-
zees was recently supported by the failure to detect a signature of
positive selection in their G6PD genes, despite a long association
with Plasmodium parasites [31]. The contrasting parasitological and
clinical evolutions of P. falciparum in its two hosts, humans and
bonobos, which have highly similar genomes, provides an
excellent opportunity for comparative genomic studies to uncover
the genetic or molecular basis for its higher virulence in humans.
Such knowledge could be exploited to devise novel approaches to
reduce the substantial global morbidity and mortality burdens.
It is likely that bonobos, in which we have found significant
numbers to be naturally infected with P. falciparum or P. malariae,
are also susceptible to infections by P. ovale and P. vivax, as is the
case for chimpanzees [13,14,19]. One can now, therefore,
justifiably explore whether bonobos and chimpanzees could act
as a reservoir for all Plasmodium species that afflict humans. The
Table 2. Estimated TMRCA for different parasite groups.
Clade
TMRCA mean Mya
(L 95% CI–H 95% CI)
P. falciparum in Pan paniscus0.77 (0.43–1.6)
P. falciparum in H. sapiens 0.20 (0.078–0.33)
P. falciparum in Pan paniscus and H. sapiens0.85 (0.46–1.3)
P. reichenowi 1.8 (0.60–3.2)
P. reichenowi - P. falciparum in Pan paniscus2.2 (1.0–3.1)
P. billbray n. sp. 1.1 (0.52–1.7)
P. billcollinsi n. sp. 0.97 (0.38–1.7)
Laverania radiation 12.0 (6.0–19.0)
doi:10.1371/journal.ppat.1000765.t002
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org8February 2010 | Volume 6 | Issue 2 | e1000765

Page 9

potential impact of zoonotic malaria transmission on human
health has been recently exemplified by a stable focus of
potentially lethal P. knowlesi, a benign parasite of macaques, in
inhabitants of Malaysian Borneo [32,33]. Such a possibility has
not been considered for sub-Saharan Africa. A zoonotic
reintroduction of malaria into communities that live in hyperen-
demic areas is likely to be of little consequence. However, this
would hinder efforts to eradicate malaria and might possibly lead
to epidemic foci in formerly malarious regions whose inhabitants
have lost immunity acquired against malaria. Furthermore,
humans have been shown to be susceptible to infection by two
of the parasite species of African Apes (P. rodhaini and P. schwetzi)
[13,14], and the meagre data available does not exclude the
possibility that humans can be infected by P. reichenowi or the two
new species we describe here. Using the sequence data we
obtained from chimpanzee parasites, it will now be possible to seek
these parasites in groups of humans that are in contact with
African Apes.
In conclusion, the data gathered from a limited molecular
analysis of a modest number of chimpanzee blood samples have
not only significantly added to our knowledge of Plasmodium in our
closest relatives, bonobos and chimpanzees, but also provided
tantalizing insights into the evolutionary history of the malaria
parasites of humans. We urge the scientific and the wildlife
conservation communities to devote some resources to archive the
parasites of Great Apes, which are at present likely to remain only
amenable to molecular investigations, and to develop in vitro and/
or ex-vivo methods to preserve and maintain them. These studies
might provide novel approaches that could help control and
eventually eradicate pathogens that have long exacted devastating
global health, economic and social burdens.
Methods
Samples
Ethics statement.
in the DRC were made during routine annual medical check-ups.
