Human coronavirus NL63 open reading frame 3 encodes a virion-incorporated N-glycosylated membrane protein.

Abstract

Human pathogenic coronavirus NL63 (hCoV-NL63) is a group 1 (alpha) coronavirus commonly associated with respiratory tract infections. In addition to known non-structural and structural proteins all coronaviruses have one or more accessory proteins whose functions are mostly unknown. Our study focuses on hCoV-NL63 open reading frame 3 (ORF 3) which is a highly conserved accessory protein among coronaviruses.
In-silico analysis of the 225 amino acid sequence of hCoV-NL63 ORF 3 predicted a triple membrane-spanning protein. Expression in infected CaCo-2 and LLC-MK2 cells was confirmed by immunofluorescence and Western blot analysis. The protein was detected within the endoplasmatic reticulum/Golgi intermediate compartment (ERGIC) where coronavirus assembly and budding takes place. Subcellular localization studies using recombinant ORF 3 protein transfected in Huh-7 cells revealed occurrence in ERGIC, Golgi- and lysosomal compartments. By fluorescence microscopy of differently tagged envelope (E), membrane (M) and nucleocapsid (N) proteins it was shown that ORF 3 protein colocalizes extensively with E and M within the ERGIC. Using N-terminally FLAG-tagged ORF 3 protein and an antiserum specific to the C-terminus we verified the proposed topology of an extracellular N-terminus and a cytosolic C-terminus. By in-vitro translation analysis and subsequent endoglycosidase H digestion we showed that ORF 3 protein is N-glycosylated at the N-terminus. Analysis of purified viral particles revealed that ORF 3 protein is incorporated into virions and is therefore an additional structural protein.
This study is the first extensive expression analysis of a group 1 hCoV-ORF 3 protein. We give evidence that ORF 3 protein is a structural N-glycosylated and virion-incorporated protein.

Full text

Page 1

RESEARCHOpen Access
Human Coronavirus NL63 Open Reading Frame 3
encodes a virion-incorporated N-glycosylated
membrane protein
Marcel A Müller1,2, Lia van der Hoek3, Daniel Voss2, Oliver Bader2, Dörte Lehmann2, Axel R Schulz2,
Stephan Kallies1, Tasnim Suliman4, Burtram C Fielding4, Christian Drosten1*, Matthias Niedrig2
Abstract
Background: Human pathogenic coronavirus NL63 (hCoV-NL63) is a group 1 (alpha) coronavirus commonly
associated with respiratory tract infections. In addition to known non-structural and structural proteins all
coronaviruses have one or more accessory proteins whose functions are mostly unknown. Our study focuses on
hCoV-NL63 open reading frame 3 (ORF 3) which is a highly conserved accessory protein among coronaviruses.
Results: In-silico analysis of the 225 amino acid sequence of hCoV-NL63 ORF 3 predicted a triple membrane-
spanning protein. Expression in infected CaCo-2 and LLC-MK2 cells was confirmed by immunofluorescence and
Western blot analysis. The protein was detected within the endoplasmatic reticulum/Golgi intermediate
compartment (ERGIC) where coronavirus assembly and budding takes place. Subcellular localization studies using
recombinant ORF 3 protein transfected in Huh-7 cells revealed occurrence in ERGIC, Golgi- and lysosomal
compartments. By fluorescence microscopy of differently tagged envelope (E), membrane (M) and nucleocapsid (N)
proteins it was shown that ORF 3 protein colocalizes extensively with E and M within the ERGIC. Using N-terminally
FLAG-tagged ORF 3 protein and an antiserum specific to the C-terminus we verified the proposed topology of an
extracellular N-terminus and a cytosolic C-terminus. By in-vitro translation analysis and subsequent endoglycosidase
H digestion we showed that ORF 3 protein is N-glycosylated at the N-terminus. Analysis of purified viral particles
revealed that ORF 3 protein is incorporated into virions and is therefore an additional structural protein.
Conclusions: This study is the first extensive expression analysis of a group 1 hCoV-ORF 3 protein. We give
evidence that ORF 3 protein is a structural N-glycosylated and virion-incorporated protein.
Background
The human Coronavirus (hCoV)-NL63 constitutes one
of four circulating prototypic human Coronaviruses
(CoV) [1]. HCoV-NL63 infection causes upper and
lower respiratory tract disease and is globally wide-
spread, particularly among children under the age of six
years [2-4]. It was shown to be associated with croup
[5,6].
CoV belong to the Nidovirales. The CoV genome con-
sists of a 27 to 33 kb positive single-stranded RNA
which is 5’-capped and 3’-polyadenylated [7]. The gen-
ome of hCoV-NL63 comprises 27,553 nt and has a gene
organization conserved in all CoV, i.e., gene 1a/b, spike
(S), open reading frame 3 (ORF 3), envelope (E), mem-
brane (M) and the nucleocapsid (N) gene. CoV virions
consist of a nucleocapsid core surrounded by an envel-
ope containing three membrane proteins, S, E, and M.
CoV assemble and bud at membranes of the endoplas-
mic reticulum (ER)-Golgi intermediate compartment
(ERGIC) [8,9]. While the budding site of several CoV
has been localized at the ERGIC, the viral surface pro-
teins can also be found in downstream compartments of
the secretory pathway [8]. M localizes predominantly in
the Golgi apparatus [10,11], S is found along the secre-
tory pathway and at the plasma membrane [12,13], and
E is detected in perinuclear regions, the ER and Golgi
[14-16]. S and M are typically glycosylated and it was
shown that glycosylation plays an important role in the
* Correspondence: drosten@virology-bonn.de
1University of Bonn Medical Centre, Sigmund-Freud-Str. 25, D-53127 Bonn,
Germany
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
© 2010 Müller et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.

