Role of cationic channel TRPV2 in promoting prostate cancer migration and progression to androgen resistance.

Abstract

Castration resistance in prostate cancer (PCa) constitutes an advanced, aggressive disease with poor prognosis, associated with uncontrolled cell proliferation, resistance to apoptosis, and enhanced invasive potential. The molecular mechanisms involved in the transition of PCa to castration resistance are obscure. Here, we report that the nonselective cationic channel transient receptor potential vanilloid 2 (TRPV2) is a distinctive feature of castration-resistant PCa. TRPV2 transcript levels were higher in patients with metastatic cancer (stage M1) compared with primary solid tumors (stages T2a and T2b). Previous studies of the TRPV2 channel indicated that it is primarily involved in cancer cell migration and not in cell growth. Introducing TRPV2 into androgen-dependent LNCaP cells enhanced cell migration along with expression of invasion markers matrix metalloproteinase (MMP) 9 and cathepsin B. Consistent with the likelihood that TRPV2 may affect cancer cell aggressiveness by influencing basal intracellular calcium levels, small interfering RNA-mediated silencing of TRPV2 reduced the growth and invasive properties of PC3 prostate tumors established in nude mice xenografts, and diminished expression of invasive enzymes MMP2, MMP9, and cathepsin B. Our findings establish a role for TRPV2 in PCa progression to the aggressive castration-resistant stage, prompting evaluation of TRPV2 as a potential prognostic marker and therapeutic target in the setting of advanced PCa.

Full text

Page 1

2010;70:1225-1235. Published OnlineFirst January 26, 2010. Cancer Res


Michaël Monet, V'yacheslav Lehen'kyi, Florian Gackiere, et al.
Migration and Progression to Androgen Resistance
Role of Cationic Channel TRPV2 in Promoting Prostate Cancer



Updated Version
10.1158/0008-5472.CAN-09-2205 doi:
Access the most recent version of this article at:


Cited Articles
http://cancerres.aacrjournals.org/content/70/3/1225.full.html#ref-list-1
This article cites 40 articles, 10 of which you can access for free at:
Citing Articles
http://cancerres.aacrjournals.org/content/70/3/1225.full.html#related-urls
This article has been cited by 8 HighWire-hosted articles. Access the articles at:


E-mail alerts
related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
.permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 2

Tumor and Stem Cell Biology
Role of Cationic Channel TRPV2 in Promoting Prostate
Cancer Migration and Progression to Androgen Resistance
Michaël Monet1,2, V'yacheslav Lehen'kyi1,2, Florian Gackiere1,2, Virginie Firlej3, Matthieu Vandenberghe1,2,
Morad Roudbaraki1,2, Dimitra Gkika1,2, Albin Pourtier4, Gabriel Bidaux1,2, Christian Slomianny1,2,
Philippe Delcourt1,2, François Rassendren5, Jean-Pierre Bergerat6, Jocelyn Ceraline7,
Florence Cabon3, Sandrine Humez1,2,8, and Natalia Prevarskaya1,2
Abstract
Castration resistance in prostate cancer (PCa) constitutes an advanced, aggressive disease with poor
prognosis, associated with uncontrolled cell proliferation, resistance to apoptosis, and enhanced invasive
potential. The molecular mechanisms involved in the transition of PCa to castration resistance are ob-
scure. Here, we report that the nonselective cationic channel transient receptor potential vanilloid 2
(TRPV2) is a distinctive feature of castration-resistant PCa. TRPV2 transcript levels were higher in patients
with metastatic cancer (stage M1) compared with primary solid tumors (stages T2a and T2b). Previous
studies of the TRPV2 channel indicated that it is primarily involved in cancer cell migration and not in
cell growth. Introducing TRPV2 into androgen-dependent LNCaP cells enhanced cell migration along with
expression of invasion markers matrix metalloproteinase (MMP) 9 and cathepsin B. Consistent with the
likelihood that TRPV2 may affect cancer cell aggressiveness by influencing basal intracellular calcium le-
vels, small interfering RNA–mediated silencing of TRPV2 reduced the growth and invasive properties of
PC3 prostate tumors established in nude mice xenografts, and diminished expression of invasive enzymes
MMP2, MMP9, and cathepsin B. Our findings establish a role for TRPV2 in PCa progression to the ag-
gressive castration-resistant stage, prompting evaluation of TRPV2 as a potential prognostic marker and
therapeutic target in the setting of advanced PCa. Cancer Res; 70(3); 1225–35. ©2010 AACR.
Introduction
Androgen ablation is initially beneficial to nearly all men
suffering from prostate cancer (PCa) because androgen-
dependentPCacellsundergoapoptoticdeathinducedbysuch
treatment (1). Unfortunately, androgen ablation is only palli-
ative and patients relapse into castration-resistant PCa with
dramatic consequences (2). Indeed, androgen-independent
PCa cells do not enter the programmed cell death pathway
following androgen ablation (3). Thus, the major reason for
the ability of PCa cells to metastasize and kill the patient is
not related to their rate of proliferation but to their extensive
ability to survive once they have been disseminated to a dis-
tantsite(4).Thesecellsrepresentanandrogen-insensitiveand
apoptosis-resistant cell phenotype in the prostate (5), and
their abundance correlates with tumor malignancy, loss of
sensitivitytoandrogens,andpoorprognosis(6,7).Inaddition,
the emergence of castration-resistant phenotype is concomi-
tant with an increase in overall tumorgrowth andprogression
associated with enhanced level of cell migration (8). However,
the molecular and cellular mechanisms controlling hormone
refractoriness, apoptosis resistance, and migration of these
cells are only partially understood (9). Among the different
mechanisms regulating cancer cell migration, those that
involve calcium dependence have been supposed to play
a primary role (10, 11). The family of transient receptor
potential (TRP) cationic protein channels displaying ex-
traordinarily diverse activation mechanisms (12) has re-
cently received increasing attention, in particular, to their
link to human diseases (13–15). Some of these TRP chan-
nels have been reported to be involved in cancerogenesis:
TRPM1 in melanoma (13) and TRPV6 and TRPM8 in PCa
Cancer
Research
Authors' Affiliations:1Institut National de la Santé et de la Recherche
Médicale, U-800, Equipe labellisée par la Ligue Nationale contre le
cancer;2Université des Sciences et Technologies de Lille, Villeneuve
d'Ascq, France;
University Paris-Sud, FRE2944, Epigenetics and Cancer, Institut
André Lwoff, Villejuif, France;4UMR 8161 Institut de Biologie de
Lille Centre National de la Recherche Scientifique/Université
Université Lille 1 et 2/Institut Pasteur de Lille, Lille, France;
5Département de Pharmacologie, Institut de Génomique
Fonctionnelle, Centre National de la Recherche Scientifique UMR
5203, Institut National de la Santé et de la Recherche Médicale
U661, Université Montpellier I, Université Montpellier II, Montpellier
Cedex, France;
3Centre National de la Recherche Scientifique,
6Département d'Onco-Hématologie, Hôpitaux
Universitaires de Strasbourg;7Unité Physiopathologie et Médecine
Translationnelle, Faculté de Médecine, Université de Strasbourg,
Strasbourg, France; and8Université d'Artois, Faculté des Sciences
Jean Perrin, Lens, France
Note: M. Monet and V. Lehen'kyi contributed equally to this work.
CorrespondingAuthor:NataliaPrevarskaya,LaboratoryofCellPhysiology,
Institut National de la Santé et de la Recherche Médicale U800, Bâtiment
SN3, USTL, 59650 Villeneuve d'Ascq, France. Phone: 33-3-20-33-64-23;
Fax: 33-3-20-43-40-66; E-mail: natacha.prevarskaya@univ-lille1.fr.
doi: 10.1158/0008-5472.CAN-09-2205
©2010 American Association for Cancer Research.
www.aacrjournals.org
1225
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 3