Authorization for the samples collected in the DRC was obtained
from the Direction de la Conservation de la Nature et Organe de
gestion de la CITES at the Ministe `re de l’Environnement,
Conservation de la nature et Tourisme (DR), and the use of
samples for scientific investigations was approved (CITES E0909/
07). Specific authorization was also granted to ‘‘Les Amis des
Bonobos du Congo’’ by the Ministe `re de la Recherche Scientifique
(DRC). The few drops of blood from the chimpanzees at the
Kibale National Park (Uganda) were obtained non-invasively: one
in the course of post-mortem examination, the others from blood
that dripped from wounds; collection of blood samples from the
chimpanzees on Ngamba Island Chimpanzee Sanctuary (Uganda)
were also conducted during routine annual medical check-ups;
DNA extraction and preliminary PCR analysis were performed in
Uganda. Authorization to use the DNA extracted from the
samples for the purposes of genetic analyses of Plasmodium parasites
that might be present was granted by the Uganda Wildlife
Authority and the Uganda National Council for Science and
Technology. The animal work was conducted according to
relevant national and international guidelines. In all cases, the
animals were not subjected to any experimental procedures, and
the blood samples were obtained from aliquots collected
independently by veterinarians carrying out routine medical
examination. After consideration of the protocols of the study,
theArizonaState University
considered that the proposed molecular analyses of parasite
DNA did not require formal approval. The Institutional Review
Collections of blood samples from animals
InstitutionalReview Board
Board of the Muse ´um National d’Histoire Naturelle also
considered it unwarranted to seek formal approval for the
genetic analysis of parasites present in material collected non-
invasively and/or in an aliquot of samples collected during routine
medical care of animals.
Chimpanzees, Uganda.
Blood samples were collected on
EDTA from three, wild, eastern chimpanzees (Pan troglodytes
schweinfurthii), members of the Kanyawara community in Kibale
National Park in western Uganda. A team led by S. Krief closely
monitors the behaviour and health status of the Kanyawara
chimpanzees. The blood samples have been opportunistically
collected from one adult female (named NL) found dead on 20 Jan
2007, and from blood that dripped from wounds of an adolescent
female (named JK) found caught in a snare on the 24 Oct 2006,
and from those of another adolescent female (named OK) found
injured on 30 Sep 2006. The samples were kept at 280uC until
DNA extraction.
Blood samples were collected on EDTA in 2005 from thirty-
eight semi-captive chimpanzees (Pan troglodytes schweinfurthii) at the
Ngamba Island Chimpanzee Sanctuary situated on Lake Victoria
close to Kampala in Uganda. The blood was collected under
general anaesthesia during the routine annual health check
monitoring. The samples were kept at 280uC at the Uganda
Virus Research Institute (Entebbe, Uganda) until DNA extraction.
Chimpanzees, DRC.
Eight orphan Pan troglodytes troglodytes
from the DRC were sampled immediately after rescue between
2003 and 2006.
Bonobos, DRC.
Blood samples were collected from 42
bonobos (Pan paniscus) that were kept at the Lola ya Bonobo
Sanctuary, on the outskirts of Kinshasa in the Democratic
Republic of Congo. The samples were obtained in 2007 as part
of the routine annual health monitoring of 20 females and 22
males (age from 2 to 22 years old). The health status of each
animal was scored on a scale of 1 to 3 (1=good; 2=medium;
3=bad). 21 animals were scored 1, 18 were scored 2 and three
were scored 3. Cough symptoms were noted in 19 individuals.
Body temperatures ranged from 35.4uC to 37.7uC, but neither of
these two parameters were correlated with the health score, nor
with the presence of Plasmodium as detected by PCR. None of the
animals suffered from diarrhoea, nor was blood found in the urine
samples collected.
DNA extraction, amplification protocols and sequencing
strategies
For all samples, genomic DNA was extracted from aliquots of
200 ml of whole blood using the Qiagen DNeasy Blood and Tissue
Kit (Qiagen, Germany), and the DNA obtained resuspended in
200 ml of buffer. Blood smears were not available for microscopic
examination, thus parasite levels were estimated using PCR
analysis of a 10-fold serial dilution series of the DNA purified from
the positive samples. The nested PCR detection assay used was
based on the small subunit ribosomal RNA gene (ssrRNA), using
oligonucleotide primers that were specific to, and conserved in, all
known Plasmodium species [18]. This established that the parasite
burdens in these animals were very low (,10–100 parasite per ml
of blood, and in one case ,1000 parasites per ml).