Page 2

generation of bioactive protein conformations and influ-
ences fusion activity, receptor binding, and antigenic
properties of CoV [17-20].
In addition to the S, E, M and N protein genes, the
structural gene portion of CoV genomes contains a vari-
able number of accessory ORFs. Because these accessory
ORFs are not shared between different CoV groups,
they are also referred to as group-specific ORFs [21].
Proteins encoded by group-specific ORFs of different
CoV have been shown to influence pathogenesis, virus
replication, or host immune response [21-27]. Others
may be dispensable for virus replication in cultured cells
of primate or rodent origin, as well as in rodent models
[26,28,29].
The ORF 3 is the only accessory ORF conserved in all
CoVs [30]. Most investigations of its functionality have
been done on the example of SARS-CoV ORF 3a. The
SARS-CoV ORF 3a protein is expressed in infected cells
and patient sera contained antibodies reactive with
recombinant ORF 3a antigen. The N-terminal ectodo-
main was able to induce virus-neutralizing antibodies in
rabbits [31]. SARS-CoV ORF 3a protein is a triple-span-
ning membrane protein with a similar topology as the
M protein, and is integrated into virions [32]. Moreover,
truncated forms were discovered for recombinantly and
virally expressed ORF 3a protein which could also be
detected in virions [33]. Unlike the M protein it is not
N-glycosylated but O-glycosylated and it was shown to
interact with E, M and S protein [16,34-36]. Subcellular
localization of ORF 3a protein was found to be at the
Golgi complex and the plasma membrane where it was
also internalized by endocytosis [36]. ORF 3a protein
was shown to induce apoptosis [37] and cell cycle arrest
[38] and to up-regulate expression of fibrinogen in lung
epithelial cells [39]. Although small interfering RNAs
targeting the ORF 3a-specific viral subgenomic RNA
were able to reduce viral replication [40], deletion of
ORF 3a from an infectious cDNA clone had no effect
on viral replication in cell culture and mice [28]. More-
over it has been demonstrated that SARS-ORF 3a pro-
tein forms a homotetramer through inter-protein
disulfide bonds, functionally working as a potassium ion
channel that modulates virus release [41]. Very recently
it was shown that the ORF 3a protein disrupts the archi-
tecture of the Golgi apparatus and might thus be
responsible for the formation of vesicular structures in
which virus replication takes place [42].
SARS-CoV as a member of CoV group 2b (beta) is
only distantly related to the human CoV-NL63, a mem-
ber of group 1b (alpha). For the ORF 3 protein of group
1 (alpha) CoVs investigations have focused on the por-
cine epidemic diarrhea virus (PEDV, group 1b, alpha)
and transmissible gastroenteritis virus (TGEV, group 1a,
alpha) that cause enteropathogenic diarrhea in swine
[43]. It was shown that virulence of these viruses could
be reduced by altering the ORF 3 gene through cell cul-
ture adaptation [44,45]. For hCoV-NL63, preliminary
experiments suggested that deletion of ORF 3 had little
influence on viral replication in cell culture [46]. How-
ever, the closely related hCoV-229E has a homologous
gene named ORF 4 that is split into two ORFs (4a and
4b) in cell culture but maintained in all circulating
viruses. This suggests an in-vivo function that may not
be necessary for viral replication in cell culture [47].
In the present study we characterized the ORF 3 pro-
tein of hCoV-NL63. We analyzed the expression and
subcellular localization of the ORF 3 protein in virus-
infected cells and cells transfected transiently with ORF
3 protein-expressing plasmids. We determined the
topology of the ORF 3 protein, characterized its glycosy-
lation, and showed that the ORF 3 protein is a struc-
tural protein incorporated into viral particles.
Results and Discussion
The hCoV-NL63 genome contains an open reading
frame (ORF 3) situated between the S and E genes (Fig-
ure 1A). Nucleic acid sequence alignments with homo-
logous genes of other CoV from groups alpha, beta and
gamma yield nucleotide identities between 30,3% and
51,9% (Table within Figure 1A). Amino acid alignments
showed highest levels of similarity (62%) and identity
(43%) between hCoV-NL63 ORF 3 protein and the
homologous protein of hCoV-229E [48]. A constant
level of similarity was observed across the whole protein.
In-silico analysis of potential glycosylation sites and
membrane topology suggest properties similar to SARS-
CoV ORF 3a protein (Figure 1B and Table 1). HCoV-
NL63 encodes a 225 aa protein (approximately 26 kDa)
with three putative transmembrane domains at aa posi-
tions 39-61, 70-92 and 97-116, respectively (TMHMM
analysis). It has three potential N-glycosylation sites
(NXS/T) at aa positions 16, 119 and 126, of which prob-
ably only the first is used because the sites at positions
119 and 126 are located inside the predicted transmem-
brane domains. No O-glycosylation sites are predicted.
Nearly half of the protein (108 of 225 aa) forms a
hydrophilic C-terminus. These findings are in concor-
dance with earlier data comparing SARS-CoV 3a-like
CoV proteins [35].
Expression and subcellular localization of ORF 3 protein
in virus-infected cells
To analyze the expression of ORF 3 protein during viral
replication, colon carcinoma cells (CaCo-2) and Rhesus
monkey kidney cells (LLC-MK2) cells were infected
with hCoV-NL63 and an immunofluorescence assay
(IFA) was done after two and four days, respectively. A
rabbit polyclonal antiserum raised against a peptide
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 2 of 12

Page 3

representing the C-terminal aa 211-225 of the predicted
ORF 3 protein yielded fluorescence in the cytoplasm as
shown in Figure 2A and 2B (upper panel). Because colo-
calization of SARS-CoV ORF 3a protein with the
ERGIC has been reported [36,49], the same cells were
counterstained with a murine monoclonal antibody
against the ERGIC53 marker protein. As shown in Fig-
ure 2A and 2B (upper panel) colocalization was
observed in CaCo-2 and LLC-MK2 cells. Because over-
lapping subcellular localization was reported for SARS-
CoV proteins 3a and M [50], it was analyzed whether
hCoV-NL63 ORF 3 and M proteins were located in the
same compartment. As shown in Figure 2B (bottom
panel), a strong colocalization was also seen for anti-
NL63 M and anti-ERGIC53 signals.
Subcellular localization of transfected ORF 3 protein in
human hepatocellular carcinoma cells (Huh-7) cells
After showing that the ORF 3 protein can be found
within the ERGIC compartment in infected cells we
were interested in which other cellular compartments
Figure 1 Characteristics of hCoV-NL63 open reading frame 3 and comparison to homologous genes in other coronaviruses. The
sequence of ORF 3 (GenBank accession no. AY567487.2) was analyzed using BLAST and MEGA4. (A), localization of ORF 3 within the hCoV-NL63
genome and comparison of nucleotide (nt) identity based on multiple sequence alignments with prototype strains of CoV groups alpha, beta,
gamma. Note that IBV ORF 3a and b were fused to one ORF 3ab. (B), Summarized results of in-silico analysis on membrane topology and
glycosylation (refer to Materials and Methods section). Predicted N-linked glycosylation sites are indicated by an “N” at the respective
localizations with an index number indentifying the amino acid position. No O linked glycosylation sites were predicted.
Table 1 Comparison of viral proteins ORF 3 and M of hCoV-NL63 and SARS-CoVa
Viral proteinhCoV-NL63 ORF 3
No. amino acids [size in kDa]225 [26]
No. transmembrane domains
(position)
No. cysteine residues (position)4 (72, 131, 137, 182)
SARS-CoV ORF 3a
274 [31]
3 (34-56, 77-99,103-125)
hCoV-NL63 M
226 [26]
4 (20-38, 43-65, 75-97,
129-151)
4 (54, 67, 90, 180)
SARS-CoV M
221 [25]
3 (15-37, 50-72, 77-99)3 (39-61, 70-92, 97-116)
8 (81, 117, 121, 127, 130,
133, 148, 157)
1 (227b)
3 (158, 63, 85)
No. putative N-glycosylation
sites (position)
No. putative O-glycosylation
sites (position)
3 (16, 119, 126)
3 (3, 19, 188)1 (4c)
-3 (28c, 32c, 267-271)--
aPositions of aa refer to accession no. NC_005831 (hCoV-NL63) and AY278491 (SARS-CoV)
bNot used
cUsage confirmed
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 3 of 12