(15–17). Among them, the TRP vanilloid 2 (TRPV2) chan-
nel is the one for which the mechanisms of regulation or
the role in carcinogenesis is not known thus far. Recent
studies have shown that mRNA of TRPV2 is expressed in
prostate (18). TRPV2 function may be regulated by some
lysophospholipids identified and known to have a range
of physiologic and pathologic effects, including stimulation
of cancer cell migration (19–21). However, the question re-
mains as to how TRPV2 is involved in tumor development
and progression both in vitro and in vivo to an extremely
aggressive castration-resistant stage and whether it could
be a real hallmark of poor prognosis in patients suffering
from PCa.
Materials and Methods
Cell culture. The androgen-dependent human PCa cell
line LNCaP and androgen-independent human PCa cell lines
LNCaP C4-2, DU145, and PC3 were obtained from the Amer-
ican Type Culture Collection and maintained in culture in
RPMI 1640 (Life Technologies) supplemented with 10% FCS
(Seromed, Poly-Labo), 5 mmol/L L-glutamine (Sigma), and
100 μg/mL kanamycin.
Cells were grown at 37°C in a humidified atmosphere con-
taining 5% CO2. Before fluorescence measurements, the cells
were trypsinized and transferred onto glass coverslips. Cells
were used 2 to 4 d after trypsinization. The medium was re-
placed every 48 h.
Generation of shTRPV2 vectors. Hybridized oligonucleo-
tides were cloned into pSilencer 4.1-CMV-puro vector (Am-
bion) following the manufacturer's instructions and defined
as shTRPV2 I (sense, 5′-GGTAAGACGTGCCTGATGA-3′) and
shTRPV2 II (sense, 5′-TAAGAGTCAACCTCAACTA-3′).
Nucleofection. Transfection of LNCaP or PC3 cells with
TRPV2-GFP or with shTRPV2 I or II was carried out using
Nucleofector (Amaxa GmbH) according to the manufac-
turer's instructions. Briefly, 3 μg of vector were transfected
into 2 millions of trypsinized cells, which then were plated
into a T75 flask or onto the glass coverslips for 72 h.
Small interfering RNA transfection. LNCaP and LNCaP
C4-2 cells were transfected with 50 nmol/L small interfering
RNA (siRNA) against TRPV2 (siTRPV2; synthesized by Dhar-
macon, Inc.) using 6 μL TransIT-TKO transfection reagent
(Mirus, Inc.) following the manufacturer's instructions (see
Table 1 for the siRNA sequence).
Ca2+measurements using Fura-2 acetoxymethyl ester.
Before fluorescence measurements, the cells were trypsinized
and plated onto glass slips. The medium was replaced every
48 h. Cells were used 3 d after trypsinization. The culture me-
dium was replaced by a HBSS solution containing 142 mmol/L
NaCl, 5.6 mmol/L KCl, 1 mmol/L MgCl2, 2 mmol/L CaCl2,
0.34 mmol/L Na2HPO4, 0.44 mmol/L KH2PO4, 10 mmol/L
HEPES, and 5.6 mmol/L glucose. The osmolarity and pH of
this solution were adjusted to 310 mOsm/L and 7.4, respec-
tively. When a calcium-free medium was required, CaCl2was
omitted and replaced by equimolar MgCl2. Dye loading was
achieved by transferring the cells into a standard HBSS solu-
tioncontaining1mmol/LFura-2acetoxymethyl ester(Calbio-
chem) loaded (45 min) for 40 min at 37°C, as described
previously(11),usingaphotomultiplier-basedsystem(Photon
Technologies) and a double-wavelength (340 and 380 nm)
excitation protocol to quantify the absolute value of calci-
um concentration (22). All recordings were made at 37°C.
The cells were continuously perfused with HBSS solution
via a whole-chamber perfusion system. The flow rate of
the whole-chamber perfusion system was set to 1 mL/min
and the chamber volume was 500 mL. The basal Ca2+was
measured using HBSS solutions containing 0 and 2 mmol/L
Ca2+. The relative increase in [Ca2+]cytwas measured follow-
ing consecutive switch from free Ca2+medium to 2 mmol/L
Ca2+medium.
Reverse transcription-PCR. Total mRNA was isolated
from cells as previously described (23). DNA amplification
conditions included an initial denaturation step of 7 min at
95°C; 36 cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C;
and finally 7 min at 72°C. Primers used are listed in Table 1.
Antibody production. Rabbit polyclonal antibody anti-
TRPV2 was produced in the laboratory headed by Dr. Rassen-
dren (Centre National de la Recherche Scientifique UMR
5203, Institut National de la Santé et de la Recherche Médi-
cale U661, Montpellier, France). The polypeptide ASEE-
NYVPVQLLQS corresponding to 740 to 763 amino acids of
the COOH-terminal sequence of the human TRPV2 channel
(NM_016113) was injected into rabbit to produce a polyclon-
al anti-TRPV2 antibody.
Fluorescence experiments. LNCaP cells nucleofected with
TRPV2-GFP were washed twice with PBS and subjected to
fluorescence analysis using a Zeiss LSM 510 confocal micro-
scope and analysis software (AIM 3.2, Zeiss), as previously
described (23).
Western blotting. The experiments were carried out as de-
scribed previously (19). Membranes were reblotted twice:
first with the anti-NSE mouse monoclonal antibody (1:250;
Dako) and then with the anti–β-actin mouse monoclonal an-
tibody (1:500; NeoMarkers).
Migration assay. Cells were seeded onto the top of Trans-
well cell culture inserts with 8.0-μm pore size (Falcon) at a
density of 30,000 per well (24-well format) in serum-free
culture medium. Cells were stimulated to migrate across
the filters by providing 10% FCS as a chemoattractant in
the assay chambers beneath the inserts. After 2 h, almost
two thirds of the cells were adherent to each filter in the
inserts. After 26 h of incubation at 37°C, nonmigratory cells
were removed from the top of the filter by scraping, whereas
cells that had migrated through the filter pores to the lower
face of the inserts were fixed in 4% paraformaldehyde in PBS
and stained with Hoechst (5 mg/L in PBS). Cells under each
filter were counted on five random examination fields (×200)
using a Leica DMIRB. Data are expressed as means of four
wells ± SE.
Cell proliferation assay. Cells were plated at the initial
density of 500 per well for PC3 cells and 2,500 per well for
LNCaP cells in 96-well plates (Poly-Labo). After 48 h, cells
were cultured in the treatment medium (day 0). From day
0, half of the medium was changed daily for each condition.
Monet et al.
Cancer Res; 70(3) February 1, 2010
Cancer Research
1226
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 4