Approximately 5,800 bp (out of 6,000) of the parasites’
mitochondrial genome were amplified using the oligos Forward
59-GAGGATTCTCTCCACACTTCAATTCGTACTTC
Reverse 59-CAGGAAAATWATAGACCGAACCTTGGACTC
with Takara LA TaqTMPolymerase (TaKaRa Takara Mirus
Bio), (1 cycle 94uC for 1 min, then 30 cycles of 94uC for 30 sec
and 68uC for 7 min2 1 cycle 72uC for 10 min). PCR products
were cloned in the PGemH-T vector (Promega). In the case of the
and
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org9 February 2010 | Volume 6 | Issue 2 | e1000765

Page 10

mitochondrial genome, we report sequences deposited in Gen-
Bank (Accession numbers are in parentheses following species
name) for the Asian macaque parasites P. inui strain Taiwan II
(GQ355483), P. inui strain Leaf Monkey II (GQ355482), and for P.
brasilianum (GQ355484) from South American primates. Other
sequences were reported in other studies: P. inui Mulligan
(AB354572),
P. fieldi
(AB354574),
AY800109), P. knowlesi (NC_007232), P. cynomolgi (AY800108), P.
fragile (AY722799) and P. coatneyi (AB354575); P. hylobati
(AB354573) from gibbons, P. simium (AY800110), P. gonderi from
African monkeys (AY800111), and the parasites of humans P. ovale
(AB354571) and P. malariae (AB354570). Additional information
about these species, including their description, basic biology,
geographic distribution and host-range can be found elsewhere
[13]. Additional sequences of Plasmodium mitochondrial genomes
were obtained from the GenBank (Accession numbers are in
parentheses following species name): the avian malarial parasites
P. gallinaceum (NC_008288), P. juxtanucleare (NC_008279), and P.
relictum (AY733088–AY733090); the rodent malarial parasites P.
yoelii (M29000), P. berghei (AF014115), P. chabaudi (AF014116); the
non-human primate malarial parasite P. reichenowi (NC_002235);
the human malarial parasite P. falciparum (AY282930) and P. vivax
(AY598140).Theavian parasite
(NC_009336) was used as outgroup.
The gene encoding dihydrofolate reductase-thymidylate syn-
thase (dhfr-ts) from P. falciparum or related species in samples
collected from chimpanzees in Uganda and bonobos in the DRC
was obtained as two overlapping fragments amplified by nested
PCR using the following primer pair for the primary reaction:
Pfdhfrts-F59-ATGATGGAACAAGTCTGCGACGTTTTCG
and Pfdhfrts-R59-GCAGCCATATCCATTGAAATTTTTT-
CATG, (2.5 mM Mg2+, annealing at 58uC) The two separate
secondary reactions were initiated with 1 ml of the product from
the primary reaction using the following primer pairs Pfdhfrts-F
and Pfdhfrts-NR 59-GGGAAATATTGACTTAAATCAAATT-
TC (1.5 mM Mg2+, annealing at 58uC) that amplifies the fragment
coding for the DHFR and linker domains, or Pfdhfrts-NF 59-
CAAAGTGATCGAACGGGAGTAGGTG
(3.5 mM Mg2+, annealing at 58uC) that amplifies the fragment
encoding the TS domain. All reactions were initiated with 1 ml of
template (equivalent to ca. 1 ml of whole blood) in a total reaction
volume of 40 ml (final concentrations of 125 mM dNTP, 250 nM
of each oligo, and 2 units/100 ml AmpliTaq polymerase), with the
following cycling conditions: 95uC for 5 min, then 30 cycles of
2 min annealing (see above for temperatures used for each primer
set), 2 min extension at 72uC and 1 min denaturation at 94uC,
after a final annealing step followed by a 5 min extension step, the
reaction temperature was brought down to 25uC before storage at
220uC.
The gene encoding the dhfr-ts from parasites related to P.
falciparum in samples collected from chimpanzees in the DRC, was
amplifiedusing the primers:
CAAGTCTGCGand Reverse 59-TTAAGCAGCCATATC-
CATTG. The PCR conditions were: a partial denaturation at
94uC for 3 min and 35 cycles with 1 min at 94uC, 1 min at 53uC–
55uC and 2 min extension at 72uC, a final extension of 10 min
was added in the last cycle. Aligning dhfr-ts sequences among
distantly related species of Plasmodium was difficult due to several
insertions-deletions. We performed two analyses, one including
only P. falciparum-like sequences on 1789 bp and a second
including P. gallinaceum (AY033582), P. chabaudi (M30834), and P.
yoelii (XM_719562) with only 1690 bp.