Page 4

an isolated overexpressed ORF 3 protein can be
detected. Therefore we transfected Huh-7 cells and
stained the ORF 3 protein with the specific antiserum
and co-stained different cellular compartments with spe-
cific antibodies (mouse-anti-ERGIC53, mouse-anti-Golgi
58 K, goat-anti-LAMP-1 for trans-Golgi/Lysosomes). As
shown in Figure 3 the recombinant ORF 3 protein can
be detected in all major compartments of the secretory
pathway (Figure 3A for ERGIC, 3B for Golgi and 3C for
trans-Golgi and lysosomes). These localizations are in
concordance with recently published data on the homo-
logous SARS-CoV ORF 3a protein that is responsible
for Golgi membrane rearrangement [42].
Colocalization of hCoV-NL63 ORF 3 protein with structural
proteins
For SARS-CoV ORF 3a protein, colocalization with the
structural proteins S, E, and M, but only partial colocali-
zation with N has been suggested [36]. To investigate
colocalization of NL63-ORF 3 protein with structural
proteins, an expression plasmid containing ORF 3 with
an N-terminal FLAG-tag epitope was co-transfected
with vectors coding for green fluorescent protein (GFP)
fused to hCoV-NL63 E, M and N proteins, respectively.
Expression of proteins with correct molecular weights
was confirmed by Western blot analysis (data not
shown). The ERGIC compartment was stained in trans-
fected cells as described above. As shown in Figure 4,
GFP-E and GFP-M both showed extensive colocalization
with FLAG-ORF 3 protein. Protein complexes were
localized predominantly within the ERGIC, represented
by white areas in Figure 4. GFP-N had primarily a cyto-
solic distribution but there were small areas of colocali-
zation with FLAG-ORF 3 protein, within the ERGIC
compartment. All experiments were done in Huh-7 cells
supportive of hCoV-NL63 replication, but these same
findings were also confirmed in another cell line, human
embryonic kidney (HEK)-293T (data not shown).
To rule out altered subcellular localization contributed
by the fusion tags on the overexpressed structural pro-
teins, experiments were repeated using FLAG-ORF 3
protein in combination with HA tagged E, M and N
proteins in HEK-293T cells (Figure 4B). Again, colocali-
zation of ORF 3 protein with E and M protein and, to a
far lesser extent, with N protein was seen.
Posttranslational modification of ORF 3 protein
Posttranslational modification of the ORF 3 protein in
hCoV-NL63-infected LLC-MK2 cells was analyzed by
Western blot. The M protein which had a very similar
Figure 2 Subcellular localization of viral proteins in hCoV-NL63
infected CaCo-2 and LLC-MK2 cells by immunofluorescence
assay. Confocal laser scanning microscopy on CaCo-2 (A) and LLC-
MK2 cells (B) infected with hCoV-NL63. Left panels: staining with
anti-ORF 3 and anti-M protein rabbit antisera (only in B) and
detection by fluorescein isothiocyanate (FITC)-labelled goat-anti-
rabbit antibody (green). Middle panels: detection of co-staining of
the same cells with mouse-anti-ERGIC-53 mAB (Axxora) and
detection with rhodamine-labelled goat-anti-mouse antibody.
Yellow signals in merged pictures (right panels) show colocalization.
Bars represent 20 μm.
Figure 3 Subcellular localization study of overexpressed hCoV-
NL63 ORF 3 protein in Huh-7 cells. Confocal laser scanning
microscopy on cells expressing recombinant ORF 3 protein and co-
staining with different antibodies for cellular organelles. Left panels:
staining with rabbit-anti-ORF 3 serum and anti-rabbit-Cy2 (Dianova).
Middle panels from top to bottom: co-staining of cellular organelles
with a mouse-anti-ERGIC53 (A), mouse-anti-Golgi 58 K for the Golgi
(B), goat-anti-LAMP-1 for trans-Golgi Network (TGN) and Lysosomes
(LYS) together with goat (or donkey)-anti-mouse-Cy3 antibodies (C).
Right panels show merged pictures where yellow areas represent
colocalization. Partial colocalizations can be observed with all
organelle markers indicating that the glycoprotein ORF 3 is
processed trans-Golgi. Bars indicate 20 μm.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 4 of 12

Page 5

Figure 4 Subcellular localization of overexpressed hCoV-NL63 proteins in Huh-7 and HEK-293T cells. Confocal laser scanning microscopy
on cells co-expressing GFP-E, GFP-M, GFP-N, respectively, together with FLAG-ORF 3. (A), Huh-7 cells. The green panels on the left show GFP
fluorescence from overexpressed E, M, and N proteins. Red pictures in the next column show Cy3 fluorescence from anti-FLAG staining of
overexpressed FLAG-ORF 3 fusion protein. Blue pictures show Cy5 fluorescence from staining of the ER-Golgi intermediate compartment (ERGIC)
(refer to Materials and Methods section for antibodies and staining technique). Yellow areas in the right hand column represent colocalization of
the GFP-proteins with FLAG-ORF 3 whereas white regions in merged pictures show colocalization of GFP proteins with FLAG-ORF 3 within the
ERGIC. GFP-E and M show excessive colocalization with FLAG-ORF 3 especially within the ERGIC in both cell lines. GFP-N partially colocalizes with
FLAG-ORF 3 mainly within the ERGIC. Analysis was performed with the help of a confocal laser scanning microscope (cLSM 510 Meta, Zeiss). Bars
represent 20 μm. (B), to exclude altered subcellular localization contributed by the fusion tags on the overexpressed structural proteins,
experiments were repeated in HEK-293T cells using FLAG-ORF 3 in combination with HA tagged E, M and N proteins. Bars represent 10 μm.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 5 of 12