The CellTiter 96 AQueous Non-Radioactive Cell Proliferation
Assay (Promega Corp.) was used to determine the number of
viable cells (11).
Cancer tissue sampling and total RNA extraction. After
informed consent, patients with clear localized T2a and T2b
stages of PCa for whom a prostatectomy has been scheduled,
as well as patients with metastatic PCa having a stage M1
who were previously subjected to androgen ablation therapy,
have been included in a clinical research program (protocol
ID: 2897) funded by the Hôpitaux Universitaires de Stras-
bourg (Strasbourg, France). A total volume of 3 mL of bone
marrow was aspirated at a scintigraphic-indicated metastatic
site. Microscopic observations were made from an aliquot of
each bone marrow aspirate to confirm the presence of meta-
static PCa cells. Total RNAs were extracted from small pieces
of localized tumor by the use of the RNeasy Midi kit (Qiagen)
and from bone marrow aspirates by the use of the QIAamp
RNA Blood kit (Qiagen) according to the manufacturer's pro-
tocol. Nine samples from both localized and metastatic PCa
were used in our study.
Quantitative real-time PCR. Quantitative real-time PCR
of TRPV2 mRNA transcript was done using MESA GREEN
qPCR MasterMix Plus for SYBR Assay (Eurogentec) on the
Bio-Rad CFX96 Real-Time PCR Detection System. The se-
quence of primers is indicated in Table 1. The 18S rRNA gene
was used as an endogenous control to normalize variations
in RNA extractions, the degree of RNA degradation, and var-
iability in RT efficiency. To quantify the results, we used the
comparative threshold cycle method described by Livak and
Schmittgen (24).
Animals, siRNA injection, and tumorigenicity assays.
Studies involving animals, including housing and care, meth-
od of euthanasia, and experimental protocols, were con-
ducted in accordance with the local animal ethical
committee in the Institut André Lwoff in Villejuif, France.
Tumor cells (2 × 106per mouse) were injected s.c. in 50%
(v/v) Matrigel (BD Biosciences) to 6- to 8-wk-old male nude
mice. Once tumors were exponentially growing, mice were
randomized for treatment (at least six animals per group)
and received daily i.p. either siRNA control (siCTL) or
siTRPV2 at a dose of 120 μg/kg diluted in PBS. Mice were
sacrificed after 17 d of treatment, and tumors were dissected
and weighed.
Data analysis. Results were expressed as mean ± SE. Plots
were produced using Origin 7.0 (MicroCal Software, Inc.).
Each experiment was repeated at least three times. n indi-
cates the number of the cells per experiment. N indicates
the number of experiments performed. The Turkey-Kramer
test was used for statistical comparison among means and
differences, and P < 0.05 was considered significant.
Results
TRPV2 channel expression and function in human PCa
cell lines. We have studied the expression of TRPV2 channel
in the androgen-dependent human PCa cell line LNCaP,
the androgen-independent human PCa cell line LNCaP C4-
2 derived from androgen-dependent LNCaP cells, and the
castration-resistant human PCa cell lines DU145 and PC3
(Fig. 1A).
Short hairpin RNA (shRNA) TRPV2 I and II (PC3 shV2 I
and II) were nucleofected into PC3 cells to specifically inhibit
the expression of TRPV2 (Fig. 1B). TRPV2 knockdown with
shTRPV2 I or II in PC3 cells led to significant suppression
of both mRNA and protein of TRPV2 and NSE (Fig. 1B).
We have shown that the proliferation rate of PC3 cells trea-
ted with shTRPV2 I or II evaluated during 6 days is not sta-
tistically different as compared with PC3 pSilencer–treated
cells (N = 4; Fig. 1C). However, the cell migration is decreased
in PC3 cells treated with shTRPV2 I or II (59 ± 11 cells for
PC3 shTRPV2 I and 58 ± 12 cells for PC3 shTRPV2 II, n =
4, N = 4; Fig. 1C) than in PC3 pSilencer cells (89 ± 5 cells,
n = 4, N = 4). The basal [Ca2+]cytin PC3 treated with shTRPV2
I or II is lower (120 ± 13 nmol/L and 110 ± 9 nmol/L, n = 120,
Table 1. List of primers used for RT-PCR amplifications and a siRNA-TRPV2 sequence
5′-forward-3′
5′-reverse-3′
Product size (bp)Accession number
TRPV2 (a)
TRPV2 (b)
NSE
GAPDH
β-Actin
CCGACTCGGAATACACAGAGG
AAAGGGAACAGGTGCCAGTCA
TGAGGGATGGAGACAAACAG
TTCACCACCATGGAGAAGGC
CAGAGCAAGAGAGGCATCCT
siRNA-TRPV2: 5′-UAAGAGUCAACCUCAACUdTdT-3′
TCCCACTGCTTGGTGCAAGCG
TCCCACTGCTTGGTGCAAGCG
CTTGTCGATGGCTTCCTTCAC
GGCATGGACTGTGGTCATGA
GTTGAAGGTCTCAAACATGATC
351
475
553
237
210
NM_016113.3
NM_016113.3
NM_001975.2
NM_002046.3
NM_001101
Primers for quantitative PCR
TRPV2
MMP2
MMP9
Cathepsin B
18S
CGAAGCCGAAAAGGAAGAC
GGAAAGCCAGGATCCATTTT
TTGGTCCACCTGGTTCAACT
CCAACACCAGCAGGCAG
CAGCTTCCGGGAAACCAAAGTC
TCCAGCACACAGGCATCTAC
ATGCCGCCTTTAACTGGAG
ACGACGTCTTCCAGTACCGA
CTGGGCTGCAGGCTCTC
AATTAAGCCGCAGGCTCCACTC
99NM_016113
NM_004530
NM_004994
NM_001908
NR_003286
103
95
99
111
Implication of TRPV2 in Prostate Cancer
Cancer Res; 70(3) February 1, 2010www.aacrjournals.org
1227
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 5