The fragment encoding the block 3 polymorphic domain of
merozoite surface protein 2 (msp2) from P. falciparum or related
P. simiovale
(AB434920,
Leucocytozoon sabrazesi
andPfdhfrts-R
Forward59-ATGATGGAA-
species in samples collected from chimpanzees in the Uganda and
bonobos in the DRC was by nested PCR amplification using the
following primer pairs: primary reaction M2-P1 59-GAAGG-
TAATTAAAACATTGTC and M2-P2 59-GAGGGATGTTG-
CTGCTCCACAG, and a secondary reaction were initiated with
1 ml of the product from the primary reaction using M2-N1 59-
CTAGAACCATGCATATGTCC
TAAGGAGAAGTATG. All reactions were initiated with 1 ml
of template in a total reaction volume of 40 ml (final concentrations
of 1.0 mM Mg2+, 25 mM dNTP, 250 nM of each oligo, and 2
units/100 ml AmpliTaq polymerase), with the following cycling
conditions: 95uC for 5 min, then 30 cycles of 30 sec annealing at
50uC, 1 min extension at 72uC and 30 sec denaturation at 94uC,
after a final annealing step followed by a 5 min extension step, the
reaction temperature was brought down to 25uC before storage at
220uC.
In the majority of cases these sequences were derived from two
or more independent amplifications. All the sequences obtained
and reported here were submitted to GenBank (Accession
numbers and the corresponding gene fragments are presented in
the Table S1).
and M2-N259-GAGTA-
Phylogenetic analyses
Initial Neighbor Joining (NJ) trees were inferred under Tamura-
3P model of nucleotide substitution [34] in Mega4 [35].
Maximum likelihood (ML) search of a tree topology was
implemented in PAML4 [36] under a General Time Reversible
(GTR) + I + C4substitution model, chosen based on likelihood
ratio tests [37], and employing the NJ method to generate an
initial tree. Bayesian support for the nodes was inferred in
MRBAYES [38], under a General Time Reversible (GTR) + I +
C4substitution model, using 4 Markov chains and 10,000,000
Markov Chain Monte Carlo (MCMC) steps, discarding the first
3,000,000 steps (30%) as a burn-in. Sampling was performed every
500 generations. Mixing of the chains and convergence was
properly checked after runs. The recovered ML and Bayesian
trees were identical.
Although a total of eight distinct near-complete mitochondrial
genomes were obtained from the parasites found in the bonobos,
we stringently excluded any where the accuracy of the sequence
obtained was not optimal, thus only 4 sequences were included in
the phylogenetic and other analyses.
Estimation of divergence times
The mutation rates that have been widely used in Plasmodium
evolutionary genetic studies have used the Homo/Pan divergence
time as a point of calibration for the falciparum-reichenowi divergence
(for e.g. [9,39]). However, using such rates will make whatever
argument we put forward about the origin of P. falciparum and P.
reichenowi circular. Thus, in order to avoid tautological arguments,
we estimated mutation rates by considering time of divergence
under two scenarios: i) the Plasmodium currently found in macaques
radiated with the genus Macaca [5], which allows the estimation of
a substitution rate of 2.83E-09 subs/site/year; ii) assuming that P.
gonderi and macaque parasites co-diverged when Macaca branched
from other Papionina [25], which allows the estimation of a
mutation rate of 5.07E-09. It is worth noting that these mutation
rates were not particularly off other estimates obtained for
Plasmodium mitochondrial genomes (for e.g. [9]) indicating that,
at least as first approximations, these scenarios are reasonable.