Page 6

predicted molecular mass of 26 kDa (Table 1) served as
a control. As expected, the M protein and a protein cor-
responding to ORF 3 protein migrated at corresponding
heights in Western blots (Figure 5A). Both proteins
showed additional bands at slightly higher molecular
mass, consistent with posttranslational modification. In
contrast to virus-infected cells, cells overexpressing ORF
3 protein from plasmid with an N-terminal FLAG epi-
tope showed only a single band in Western blot whose
migration was consistent with the hypothetical unglyco-
sylated form (Figure 5B, left panel). It was assumed that
glycosylation at the predicted N-glycosylation site at
position 16 (Table 1) might be ablated in the overex-
pressed protein, due to presence of the N-terminal epi-
tope tag. Indeed, recombinant ORF 3 (rORF 3) protein
without any tag and overexpressed in the same cells
from the same vector showed both forms, identical to
those observed in virus-infected cells (Figure 5B, right
panel). To determine whether N-terminal glycosylation
was to be expected at position 16, the membrane topol-
ogy of the N-terminus was examined next.
Topology of ORF 3 protein
Based on our in-silico analyses and in agreement with
reports on SARS-CoV ORF 3a protein [36], we hypothe-
sized that the hCoV-NL63 ORF 3 protein N-terminus
reached the ER lumen and was eventually exposed on
the cell surface. For confirmation, N-terminally FLAG-
tagged ORF 3 protein was overexpressed in HEK-293T
cells and stained by IFA using monoclonal antibodies
against the FLAG tag, or alternatively, a polyclonal anti-
body against a peptide representing the ORF 3 protein
C-terminus. As shown in Figure 6, a perinuclear distri-
bution of fluorescence was observed with both antibo-
dies in permeabilized cells. In non-permeabilized cells,
only the anti-FLAG antibody yielded fluorescence at cell
surfaces. Unfortunately, there was no complete overlap
of signals from both antibodies in fully permeabilized
cells in merged fluorescence pictures, most likely due to
additional non-specific recognition of non-viral epitopes
by the polyclonal antibody against the ORF 3 protein C-
terminus. For this reason a clear intracellular localiza-
tion of the C-terminus in relation to the ER/Golgi mem-
brane could not be formally determined. However, it
could be concluded that the N-terminus of the ORF 3
protein was facing towards the extracellular space.
N-glycosylation of in-vitro translated ORF 3
According to in-silico predictions the ORF 3 protein
contained three putative N-glycosylation sites at posi-
tions 16, 119 and 126 (Figure 1B, Table 1). Only posi-
tion 16 was considered a possible N-glycosylation target,
as the other two positions would be located within the
membrane. In a vector expressing ORF 3 protein with a
C-terminal V5 tag, asparagine (N) at position 16 was
changed into glutamine (Q). In-vitro translated35S-radi-
olabelled proteins with and without the exchange were
treated or not treated with endoglycosidase H prior to
SDS-PAGE analysis. SARS-CoV M protein served as the
control because it had been shown previously to be N-
glycosylated exclusively at position four [34]. In-vitro
translated NL63 protein ORF 3 with and without the V5
tag, but not the same protein with an N16Q exchange,
showed a second band of increased molecular weight in
SDS-PAGE that disappeared upon endoglycosidase H
treatment (Figure 7). In the same way as for SARS-CoV
M-protein, deglycosylation did not change the apparent
molecular weight of the lower band, verifying absence of
any further active glycosylation sites.
NL63-ORF 3 protein is a structural viral protein
Our data suggested that the ORF 3 protein was a glyco-
sylated protein that colocalized with structural proteins
in the ERGIC. Protein ORF 3 might thus constitute a
structural protein itself. To assess if the ORF 3 protein
was incorporated into virions, viral particles were puri-
fied by sucrose gradient ultracentrifugation. After
Figure 5 Comparison of ORF 3 protein in viral infection and overexpression by Western blot. (A), LLC-MK2 cells were inoculated with
hCoV-NL63 (MOI 0.01) and analyzed by Western blot after 4 days using antibodies against the ORF 3 protein C-terminus (top) and against M
(bottom). The bands named ORF 30and M0are corresponding to the predicted molecular weights of both proteins (26 kDa). Larger bands ORF
3 g and Mg were assumed to be the result of posttranslational modification. (B, left panel): HEK-293T cells transfected with N-terminally FLAG-
tagged ORF 3 do not show signs of posttranslational modification as observed in (A). (B, right panel): overexpression of ORF 3 protein in the
same system without an N-terminal fusion tag reconstitutes the additional band of higher molecular weight observed in infected cells. The
“mock” lane represents a control transfected with an empty vector.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 6 of 12

Page 7

centrifugation, the gradient was divided into ten frac-
tions and infectivity within each fraction was determined
by plaque assay (Figure 8). Only fractions 4 to 7 corre-
lating with a sucrose density of 35% to 45% contained
infectious particles with a peak of 3.6 × 10E5 PFU/ml in
fraction 5 (sucrose density 40-41%). Subsequent Wes-
tern blot analysis identified the same pattern of accumu-
lation within the gradient for the ORF 3 protein as for
the structural M and N proteins. Anti-actin staining
excluded cellular contamination in these fractions. It
was concluded that hCoV-NL63 ORF 3 protein was
incorporated into viral particles.
Conclusions
The ORF 3 protein and its homologues are conserved
among CoVs [30]. Although identities on nt and aa level
are low, most are predicted to be triple membrane-span-
ning proteins [35]. While it has been suggested that ORF 3
homologues are dispensable for replication in cell culture,
mutations of ORF 3 homologues in transmissible gastro-
enteritis virus (TGEV) and porcine epidemic diarrhea
virus (PEDV) lead to attenuation of virus in-vivo in pig
models [44,51,52]. Because the SARS-ORF 3a protein
underwent positive selective pressure during the human
epidemic in 2002/2003 [53], an important function in-vivo
can be assumed for the SARS-CoV ORF 3a protein as well.
Unfortunately, it remains difficult to characterize in-
vivo functions of hCoV-NL63 ORF 3 protein due to lack
of any animal model. However, it is interesting to note
that across all strains of hCoV-NL63 characterized so
far, there are no mutations in the ORF 3 amino acid
Figure 6 Topology of recombinant FLAG-tagged ORF 3 protein.
Recombinant N-terminal tagged FLAG-ORF 3 protein was transiently
expressed in HEK-293T cells and localization was analyzed by
confocal laser scanning microscopy (cLSM 510 Meta, Zeiss). FLAG-
ORF 3 protein was stained with rabbit-anti-ORF 3 recognizing the C-
terminus and mouse-anti-FLAG for detection of the FLAG-tagged N-
terminus (upper panel). Permeabilized cells (+TritonX100) show
colocalized signals mainly in perinuclear regions for protein ORF 3
C-terminus and N-terminus whereas without permeabilization
(-TritonX100) only FLAG-tagged N-terminus of protein ORF 3 could
be detected at the plasma membrane (lower panel). Bars represent
10 μm.
Figure 7 N-glycosylation of hCoV-NL63 ORF 3 protein. HCoV-
NL63 ORF 3 protein with and without a C-terminal V5 tag, and with
an N16Q exchange in the tagged version was in-vitro translated in
presence of35S-methionine. SARS-CoV M protein without a tag was
translated in the same system as a control. Proteins were digested
with endoglycosidase (Endo H) as indicated below each lane,
subjected to SDS-PAGE, and visualized. Note the removal of the
bands of increased molecular weight for the control and ORF 3
proteins, but not for the ORF 3 protein with an amino acid
exchange at the hypothetical N-glycosylation site. Note also that
extent of size reduction for the SARS-CoV M protein, which is
known to have one N-terminal N-glycosylation site, is the same for
the NL63 ORF 3 protein.
Figure 8 Identification of NL63-ORF 3 protein as a structural
viral protein by sucrose gradient ultracentrifugation. Viral
supernatant was purified via subsequently centrifugation on two
discontinuous and one continuous sucrose gradients of 20% to 60%
(w/v) sucrose. The continuous cushion was divided into ten
fractions as indicated in part (A). After centrifugation of each
fraction through 20% sucrose cushions, the resulting pellets were
analyzed for infectious particles by plaque assays. Resulting virus
titers are indicated on the 20 Y-axis in part (A). (B), fractions 4-8
were subjected to Western blot analysis using specific rabbit
antibodies against ORF 3, M and N protein (1:3000; 1:250,000 and
1:24,000, respectively). To exclude cellular contaminations in the
fractions a Western blot using mouse-anti-actin (1:2,000) was
performed. Note the colocalization of the ORF 3 protein in the
same gradients as the known structural proteins M and N.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 7 of 12