Figure 1. TRPV2 expression and function in PCa cells. A,
expression of TRPV2 mRNA in different PCa cell lines at
the mRNA and protein levels. B, TRPV2 silencing downregulates
NSE expression. PC3 cells were nucleofected with either
pSilencer (PC3 pSil) or shRNATRPV2 I or II (PC3 shTRPV2 I or PC3
shTRPV2 II) for 72 h. C, effects of TRPV2 silencing on cell
proliferation and migration of PC3 cells. Cell proliferation was
measured after 0, 1, 2, 3, or 6 d of transfection with shRNATRPV2 I
or II and compared with PC3 pSilencer cells. Points and columns,
mean; bars, SD. The number of migrating cells was counted in
four fields per Transwell membrane, four membranes counted per
condition (N = 3). *, P < 0.05, compared with control cells. D,
TRPV2 affects basal [Ca2+]cytin PC3 cells (n = 120, N = 4 per
condition). *, P < 0.05, compared with control cells.
Monet et al.
Cancer Res; 70(3) February 1, 2010
Cancer Research
1228
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 6

N = 4, respectively) than control pSilencer–transfected cells
(172 ± 9 nmol/L, n = 120, N = 4) in the presence of Ca2+in
the medium (Fig. 1D). This difference was abolished when
the cells were kept in Ca2+-free medium (data not shown).
TRPV2 channel contributes to hormone refractoriness of
LNCaP C4-2 cells. Semiquantitative reverse transcription-
PCR (RT-PCR) was used to show that LNCaP C4-2 cells
express TRPV2 mRNA in the control (transfected with a
vehicle) or with 50 nmol/L siCTL for 72 hours (Fig. 2A). To
specifically silence TRPV2 mRNA, we transfected LNCaP C4-
2 cells with 50 nmol/L siTRPV2 for 72 hours. We have also
shown that in LNCaP C4-2 cells treated with siTRPV2, the
NSE expression is downregulated (Fig. 2A). A Western blot
experiment was used to confirm that transfection with
50 nmol/L siTRPV2 for 72 hours drastically diminished the
expression of TRPV2 and NSE proteins as compared with
siCTL (Fig. 2B). The basal [Ca2+]cytis lower in LNCaP C4-2
cells transfected with siTRPV2 (77 ± 2 nmol/L, n = 120,
N = 4) than in LNCaP C4-2 cells transfected with siCTL
(102 ± 12 nmol/L, n = 120, N = 4) in the presence of Ca2+
in the medium (Fig. 2C). Our results also show that LNCaP
C4-2 cell migration is drastically decreased in LNCaP C4-2
cells transfected with siTRPV2 (44 ± 2 cells, n = 4, N = 4) than
in LNCaP C4-2 cells transfected with siCTL (73 ± 5 cells,
n = 4, N = 4; Fig. 2D).
The role of TRPV2 channel in PCa aggressiveness. As we
have shown, mRNA and protein of TRPV2 are not expressed
in human PCa cell line LNCaP (Fig. 3A); however, LNCaP
cells nucleofected with TRPV2-GFP (LNCaP TRPV2-GFP)
expressed TRPV2 mRNA as compared with the cells
Figure 2. TRPV2 contributes to the oncogenic potential of LNCaP C4-2 cells. A, TRPV2 silencing downregulates NSE expression. LNCaP C4-2 cells were
transfected with either 50 nmol/L siTRPV2 or siCTL for 72 h or untreated (vehicle) used as a control. B, expression of TRPV2 and NSE proteins in
LNCaP C4-2 cells. LNCaP C4-2 cells were transfected with either 50 nmol/L siTRPV2 or siCTL for 72 h. C, TRPV2 affects basal [Ca2+]cytin LNCaP C4-2 cells
(n = 120, N = 4 per condition). *, P < 0.05, compared with control cells. D, TRPV2 silencing by siTRPV2 decreases LNCaP C4-2 cell migration (N = 3).
*, P < 0.05, compared with control cells.
Implication of TRPV2 in Prostate Cancer
Cancer Res; 70(3) February 1, 2010www.aacrjournals.org
1229
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 7