We employed a Bayesian approach with a relaxed clock [40] as
implemented in BEAST [24]. The estimations of times of
divergence for the clades of interest were performed by running
4 independent runs of 10,000,000 Markov Chain Monte Carlo
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org10February 2010 | Volume 6 | Issue 2 | e1000765

Page 11

(MCMC) steps after discarding the first 30% of the steps as burn-
in, and sampling being performed every 1,000 steps. Previous runs
showed that this burn-in was sufficient for the chains to reach
stationary distribution. For the relaxed version of the clock we
assumed a lognormal distributed clock for the mutation rate, with
an average mutation rate according to each scenario mentioned in
the previous paragraph, under a Yule prior for the simulation of
the lineages during tree reconstruction. Results of the runs were
analyzed with Tracer v1.4 [41] and estimates of average
divergence times and confidence intervals were recovered. We
checked the adequate mixing of the MCMC chains for each run in
and the effective sample size of the estimates, making sure that all
of them were above 100. The runs were combined in Tracer to
generate the final estimates of time of divergence and their 95%
confidence intervals.
GenBank Accession numbers submitted with this
manuscript
The following sequences were submitted to the GenBank: Near-
complete Plasmodium mitochondrial genomes from parasites of
chimpanzees, bonobos and other primate hosts GQ355468–
GQ355486; msp2 block 3 from parasites collected from Pan t.
schweinfurthii (Uganda) GU075719–GU75726, and from parasites
collected from Pan t. troglodytes (DRC) GU131994–GU131995;
dhfr-ts sequences from parasites collected from Pan t. troglodytes
(DRC) GQ369532–GQ369536; P. falciparum msp2 block 3
sequences from bonobo samples GU075709–GU075718; P.
falciparum dhfr-ts
partialsequences
GQ859592–GQ859595).
from bonobosamples
Supporting Information
Figure S1
chrome b fragment. NJ tree on 520 bp of cytochrome b using
Tamura 3 parameter model, 1000 bootstrap pseudo-replications.
Phylogenetic tree of Plasmodium based on a cyto-
Haplotypes represented in bold are as follows: Plasmodium species
that infect humans (black), the haplotypes we present in the
manuscript (blue), the haplotype proposed as P. gaboni by Ollomo et
al. [17] (purple), and the haplotypes presented as P. reichenowi by
Rich et al. 2009 [12] (red). The species we propose, P. billbrayi and
P. billcollinsi, are clearly set apart despite the relatively poor
resolution inherent to using a short DNA sequence. For the
‘‘reichenowi-’’ haplotypes (red), ‘‘reichenowi-Rafiki1’’ and ‘‘reich-
enowi-Rafiki2’’ might belong to P. reichenowi, but three of the
others cluster closely with P. billcollinsi and another three cluster
more loosely with the P. billbrayi/P. gaboni group.
Found at: doi:10.1371/journal.ppat.1000765.s001 (0.35 MB PDF)
Table S1
sequences (name in bold and GenBank Accession number in
parentheses).
Found at: doi:10.1371/journal.ppat.1000765.s002 (0.09 MB PDF)
Origin of the blood samples that yielded Plasmodium
Acknowledgments
We are very grateful to the Uganda Wildlife Authority and the Uganda
National Council for Science and Technology for granting us permission to
conduct this research. We also extend our gratitude to Makerere University
Biological Field Station for logistic support they provided. We are thankful
to the Field Assistants, Japan Musinguzi and Ronald Musinguzi for their
help during the fieldwork. LR and GS are currently part of an official
collaboration between SIgN/A*STAR and INSERM (Laboratoire Inter-
national Associe ´, INSERM).
Author Contributions
Conceived and designed the experiments: SK AAE MAP MC OEC ACG
TFM LR GS. Performed the experiments: SK AAE MAP LM OEC JMC
CL FL ACG GS. Analyzed the data: SK AAE MAP CA MH AF JMK
JMK MC OEC JMC CL ACG TFM LR GS. Contributed reagents/
materials/analysis tools: SK AAE MAP LM CA MH AF JMK JMK MC
OEC JMC CL FL ACG TFM LR GS. Wrote the paper: SK AAE MAP
OEC GS.
References
1. Escalante AA, Ayala FJ (1995) Evolutionary origin of Plasmodium and other
Apicomplexa based on rRNA genes. Proc Natl Acad Sci USA 92: 5793–5797.
2. Qari SH, Shi Y-P, Pieniazek NJ, Collins WE, Lal AA (1996) Phylogenetic
relationship among the malaria parasites based on small subunit rRNA gene
sequences: monophyletic nature of the human malaria parasite, Plasmodium
falciparum. Mol Phylogenet Evol 6: 157–165.