Page 8

sequence [46,54]. Conservation of ORF 3 matches
results by Donaldson et al., showing that virus produc-
tion in human airway epithelium was reduced when the
ORF 3 protein was replaced by GFP [28,46]. It has thus
been suggested that protein ORF 3 might serve func-
tions involved in viral egress which are relevant for
spreading in airway epithelium but not in simpler cell
culture [46].
Results from this study, in particular the subcellular loca-
lization of ORF 3 protein along the secretory pathway
(ERGIC, Golgi, plasma membrane), the colocalization of
NL63-ORF 3 protein with other structural proteins in the
ERGIC and the inclusion of the ORF 3 protein in virions
give support for a hypothetical function within the viral
assembly and budding process. A range of further hypoth-
eses can be derived from earlier investigations into protein
ORF 3 functions. These include antigen decoy functions as
suggested for SARS-CoV ORF 3a [55], interference with
the regulation of expression of NF?B-dependent cytokines
[56,57] and fibrinogen [39], and finally the modulation of S
protein mediated endocytosis [36] or an hypothesized
down-regulation of the expression of S protein on the cell
surface [58].
Materials and methods
Cell culture and materials
Rhesus monkey kidney LLC-MK2 cells (ATCC: CCL-7),
human embryonic kidney HEK-293T cells (ATTC: CRL-
1573), human hepatocellular carcinoma cell line (Huh-7,
JCRB0403 kindly provided by Antoine A. F. de Vries,
LUMC, Leiden) and colon carcinoma CaCo-2 cells
(ATCC: HTB-37) were grown at 37°C and 5% CO2in
Dulbecco’s Modified Eagles Medium (DMEM; Gibco,
Karlsruhe, Germany) containing 10% fetal calf serum, 2
mM L-glutamine and 25 U of penicillin/ml and 25 U
streptomycin/ml (PAA Laboratories, Linz, Austria). All
cells were tested negative for mycoplasms by PCR as
described elsewhere [59]. If not stated otherwise materi-
als were provided from Roth, Karlsruhe, Germany.
Virus infections with hCoV-NL63 and plaque assay
For virus stock production either CaCo-2 or LLC-MK2
cells were inoculated with hCoV-NL63 (8thpassage
Amsterdam strain I; accession no. NC_005831) at a multi-
plicity of infection (MOI) of 0.01 and infected cells were
cultured at 37°C and 5% CO2for five to seven days before
harvesting. After centrifugation at 6,000 × g for 10 min
supernatant was aliquoted and stored at -80°C. Titers were
determined by plaque assay performed as described else-
where [60]. Briefly, after incubation of the plaque assays at
37°C and 5% CO2for four days cells were fixed with 4%
formaldehyde, stained with crystal violet solution and
results were interpreted as described previously [61].
Construction of plasmids
For first strand cDNA synthesis total RNA was extracted
from infected cells five to seven days post infection
(dpi). Reverse transcription was performed as described
elsewhere [62] using oligo(dT) primers (Fermentas, St.
Leon-Roth, Germany). In order to recombinantly
express hCoV-NL63 proteins ORF 3, E, M and N we
cloned the different genes into a variety of expression
vectors. For generation of GFP-constructs PCR was per-
formed with the following specific primers listed in
Table 2: E: 5’NL63-E-GFP and 3’NL63-EpK R, M:
5’NL63-M-GFP and 3’NL63-MpK R, N: 5’NL63-N-GFP
and 3’NL63-NpK R, ORF 3: 5’NL63-O3-GFP and
3’NL63-O3. For producing the pcDNA3.1-ORF 3-V5/
His construct which was used for in-vitro translation
experiments we applied primers 5’Leader-NL and 3’NL-
O3s. Mutagenesis for the N16Q construct was done
with primers NL63-O3mis-Asn16 F and R using Quick-
Change Mutagenesis kit (Stratagene/Agilent Technolo-
gies, Waldbronn, Germany)
manufacturer’s instructions.
For PCR amplification of FLAG-ORF 3 as well as HA
tagged E, M and N and subsequent cloning into a
pCAGGS vector (kindly provided by Prof. Dr. Stephan
Becker, University of Marburg) we used 5’Eco-FLAG_O3-
63 and 3’Not-O3-63, 5’Eco-HA-E and 3’Not-E, 5’Eco-HA-
M and 3’Not-M, 5’Eco-HA-N and 3’Not-N, respectively
(Table 2). In this case PCR products were digested with
restriction endonucleases EcoRI and NotI (Fermentas)
before cloning into the pCAGGS vector (also digested and
additionally dephosphorylated before use).
Generally, PCR was performed with Platinum® Taq
DNA Polymerase High Fidelity (Invitrogen, Karlsruhe,
Germany), and conditions were as follows: 94°C for 2 min,
followed by 35 cycles of 94°C for 30 s, primer specific tem-
perature for 30 s, and 72°C for 90 s, with a final extension
at 72°C for 10 min. The different genes were cloned into
pcDNA3.1/V5-His-TOPO (eukaryotic expression and in-
vitro translation) and pcDNA3.1/NT-GFP-TOPO (eukar-
yotic expression) with the help of TOPO Expression Kits
(Invitrogen) according to the manufacturer’s instructions.
Cloning of FLAG-tagged ORF 3 into the pCAGGS vector
was done conventionally with T4 ligase (Invitrogen)
according to suppliers’ description. Correct cloning was
confirmed by sequencing (Abi Prism 3,100; Applied Bio-
systems, Foster City, USA).
Generation of polyclonal ORF 3 antiserum
The generation of a polyclonal antiserum against ORF 3
was done with the help of keyhole limpet hemocyanin
(KLH) coupled peptides. Two peptides were synthesized
corresponding to aa positions 182-197 and 211-225
(Eurogentec, Seraing, Belgium). Immunization was per-
according tothe
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 8 of 12