nucleofected with a control plasmid pSilencer (LNCaP pSi-
lencer). We have shown that the growth of LNCaP cells is
not affected by the presence of TRPV2 channels (N = 4; Fig.
3B) measured during 7 days. The cell migration is strongly
increased in LNCaP TRPV2-GFP cells (46 ± 2 cells, n = 4,
N = 4) than in LNCaP pSilencer cells (34 ± 2 cells, n = 4,
N = 4; Fig. 2D). Basal [Ca2+]cytis higher in LNCaP TRPV2-GFP
cells (167 ± 7 nmol/L, n = 120, N = 4) than in LNCaP pSilencer
(103 ± 6 nmol/L, n = 120, N = 4) in the presence of Ca2+in
the medium (Fig. 3C). Such markers of invasion as cathepsin
B and matrix metalloproteinase (MMP) 9 were shown to
be induced on the expression of TRPV2 in these cells (Fig. 3D).
Induction of TRPV2 expression during transition to
castration-resistant phenotype. A semiquantitative PCR
experiment showed that, under conditions of androgen
deprivation, the expression of TRPV2 mRNA is detected
Figure 3. The effects of TRPV2 overexpression in androgen-dependent LNCaP cells. A, expression of TRPV2 in LNCaP cells nucleofected with
either pSilencer (LNCaP pSil) or TRPV2-GFP for 72 h at the mRNA and protein level using Western blotting and confocal imaging; B, effects of TRPV2
overexpression on LNCaP cell proliferation and migration (N = 3). Points and columns, mean; bars, SD. C, TRPV2-GFP transfection affects basal
[Ca2+]cytin LNCaP cells (n = 120, N = 4 per condition). D, quantitative real-time PCR for LNCaP cells nucleofected with pTRPV2 plasmid as compared with
pcDNA3 plasmid. The expression of TRPV2, MMP2, and cathepsin B is normalized to 18S gene expression. Columns, mean; bars, SD. *, P < 0.05,
compared with control cells.
Monet et al.
Cancer Res; 70(3) February 1, 2010
Cancer Research
1230
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 8

starting from 24 hours (Fig. 4A) and that this expression lasts
for several days of the treatment. We have shown that the
addition of Bt2cAMP and IBMX to the culture medium in-
duces TRPV2 mRNA expression in LNCaP cells after only
8 hours of treatment (Fig. 4B). Further, the siTRPV2 transfec-
tionintothesecellsreducesTRPV2andNSEmRNAexpression
in LNCaP treated with 1 mmol/L Bt2cAMP and 100 μmol/L
IBMX for 6 days (Fig. 4C). We observed that both TRPV2
channel and NSE proteins were expressed (Fig. 4C), being
absent in LNCaP CTL. siTRPV2 transfection of LNCaP cells
treated with Bt2cAMP and IBMX showed the consequent
knockdown of both TRPV2 and NSE proteins. The basal
[Ca2+]cytis higher in LNCaP cells (vehicle) treated with
Bt2cAMP and IBMX than in LNCaP CTL cells (vehicle; 125
Figure 4. The involvement of TRPV2 channel in
androgen ablation of LNCaP cells. A, TRPV2
transcripts are upregulated in LNCaP cells treated with
a steroid-deprived medium. B, TRPV2 transcripts are
upregulated in LNCaP cells treated with 1 mmol/L
Bt2cAMP and 100 μmol/L IBMX (LNCaP + Bt2cAMP +
IBMX). C, effects of siRNA TRPV2 on the mRNA and
protein levels. siRNA TRPV2 (50 μmol/L; siTRPV2)
treatment for 72 h downregulated TRPV2 transcripts as
well as NSE transcripts in LNCaP + Bt2cAMP +
IBMX cells. Nontransfected LNCaP + Bt2cAMP +
IBMX cells (Vehicle) or cells transfected with 50 μmol/L
siRNA CTL (siCTL) for 72 h were used as control.
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
D, basal [Ca2+]cytin LNCaP + Bt2cAMP + IBMX
cells and untreated LNCaP cells (n = 120 per condition,
N = 4). *, P < 0.05.
Implication of TRPV2 in Prostate Cancer
Cancer Res; 70(3) February 1, 2010 www.aacrjournals.org
1231
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 9