3. Escalante AA, Barrio E, Ayala FJ (1995) Evolutionary origin of human and
primate malarias: evidence from the circumsporozoite protein gene. Mol Biol
Evol 12: 616–626.
4. Escalante AA, Freeland DE, Collins WE, Lal AA (1998) The evolution of
primate malaria parasites based on the gene encoding cytochrome b from the
linear mitochondrial genome. Proc Natl Acad Sci USA 95: 8124–8129.
5. Escalante AA, Cornejo OE, Freeland DE, Poe AC, Durrego E, et al. (2005) A
monkey’s tale: the origin of Plasmodium vivax as a human malaria parasite. Proc
Natl Acad Sci USA 102: 1980–1985.
6. Perkins SL, Schall JJ (2002) A molecular phylogeny of malarial parasites
recovered from cytochrome b gene sequences. J Parasitol 88: 972–978.
7. Snow RW, Guerra CA, Noor AM, Hla Yin Mint, Hay SI (2005) The global
distribution of clinical episodes of Plasmodium falciparum malaria. Nature 434:
214–217.
8. Conway DJ, Fanello C, Lloyd JM, Al-Joubori BMA-S, Baloch AH, et al. (2000)
Origin of Plasmodium falciparum malaria is traced by mitochondrial DNA. Mol
Biochem Parasitol 111: 163–171.
9. Joy DA, Feng X, Mu J, Furuya T, Chotivanich KT, et al. (2003) Early origin
and recent expansion of Plasmodium falciparum. Science 300: 318–321.
10. Rich SM, Licht MC, Hudson RR, Ayala FJ (1998) Malaria’s Eve: evidence of a
recent population bottleneck throughout the world populations of Plasmodium
falciparum. Proc Natl Acad Sci USA 95: 4425–4430.
11. Volkman SK, Barry AE, Lyons EJ, Nielsen KM, Thomas SM, et al. (2001)
Recent origin of Plasmodium falciparum from a single progenitor. Science 293:
482–484.
12. Rich SM, Leendertz FH, Xu G, Lebreton M, Djoko CF, et al. (2009) The origin
of malignant malaria. Proc Natl Acad Sci USA.
13. Coatney GR, Collins WE, Warren M, Contacos PG (1971) The primate
malarias. Washington DC: U.S. Government Printing Office. pp 1–366.
14. Garnham PCC (1966) Malaria parasites and other haemosporidia. Oxford:
Blackwell Scientific Publications. pp 1–1114.
15. Dubbeld MA, Kocken CHM, Thomas AW (1998) Merozoite surface protein 2
of Plasmodium reichenowi is a unique mosaic of Plasmodium falciparum allelic forms
and species-specific elements. Mol Biochem Parasitol 92: 187–192.
16. Tanabe K, Sakihama N, Hattori T, Ranford-Cartwright LC, Goldman IF, et al.
(2004) Genetic distance in housekeeping genes between Plasmodium falciparum and
Plasmodium reichenowi and within P. falciparum. J Mol Evol 59: 687–694.
17. Ollomo B, Durand P, Prugnolle F, Douzery E, Arnathau C, et al. (2009) A new
malaria agent in African hominids. PLoS Pathog 5: e1000446. doi:10.1371/
journal.ppat.1000446.
18. Snounou G, Singh B (2002) Nested PCR analysis of Plasmodium parasites.
Methods Mol Med 72: 189–203.
19. Duval L, Nerrienet E, Rousset D, Sadeuh Mba SA, Houze S, et al. (2009)
Chimpanzee malaria parasites related to Plasmodium ovale in Africa. PLoS ONE
4: e5520. doi:10.1371/journal.pone.0005520.
20. Rubio JM, Benito A, Roche J, Berzosa PJ, Garcı ´a ML, et al. (1999) Semi-nested,
multiplex polymerase chain reaction for detection of human malaria parasites
and evidence of Plasmodium vivax infection in Equatorial Guinea. Am J Trop Med
Hyg 60: 183–187.