Page 9

Table 2 Oligonucleotidesaused for cloning procedures
Primer
Sequence (5’-end to 3’-end)
+/-
NC_005831b
pcDNA3.1/NT-GFP-TOPO
5’NL63-E-GFP
TTCCTTCGATTAATTGATGAC
+
25203-25223
5’NL63-M-GFP
TCTAATAGTAGTGTGCCTC
+
25445-25463
5’NL63-N-GFP
GCTAGTGTAAATTGGGCC
+
26136-26153
5’NL63-O3-GFP
CCTTTTGGTGGCCTATTTC
+
24545-24563
3’NL63-EpK R
TTAGACATTTAGTACTTCAGCTGG
-
25410-25433
3’NL63-MpK R
TTAGATTAAATGAAGCAACTTCTC
-
26099-26122
3’NL63-NpK R
TTAATGCAAAACCTCGTTGAC
-
27246-27266
3’NL63-O3
ACAAGGAGCCATAAAATG
-
25244-25261
pcDNA3.1/V5-His-TOPO
5’Leader-NL
GACTTTGTGTCTACTCTTC
+
45 - 63
3’NL63-O3s
ATTAATCGAAGGAACATC
-
25199-25216
NL63-O3mis-Asn16 F
CTTACTCTTGAAAGTACTATTCAGAAGAGTGTGGCTAATCTC
+
25567-25609
NL63-O3mis-Asn16 R
GAGATTAGCCACACTCTTCTGAATAGTACTTTCAAGAGTAAG
-
25567-25609
pCAGGSc
5’Eco-FLAG_O3-63
GCAGCAGAATTCATGGACTACAAGGACGACGATGACAAGCCTTTTGGTGGCCTATTTCAACTTAC
+
24544-24570
3’Not-O3-63
CCTCCTGCGGCCGCTCAATTAATCGAAGGAACATCTTCGTATAG
-
25190-25219
5’Eco-HA-E
GCAGCAGAATTCATGTACCCATACGATGTTCCAGATTACGCTTTCCTTCGATTAATTGATGACAATG
+
25203-25227
3’Not-E
CCTCCTGCGGCCGCTTAGACATTTAGTACTTCAGCTG
-
25411-25433
5’Eco-HA-M
GCAGCAGAATTCATGTACCCATACGATGTTCCAGATTACGCTTCTAATAGTAGTGTGCCTCTTTTAGAG
+
25446-25472
3’Not-M
CCTCCTGCGGCCGCTTAGATTAAATGAAGCAACTTCTCTC
-
26098-26123
5’Eco-HA-N
GCAGCAGAATTCATGTACCCATACGATGTTCCAGATTACGCTGCTAGTGTAAATTGGGCCGATGACAG
+
26138-26163
3’Not-N
CCTCCTGCGGCCGCTTAATGCAAAACCTCGTTGACAATTTC
-
27242-27268
aOligonucleotides were provided by TIBMolbiol, Berlin, Germany
bAccession no. hCoV-NL63 strain Amsterdam I
cUnderlined are additional nucleotides representing restriction sites and a FLAG or HA-tag (italics)
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 9 of 12

Page 10

formed in-house. Briefly, a chinchilla rabbit was immu-
nized four times with 200 μg of a mixture of the two
KLH coupled peptides and sera were tested as suggested
by the manufacturer by enzyme-linked immunosorbent
assay (ELISA) using the corresponding uncoupled pep-
tides. We then tested serum with IFA using infected
LLC-MK2 cells (Figure 2) as well as with prokaryotic
recombinant proteins with the help of Dot blot and Wes-
tern blot analysis (data not shown). The bleeding for the
applied anti-ORF 3 serum was carried out 20 days after
the fourth injection and sera were used directly.
Expression analysis and subcellular localization studies of
native viral proteins by indirect IFA and Western blot
Typically, 8 × 104CaCo-2 or LLC-MK2 cells were seeded
on glass slides in a 24-well plate and infected with hCoV-
NL63 as described above. Two to four days after infection
the cells were fixed with paraformaldehyde (4%) for 15
min and permeabilized with 0.1% TritonX100 (Merck,
Darmstadt, Germany) for 10 min. Afterwards the cells
were washed with PBS again and then incubated with the
primary antibody, diluted 1:100 in sample buffer (EURO-
IMMUN, Lübeck, Germany), at 37°C for 1 h. The ERGIC
was stained with the help of mouse-anti-ERGIC53
(Axxora, Grünberg, Germany). In order to stain the Golgi
apparatus we used a mouse-anti-Golgi 58 K (Sigma-
Aldrich, Munich, Germany). For staining of the trans-
Golgi Network and lysosomal compartment we applied a
goat-anti-LAMP-1 antibody (Santa Cruz Biotechnology,
Heidelberg, Germany). Secondary detection was done
with fluorescein isothiocyanate (FITC) or cyanine 2
(Cy2)-conjugated goat-anti-rabbit as well as with rhoda-
mine or Cy3-conjugated goat-anti-mouse or donkey-anti-
goat antibody (Dianova, Hamburg, Germany) at 37°C in a
wet chamber for 30 min. Slides were mounted and ana-
lyzed by cLSM 510 META laser confocal microscope
(Zeiss, Jena, Germany).
Western blot analysis of viral proteins was done as
described elsewhere [63]. For titration of the different
rabbit antisera we used hCoV-NL63 cell lysate gener-
ated from LLC-MK2 infected cells five to seven dpi
(~1 × 107cells/blot) for Western blotting and incu-
bated the produced nitrocellulose strips with the differ-
ent rabbit antisera (pre-immune sera as negative
control) at dilutions ranging from 1:500 up to
1:256,000 (data not shown). Generally, cells were lysed
in RIPA lysis buffer (150 mM NaCl, 1% Igepal CA-630,
0.5% sodium deoxycholat, 0.1% SDS, 50 mM Tris (pH
8.0)) and separated on a 12% SDS-PAGE gel. Western
blotting was performed by using anti-ORF 3, anti-M,
anti-N at dilutions 1:4,000, 1:250,000 and 1:24,000
respectively. Secondary detection was done with the
help of SuperSignal® West Dura Extended or Femto
Chemiluminescence Substrate (Pierce Biotechnology,
Rockford, USA).
Transient transfection of recombinant proteins for
colocalization studies by indirect IFA and Western blot
analysis
Transfections of HEK-293T and Huh-7 cells with eukar-
yotic expression vectors containing the fusion genes
GFP-E, GFP-M, GFP-N, HA-E, HA-M, HA-N and
FLAG-ORF 3 were performed with the help of FuGENE
HD (Roche, Basel, Switzerland) transfection reagent as
described above using 24-well plates provided with glass
slides. After a 24 h incubation at 37°C and 5%
CO2transfected cells were washed with PBS and fixed
with paraformaldehyde (4%), permeabilized with Tri-
tonX100 and incubated with rabbit-anti-FLAG (Sigma)
and mouse-anti-ERGIC53 (Axxora) primary antibodies,
both diluted 1:100 with sample buffer (EUROIMMUN).
Secondary detection was performed with Cy3-conju-
gated goat-anti-rabbit (1:200) and Cy5 labelled goat-
anti-mouse (1:100) antibodies (Dianova). Slides were
mounted and analyzed by confocal laser scanning
microscopy. For Western blot analysis of recombinant
ORF 3 proteins (FLAG-ORF 3, rORF 3) transfections
were performed in 6-well plates using FuGENE HD
transfection reagent. Transfection was performed with 6
μg DNA and 12 μl FuGENE HD in 100 μl DMEM.
Transfected cells were washed three times with ice cold
PBS and harvested for Western blot analysis after incu-
bation for 26 to 48 h at 37°C and 5% CO2. Cell lysis
was performed with RIPA lysis buffer (~4 × 107cells/
ml) containing Protease Inhibitor Cocktail III (Calbio-
chem, San Diego, USA) and Benzonase (25 U/ml)
(Novagen, Madison, USA). After 30 min incubation on
ice samples were sonicated twice for 30 s (Branson Soni-
fier 450, Branson, Danbury, USA) and centrifuged at
13,000 × g for 1 min at 4°C. For detection of the differ-
ent proteins we used rabbit-anti-FLAG (Sigma, diluted
1:5,000) or anti-ORF 3 antiserum (1:3000) and incubated
blots for 1 to 2 h at room temperature. As secondary
antibody we applied a goat-anti-mouse or rabbit horse-
radish peroxidase (HRP)-conjugated antibody (Pierce
Biotechnology) for 1 h at room temperature. Detection
was performed by using SuperSignal® West Femto Che-
miluminescence Substrate (Pierce Biotechnology).
In-vitro translation of ORF 3 and analysis of glycosylation
by endoglycosidase H digestion
Plasmids pcDNA3.1-ORF 3-V5/His, pcDNA3.1-ORF 3-
N16Q-V5/His and pcDNA3.1-ORF 3 were employed in
the TNT T7 quick coupled reticulocyte lysate system
(Promega, Mannheim, Germany) according to the man-
ufacturer’s description. The proteins were metabolically
labelled with [35S]methionine (GE Healthcare, Munich,
Germany) and translated in the presence of canine pan-
creatic microsomal membranes (Promega). Membrane-
bound proteins were pelleted at 13,000 × g for 15 min
and resuspended in PBS. Samples were split in half and
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 10 of 12