± 10 nmol/L and 78 ± 3 nmol/L, n = 120, N = 4 per condition,
respectively) in the presence of Ca2+in the medium (Fig. 4D).
Cell transfection with siCTL does not significantly modify
the basal [Ca2+]cyt(135 ± 10 nmol/L for LNCaP treated with
Bt2cAMP and IBMX and 80 ± 6 nmol/L for LNCaP CTL, re-
spectively, n = 120, N = 4 per condition) in the presence of
Ca2+in the medium. It should be noted that transfection of
LNCaP cells with siTRPV2 had no effect on basal [Ca2+]cyt
(80 ± 3 nmol/L, n = 120, N = 4) in the presence of Ca2+in
the medium. However, in LNCaP treated with Bt2cAMP
and IBMX, the transfection with siTRPV2 significantly de-
creased the [Ca2+]cyt(96 ± 4 nmol/L, n = 120, N = 4) in the
presence of Ca2+in the medium as compared with LNCaP
treated with Bt2cAMP and IBMX and transfected with siCTL.
TRPV2 gene expression increases in PCa metastasis and
is involved in tumor development in vivo. A quantitative
real-time PCR showed that mRNA expression is ∼12 times
higher in metastatic PCa samples than in localized PCa sam-
ples (n = 9 for each condition; Fig. 5A). The most pertinent
question was whether TRPV2 silencing could inhibit tumor
development in vivo. Previously, a RNA interference in vivo
has been used to show that the androgen receptor is still re-
quired for the development of castration-resistant prostate
tumors (25). Similarly, the model of mice bearing xenografted
PC3 cell–provoked tumors has been created. Then, the mice
were treated on a daily basis during 17 days with either siCTL
or siTRPV2 at a dose of 120 μg/kg diluted in PBS. The weight
of tumors was significantly smaller in mice treated with
siTRPV2 than in siCTL-treated animals (Fig. 5B). To search
for the mechanisms that might account for the profound
effect of TRPV2 knockdown on the tumors, such markers of
invasion as MMP2, MMP9, and cathepsin B were shown to
be substantially downregulated on the TRPV2 knockdown
in vivo (Fig. 5C).
Discussion
In the present study, we report three major findings that
allow the understanding of human PCa development and
progression to castration-resistant phenotype. We have
shown for the first time that (a) the PCa tumor progression
to castration-resistant phenotype is characterized by the ex-
pression de novo of a cationic nonselective TRPV2 channel,
which may be served as a reliable prognostic marker of the
most aggressive castration-resistant stage; (b) the role of
TRPV2 in cancer cells derived from castration-resistant tu-
mors is to maintain an elevated level of cytosolic calcium
due to the constitutive activity of the channel; (c) the main
feature of the PCa metastatic cells—their ability to migrate
and invade the adjacent tissues—could be mediated by
TRPV2 activity via the direct regulation of such proteins as
Figure 5. TRPV2 gene expression in PCa metastasis
and solid tumors and the role of TRPV2 in tumor development
in vivo. A, TRPV2 mRNA levels in localized and metastatic
PCa human samples (n = 9 for each condition) were analyzed
by quantitative real-time PCR. Values are calculated as a
ratio to 18S rRNA expression. *, P < 0.05. B, weight of tumors
analyzed after the treatment with siCTL or siTRPV2 during
15 d. *, P < 0.05. C, effects of siTRPV2 treatment on the
mRNA levels of TRPV2, MMP2, MMP9, and cathepsin B in
tumor cells. *, P < 0.05, compared with the corresponding
levels in mice treated with siCT.
Monet et al.
Cancer Res; 70(3) February 1, 2010
Cancer Research
1232
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 10

MMP2, MMP9, and cathepsin B used by the cancer cell to
invade.
The fact that the hormone refractoriness of PCa is featured
by the emergence of malignant cell phenotypes characterized
by uncontrolled proliferation, resistance to apoptosis, and
enhanced potential to invade has led us to the search of
some specific molecular intermediators helping PCa cells
to escape a natural regulation by hormones. In the context
of the present work, we report a nonselective cationic chan-
nel TRPV2 as a unique and distinguished feature of castra-
tion-resistant PCa. As the evidence, TRPV2 is ultimately
expressed in metastatic castration-resistant PCa samples
rather than in localized hormone-responsive PCa tumors. In-
deed, until now, TRPV2 channel has never been associated
with the development and progression of PCa. Unlike some
other TRP channels (e.g., TRPM8 channel), the expression
of TRPV2 channel does not require the presence and/or
activation of an androgen receptor (26). Therefore, it
seems likely that TRPV2 expression being confined to the
castration-resistant phenotype, which is no longer under
AR control, may be used by the cancer cell to increase its
oncogenic potential.
It has been previously shown that TRPV2 channels were
constitutively activated in TRPV2-overexpressing cell sys-
tems and induced an increase in basal [Ca2+]cyt(27). Our
results show that the basal [Ca2+]cytis higher in hormone-
resistant PCa cell lines, which express TRPV2, as compared
with androgen-dependent LNCaP cell line, which does not
express TRPV2. This increase in calcium is ultimately me-
diated by TRPV2 because, on the one hand, this high level
may be achieved by TRPV2 transfection into LNCaP cells
and, on the other hand, shRNA of TRPV2 prevents calcium
increase. Thus, by increasing basal [Ca2+]cyt, which is appar-
ently temporally and spatially regulated in the cancer cell,
TRPV2 channels contribute to the progression to castration-
resistant phenotype.
The transition of PCa cells to hormone-insensitive pheno-
type is a common feature of human prostate carcinoma (28,
29) and the appearance of neuroendocrine markers is con-
sidered to be associated with a poor prognosis and reduced
long-term survival (30). We have shown that TRPV2 expres-
sion is associated with the NSE expression in PC3 and
LNCaP C4-2 cells. It has been already shown that other neu-
roendocrine cell markers, PGP9.5 and chromogranin A, are
expressed in PCa derived from metastatic (lymph node and
bone) adenocarcinomas, suggesting that these cells had un-
dergone specific PCa neuroendocrine differentiation (31).
This is usually accompanied by the loss of a nuclear andro-
gen receptor (5) or, in the case of LNCaP C4-2, by the loss
of androgen sensitivity (32). Both steroid deprivation and
Bt2cAMP and IBMX treatments were used to restore in
the experimental conditions the consequences of androgen
ablation therapy in men in vivo. Interestingly, both treat-
ments resulted in the expression of TRPV2 channels in
androgen-deprived LNCaP cells, in increase in cytosolic
calcium levels, and in overexpression of NSE. The latter has
already been used as a marker because serum NSE in meta-
static PCa patients who underwent endocrine therapy is sig-
nificantly higher than that in nonmetastatic patients (33).
Our data were confirmed by the clinical in vivo studies using
the biopsies of the patients subjected to hormone ablation
therapy and who finally developed a castration-resistant
metastatic PCa.
TRPV2 was suggested to be a physiologic sensor of hot
temperatures (34). It is also expressed in nonneuronal cells,
such as prostate cells (19, 35), or in human blood cells, sug-
gesting that, in addition to its role as a noxious heat sensor
(34), this channel may encompass other cellular functions
(36). One of such function of TRPV2 in cancer cells is the
control of cell migration. As we have shown, TRPV2 is pri-
marily involved in PCa cell migration and not in cell prolif-
eration. TRPV2 silencing drastically decreased the migration
of the cancer cells derived from castration-resistant tumors
and that TRPV2 overexpression increased cell migration of
androgen-dependent LNCaP cells. Such a promigrative role
of TRPV2 has been also previously shown on macrophage
cells (37). To have an insight into the possible molecular
mechanisms responsible for TRPV2-induced enhanced po-
tential to invade, such markers of invasion as MMP2,
MMP9, and cathepsin B (38–40) were studied. We have
shown that the expression of the above enzymes directly
participating in the process of invasion is strongly depen-
dent on TRPV2 expression. Indeed, the transfection of
TRPV2 channel into androgen-dependent LNCaP cells in-
duces the expression of MMP9 and cathepsin B, and at
the same time, the siRNA knockdown in vivo leads to pro-
gressive downregulation of these markers in the xeno-
grafted tumors.
Moreover, our data obtained in vivo using a nude mice xe-
nograft model show that TRPV2 silencing in mice bearing
TRPV2-expressing PC3 cell tumors significantly decreased
the tumor weight, suggesting that tumors void of TRPV2
channel are likely to undergo necrosis. The fact that siRNA
against particular target does not inhibit cancer cell prolifer-
ation or is implicated in cell survival in vitro, preserving its
strong antitumor effects in vivo, comes from the specific sup-
pression of this cancer cell migration. Indeed, the continuous
cell division inside of the tumor without any possibility to
invade the host in addition to restriction in oxygen and nu-
trition element supply leads eventually to tissue necrosis (see
ref. 41 for review).
Thus, the involvement of TRPV2 in the invasion process by
enhancing cell migration is evident for more aggressive PCa
cells and therefore seems vital for the PCa tumor in general.
In conclusion, we have discovered a new feature of cas-
tration-resistant PCa characterized by de novo expression of
a nonselective cationic TRPV2 channel. The latter has been
shown to manifest its activity via maintaining an elevated
intracellular calcium concentration. As a result of TRPV2
function, it contributes to enhanced cancer cell migration by
induction of key proteases—MMP2, MMP9, cathepsin B—and
is necessary for castration-resistant tumor development and
progression, as we have shown in vivo. Thus, TRPV2 channel
could be a prospective prognostic marker and potential ther-
apeutic target for future interventions to increase the life
expectancy of the patients.
Implication of TRPV2 in Prostate Cancer
Cancer Res; 70(3) February 1, 2010 www.aacrjournals.org
1233
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 11

Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Acknowledgments
We thank Thierry Capiod, Etienne Dewailly, and Gilbert Lepage for helpful
advices.
Grant Support
Ministère de l'Education Nationale, Association pour la Recherche sur le
Cancer, Institut National de la Santé et de la Recherche Médicale, and Ligue
Nationale Contre le Cancer.
The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 6/16/09; revised 11/19/09; accepted 11/20/09; published
OnlineFirst 1/26/10.
References
1.
Kyprianou N, English HF, Isaacs JT. Programmed cell death during
regression of PC-82 human prostate cancer following androgen ab-
lation. Cancer Res 1990;50:3748–53.
Crawford ED. Combined androgen blockade. Urology 1989;34:22–6,
discussion 46–56.
Denmeade SR, Lin XS, Isaacs JT. Role of programmed (apoptotic)
cell death during the progression and therapy for prostate cancer.
Prostate 1996;28:251–65.
Berges RR, Vukanovic J, Epstein JI, et al. Implication of cell kinetic
changes during the progression of human prostatic cancer. Clin
Cancer Res 1995;1:473–80.
Krijnen JL, Janssen PJ, Ruizeveld de Winter JA, van Krimpen H,
Schroder FH, van der Kwast TH. Do neuroendocrine cells in human
prostate cancer express androgen receptor? Histochemistry 1993;
100:393–8.
Cussenot O, Villette JM, Cochand-Priollet B, Berthon P. Evaluation
and clinical value of neuroendocrine differentiation in human prostat-
ic tumors. Prostate Suppl 1998;8:43–51.
Jongsma J, Oomen MH, Noordzij MA, et al. Kinetics of neuroendo-
crine differentiation in an androgen-dependent human prostate xe-
nograft model. Am J Pathol 1999;154:543–51.
Grobholz R, Griebe M, Sauer CG, Michel MS, Trojan L, Bleyl U. In-
fluence of neuroendocrine tumor cells on proliferation in prostatic
carcinoma. Hum Pathol 2005;36:562–70.
Vashchenko N, Abrahamsson PA. Neuroendocrine differentiation in
prostate cancer: implications for new treatment modalities. Eur Urol
2005;47:147–55.
10. Amorino GP, Parsons SJ. Neuroendocrine cells in prostate cancer.
Crit Rev Eukaryot Gene Expr 2004;14:287–300.
11. Humez S, Monet M, Legrand G, Lepage G, Delcourt P, Prevarskaya
N. Epidermal growth factor-induced neuroendocrine differentiation
and apoptotic resistance of androgen-independent human prostate
cancer cells. Endocr Relat Cancer 2006;13:181–95.
12. Alexander SP, Mathie A, Peters JA. Guide to receptors and channels
(GRAC),2ndedition(2007revision).BrJPharmacol2007;150Suppl1:
S1–168.
13. Duncan LM, Deeds J, Hunter J, et al. Down-regulation of the novel
gene melastatin correlates with potential for melanoma metastasis.
Cancer Res 1998;58:1515–20.
14. Prawitt D, Enklaar T, Klemm G, et al. Identification and characteriza-
tion of MTR1, a novel gene with homology to melastatin (MLSN1)
and the trp gene family located in the BWS-WT2 critical region on
chromosome 11p15.5 and showing allele-specific expression. Hum
Mol Genet 2000;9:203–16.
15. Tsavaler L, Shapero MH, Morkowski S, Laus R. Trp-p8, a novel
prostate-specific gene, is up-regulated in prostate cancer and
other malignancies and shares high homology with transient re-
ceptor potential calcium channel proteins. Cancer Res 2001;61:
3760–9.
16. Peng JB, Zhuang L, Berger UV, et al. CaT1 expression correlates
with tumor grade in prostate cancer. Biochem Biophys Res Commun
2001;282:729–34.
2.
3.
4.
5.
6.
7.
8.
9.
17. Lehen'kyi V, Flourakis M, Skryma R, Prevarskaya N. TRPV6 channel
controls prostate cancer cell proliferation via Ca(2+)/NFAT-depen-
dent pathways. Oncogene 2007;26:7380–5.
18. Wang HP, Pu XY, Wang XH. Distribution profiles of transient receptor
potential melastatin-related and vanilloid-related channels in prostat-
ic tissue in rat. Asian J Androl 2007;9:634–40.
19. Monet M, Gkika D, Lehen'kyi V, et al. Lysophospholipids stimulate
prostate cancer cell migration via TRPV2 channel activation. Biochim
Biophys Acta 2009;1793:528–39.
20. Park KS, Lee HY, Lee SY, et al. Lysophosphatidylethanolamine
stimulates chemotactic migration and cellular invasion in SK-OV3
human ovarian cancer cells: involvement of pertussis toxin-sensi-
tive G-protein coupled receptor. FEBS Lett 2007;581:4411–6.
21. Pebay A, Bonder CS, Pitson SM. Stem cell regulation by lysopho-
spholipids. Prostaglandins Other Lipid Mediat 2007;84:83–97.
22. Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca2+indi-
cators with greatly improved fluorescence properties. J Biol Chem
1985;260:3440–50.
23. Thebault S, Lemonnier L, Bidaux G, et al. Novel role of cold/
menthol-sensitive transient receptor potential melastatine family
member 8 (TRPM8) in the activation of store-operated channels in
LNCaP human prostate cancer epithelial cells. J Biol Chem 2005;
280:39423–35.
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-ΔΔCT) method. Methods
2001;25:402–8.
25. Compagno D, Merle C, Morin A, et al. SIRNA-directed in vivo silenc-
ing of androgen receptor inhibits the growth of castration-resistant
prostate carcinomas. PLoS One 2007;2:e1006.
26. Bidaux G, Roudbaraki M, Merle C, et al. Evidence for specific
TRPM8 expression in human prostate secretory epithelial cells:
functional androgen receptor requirement. Endocr Relat Cancer
2005;12:367–82.
27. Penna A, Juvin V, Chemin J, Compan V, Monet M, Rassendren FA.
PI3-kinase promotes TRPV2 activity independently of channel trans-
location to the plasma membrane. Cell Calcium 2006;39:495–507.
28. Abrahamsson PA. Neuroendocrine differentiation in prostatic carci-
noma. Prostate 1999;39:135–48.
29. di Sant'Agnese PA, Cockett AT. Neuroendocrine differentiation in
prostatic malignancy. Cancer 1996;78:357–61.
30. Cohen MK, Arber DA, Coffield KS, Keegan GT, McClintock J,
Speights VO, Jr. Neuroendocrine differentiation in prostatic adeno-
carcinoma and its relationship to tumor progression. Cancer 1994;
74:1899–903.
31. Leiblich A, Cross SS, Catto JW, Pesce G, Hamdy FC, Rehman I.
Human prostate cancer cells express neuroendocrine cell markers
PGP 9.5 and chromogranin A. Prostate 2007;67:1761–9.
32. Wu HC, Hsieh JT, Gleave ME, Brown NM, Pathak S, Chung LW.
Derivation of androgen-independent human LNCaP prostatic can-
cer cell sublines: role of bone stromal cells. Int J Cancer 1994;57:
406–12.
33. Kamiya N, Akakura K, Suzuki H, Isshiki S, Komiya A, Ueda T, Ito H.
Monet et al.
Cancer Res; 70(3) February 1, 2010
Cancer Research
1234
American Association for Cancer Research Copyright © 2010
on July 15, 2012cancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205