21. Ryan JR, Stoute JA, Amon J, Dunton RF, Mtalib R, et al. (2006) Evidence for
transmission of Plasmodium vivax among a Duffy antigen negative population in
Western Kenya. Am J Trop Med Hyg 75: 575–581.
22. Bedford T, Hartl DL (2008) Overdispersion of the molecular clock: temporal
variation of gene-specific substitution rates in Drosophila. Mol Biol Evol 25:
1631–1638.
23. Kumar S, Filipski A, Swarna V, Walker A, Hedges SB (2005) Placing confidence
limits on the molecular age of the human-chimpanzee divergence. Proc Natl
Acad Sci USA 102: 18842–18847.
24. Drummond AJ, Rambaut A (2003) BEAST version 1.3 (http://evolve.zoo.ox.ac.
uk/Evolve/Software.html).
25. Mu J, Joy DA, Duan J, Huang Y, Carlton JM-R, et al. (2005) Host switch leads
to emergence of Plasmodium vivax malaria in humans. Mol Biol Evol 22:
1686–1693.
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org11February 2010 | Volume 6 | Issue 2 | e1000765

Page 12

26. Hedges SB, Kumar S, editors (2009) The timetree of life. New York: Oxford
University Press. pp i-555.
27. Becquet C, Patterson N, Stone AC, Przeworski M, Reich D (2007) Genetic
structure of chimpanzee populations. PLoS Genet 3: e66. doi:10.1371/
journal.pgen.0030066.
28. Caswell JL, Mallick S, Richter DJ, Neubauer J, Schirmer C, et al. (2008)
Analysis of chimpanzee history based on genome sequence alignments. PLoS
Genet 4: e1000057. doi:10.1371/journal.pgen.1000057.
29. Yu N, Jensen-Seaman MI, Chemnick L, Kidd JR, Deinard AS, et al. (2003) Low
nucleotide diversity in chimpanzees and bonobos. Genetics 164: 1511–1518.
30. Mobula L, Lilley B, Tshefu AK, Rosenthal PJ (2009) Resistance-mediating
polymorphisms in Plasmodium falciparum infections in Kinshasa, Democratic
Republic of the Congo. Am J Trop Med Hyg 80: 555–558.
31. Verrelli BC, Tishkoff SA, Stone AC, Touchman JW (2006) Contrasting histories
of G6PD molecular evolution and malarial resistance in humans and
chimpanzees. Mol Biol Evol 23: 1592–1601.
32. Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Shamsul SSG, et al.
(2004) A large focus of naturally acquired Plasmodium knowlesi infections in human
beings. Lancet 363: 1017–1024.
33. Cox-Singh J, Davis TME, Lee K-S, Shamsul SSG, Matusop A, et al. (2008)
Plasmodium knowlesi malaria in humans is widely distributed and potentially life
threatening. Clin Infect Dis 46: 165–171.
34. Tamura K (1992) Estimation of the number of nucleotide substitutions when
there are strong transition-transversion and G+C-content biases. Mol Biol Evol
9: 678–687.
35. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599.
36. Yang Z (2007) PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol
Evol 24: 1586–15891.
37. Posada D, Crandall KA (2001) Selecting the best-fit model of nucleotide
substitution. Syst Biol 50: 580–601.
38. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of
phylogenetic trees. Bioinformatics 17: 754–755.
39. Jongwutiwes S, Putaporntip C, Friedman RM, Hughes AL (2002) The extent of
nucleotide polymorphism is highly variable across a 3-kb region on Plasmodium
falciparum chromosome 2. Mol Biol Evol 19: 1585–1590.
40. Drummond AJ, Ho SY, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics
and dating with confidence. PLoS Biol 4: e88. doi:10.1371/journal.
pbio.0040088.
41. Rambaut A, Drummond AJ (2003) Tracer version 1.4 (http://beast.bio.ed.ac.
uk/Tracer).
42. Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks for inferring
intraspecific phylogenies. Mol Biol Evol 16: 37–48.
Parasites of Apes and the Origin of Human Malaria
PLoS Pathogens | www.plospathogens.org12February 2010 | Volume 6 | Issue 2 | e1000765