Page 11

incubated for 1 h at 37°C with endoglycosidase H (Endo
H; New England Biolabs, Frankfurt, Germany) or, as
control, without additives. Afterwards samples were sub-
jected to SDS-PAGE. Radioactive signals were visualized
by exposing dried gels to BioImage plates, which were
scanned by using a bioimager analyzer (BAS-1,000; Fuji).
Purification of viral particles by sucrose gradient
ultracentrifugation
Purification of viral particles was performed by sucrose gra-
dient ultracentrifugation as described elsewhere [33].
Briefly, 45 ml viral supernatant from infected CaCo-2 cells
was cleared from cell debris 4 dpi and subsequently applied
onto two discontinuous and one continuous sucrose cush-
ion of 20% to 60%. The continuous cushion was divided
into ten fractions and viral particles were pelleted by ultra-
centrifugation through a 20% sucrose cushion. Virus pellets
were resuspended in 100 μL PBS and stored at -80°C.
In-silico analyses
Prediction of protein topology and subcellular localiza-
tion was done by NetNGlyc, NetOGlyc, TMHMM
http://www.cbs.dtu.dk/services/, TMPred http://www.ch.
embnet.org/software/TMPRED_form.html, and ProDiV/
TOPCONS http://topcons.cbr.su.se/index.php. The
alignments and a sequence identity matrix were done by
using BLAST and MEGA4 (BLOSUM; parameters p-dis-
tance and pair wise deletion).
Acknowledgements
This study was supported by the German Ministry of Education and
Research (Project Code “Ökologie und Pathogenese von SARS”), and the
European Commission (FP7 framework program No 223498 EMPERIE). We
are grateful to A. Teichmann for excellent technical assistance. For providing
us with Huh-7 cells we thank A. A. F. de Vries, LUMC, Leiden, The
Netherlands. Special thanks to Dr. H.G. Bae, Dr. K. Madela, R. Kallies for
helping with the confocal laser scanning microscopy and Dr. J. F. Drexler as
well as Dr. B. Hartlieb for giving technical advice.
Author details
1University of Bonn Medical Centre, Sigmund-Freud-Str. 25, D-53127 Bonn,
Germany.2Robert Koch-Institut, Center for Biological Safety, Nordufer 20, D-
13353 Berlin, Germany.3University of Amsterdam, Laboratory of Experimental
Virology, Center for Infection and Immunity Amsterdam (CINIMA), Academic
Medical Center, Meibergdreef 15, 1105 AZ, Amsterdam, The Netherlands.
4University of the Western Cape, Department of Medical Biosciences, Private
Bag X17 Bellville 7535, Republic of South Africa.
Authors’ contributions
MAM, MN, CD conceived and performed the experiments DV, OB, DL, ARS,
SK, TS, LvdH, BCF; assisted in experiments and contributed reagents. MAM;
CD wrote the manuscript. All authors have read and approved the final
manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 29 September 2009
Accepted: 15 January 2010 Published: 15 January 2010
References
1. Hoek van der L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ,
Wolthers KC, Wertheim-van Dillen PM, Kaandorp J, Spaargaren J,
Berkhout B: Identification of a new human coronavirus. Nat Med 2004,
10:368-373.
Hofmann H, Pyrc K, Hoek van der L, Geier M, Berkhout B, Pohlmann S:
Human coronavirus NL63 employs the severe acute respiratory
syndrome coronavirus receptor for cellular entry. Proc Natl Acad Sci USA
2005, 102:7988-7993.
Han TH, Chung JY, Kim SW, Hwang ES: Human Coronavirus-NL63
infections in Korean children, 2004-2006. J Clin Virol 2007, 38:27-31.
Vabret A, Mourez T, Dina J, Hoek van der L, Gouarin S, Petitjean J,
Brouard J, Freymuth F: Human coronavirus NL63, France. Emerg Infect Dis
2005, 11:1225-1229.
Pyrc K, Berkhout B, Hoek van der L: The novel human coronaviruses NL63
and HKU1. J Virol 2007, 81:3051-3057.
Hoek van der L, Sure K, Ihorst G, Stang A, Pyrc K, Jebbink MF, Petersen G,
Forster J, Berkhout B, Uberla K: Croup is associated with the novel
coronavirus NL63. PLoS Med 2005, 2:e240.
Masters PS: The molecular biology of coronaviruses. Adv Virus Res 2006,
66:193-292.
Klumperman J, Locker JK, Meijer A, Horzinek MC, Geuze HJ, Rottier PJ:
Coronavirus M proteins accumulate in the Golgi complex beyond the
site of virion budding. J Virol 1994, 68:6523-6534.
Tooze J, Tooze S, Warren G: Replication of coronavirus MHV-A59 in sac-
cells: determination of the first site of budding of progeny virions. Eur J
Cell Biol 1984, 33:281-293.
Escors D, Ortego J, Laude H, Enjuanes L: The membrane M protein
carboxy terminus binds to transmissible gastroenteritis coronavirus core
and contributes to core stability. J Virol 2001, 75:1312-1324.
Locker JK, Opstelten DJ, Ericsson M, Horzinek MC, Rottier PJ:
Oligomerization of a trans-Golgi/trans-Golgi network retained protein
occurs in the Golgi complex and may be part of its retention. J Biol
Chem 1995, 270:8815-8821.