Page 12

Pretreatment serum level of neuron specific enolase (NSE) as a prog-
nostic factor in metastatic prostate cancer patients treated with en-
docrine therapy. Eur Urol 2003;44:309–14, discussion 314.
34. Caterina MJ, Rosen TA, Tominaga M, Brake AJ, Julius D. A capsaicin-
receptor homologue with a high threshold for noxious heat. Nature
1999;398:436–41.
35. Kowase T, Nakazato Y, Yoko OH, Morikawa A, Kojima I. Immunohis-
tochemical localization of growth factor-regulated channel (GRC) in
human tissues. Endocr J 2002;49:349–55.
36. Saunders CI, Kunde DA, Crawford A, Geraghty DP. Expression of
transient receptor potential vanilloid 1 (TRPV1) and 2 (TRPV2) in hu-
man peripheral blood. Mol Immunol 2007;44:1429–35.
37. Nagasawa M, Nakagawa Y, Tanaka S, Kojima I. Chemotactic peptide
fMetLeuPhe induces translocation of the TRPV2 channel in macro-
phages. J Cell Physiol 2007;210:692–702.
38. Overall CM, Dean RA. Degradomics: systems biology of the protease
web. Pleiotropic roles of MMPs in cancer. Cancer Metastasis Rev
2006;25:69–75.
39. van Kempen LC, Coussens LM. MMP9 potentiates pulmonary me-
tastasis formation. Cancer Cell 2002;2:251–2.
40. Podgorski I, Sloane BF. Cathepsin B and its role(s) in cancer progres-
sion. Biochem Soc Symp 2003:263–76.
41. Jin S, DiPaola RS, Mathew R, White E. Metabolic catastrophe as a
means to cancer cell death. J Cell Sci 2007;120:379–83.
Implication of TRPV2 in Prostate Cancer
Cancer Res; 70(3) February 1, 2010 www.aacrjournals.org
1235
American Association for Cancer Research Copyright © 2010
on July 15, 2012 cancerres.aacrjournals.orgDownloaded from
Published OnlineFirst January 26, 2010; DOI:10.1158/0008-5472.CAN-09-2205