Lontok E, Corse E, Machamer CE: Intracellular targeting signals contribute
to localization of coronavirus spike proteins near the virus assembly site.
J Virol 2004, 78:5913-5922.
Opstelten DJ, Raamsman MJ, Wolfs K, Horzinek MC, Rottier PJ:
Coexpression and association of the spike protein and the membrane
protein of mouse hepatitis virus. Adv Exp Med Biol 1995, 380:291-297.
Corse E, Machamer CE: The cytoplasmic tails of infectious bronchitis virus
E and M proteins mediate their interaction. Virology 2003, 312:25-34.
Raamsman MJ, Locker JK, de Hooge A, de Vries AA, Griffiths G, Vennema H,
Rottier PJ: Characterization of the coronavirus mouse hepatitis virus
strain A59 small membrane protein E. J Virol 2000, 74:2333-2342.
Nal B, Chan C, Kien F, Siu L, Tse J, Chu K, Kam J, Staropoli I, Crescenzo-
Chaigne B, Escriou N, et al: Differential maturation and subcellular
localization of severe acute respiratory syndrome coronavirus surface
proteins S, M and E. J Gen Virol 2005, 86:1423-1434.
Alexander S, Elder JH: Carbohydrate dramatically influences immune
reactivity of antisera to viral glycoprotein antigens. Science 1984,
226:1328-1330.
Braakman I, van Anken E: Folding of viral envelope glycoproteins in the
endoplasmic reticulum. Traffic 2000, 1:533-539.
de Haan CA, de Wit M, Kuo L, Montalto-Morrison C, Haagmans BL,
Weiss SR, Masters PS, Rottier PJ: The glycosylation status of the murine
hepatitis coronavirus M protein affects the interferogenic capacity of the
virus in vitro and its ability to replicate in the liver but not the brain.
Virology 2003, 312:395-406.
Wissink EH, Kroese MV, Maneschijn-Bonsing JG, Meulenberg JJ, van Rijn PA,
Rijsewijk FA, Rottier PJ: Significance of the oligosaccharides of the
porcine reproductive and respiratory syndrome virus glycoproteins GP2a
and GP5 for infectious virus production. J Gen Virol 2004, 85:3715-3723.
de Haan CA, Masters PS, Shen X, Weiss S, Rottier PJ: The group-specific
murine coronavirus genes are not essential, but their deletion, by
reverse genetics, is attenuating in the natural host. Virology 2002,
296:177-189.
Ortego J, Sola I, Almazan F, Ceriani JE, Riquelme C, Balasch M, Plana J,
Enjuanes L: Transmissible gastroenteritis coronavirus gene 7 is not
essential but influences in vivo virus replication and virulence. Virology
2003, 308:13-22.
Herrewegh AA, Vennema H, Horzinek MC, Rottier PJ, de Groot RJ: The
molecular genetics of feline coronaviruses: comparative sequence
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 11 of 12

Page 12

analysis of the ORF7a/7b transcription unit of different biotypes. Virology
1995, 212:622-631.
Haijema BJ, Volders H, Rottier PJ: Live, attenuated coronavirus vaccines
through the directed deletion of group-specific genes provide
protection against feline infectious peritonitis. J Virol 2004, 78:3863-3871.
Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LL, Guan Y,
Rozanov M, Spaan WJ, Gorbalenya AE: Unique and conserved features of
genome and proteome of SARS-coronavirus, an early split-off from the
coronavirus group 2 lineage. J Mol Biol 2003, 331:991-1004.
Frieman MB, Yount B, Sims AC, Deming DJ, Morrison TE, Sparks J,
Denison M, Heise M, Baric RS: SARS coronavirus accessory ORFs encode
luxury functions. Adv Exp Med Biol 2006, 581:149-152.
Pfefferle S, Krahling V, Ditt V, Grywna K, Muhlberger E, Drosten C: Reverse
genetic characterization of the natural genomic deletion in SARS-
Coronavirus strain Frankfurt-1 open reading frame 7b reveals an
attenuating function of the 7b protein in-vitro and in-vivo. Virol J 2009,
6:131.
Yount B, Roberts RS, Sims AC, Deming D, Frieman MB, Sparks J,
Denison MR, Davis N, Baric RS: Severe acute respiratory syndrome
coronavirus group-specific open reading frames encode nonessential
functions for replication in cell cultures and mice. J Virol 2005, 79:14909-
14922.
Schaecher SR, Touchette E, Schriewer J, Buller RM, Pekosz A: Severe acute
respiratory syndrome coronavirus gene 7 products contribute to virus-
induced apoptosis. J Virol 2007, 81:11054-11068.
Tang XC, Zhang JX, Zhang SY, Wang P, Fan XH, Li LF, Li G, Dong BQ, Liu W,
Cheung CL, et al: Prevalence and genetic diversity of coronaviruses in
bats from China. J Virol 2006, 80:7481-7490.
Akerstrom S, Tan YJ, Mirazimi A: Amino acids 15-28 in the ectodomain of
SARS coronavirus 3a protein induces neutralizing antibodies. FEBS Lett
2006, 580:3799-3803.
Ito N, Mossel EC, Narayanan K, Popov VL, Huang C, Inoue T, Peters CJ,
Makino S: Severe acute respiratory syndrome coronavirus 3a protein is a
viral structural protein. J Virol 2005, 79:3182-3186.
Shen S, Lin PS, Chao YC, Zhang A, Yang X, Lim SG, Hong W, Tan YJ: The
severe acute respiratory syndrome coronavirus 3a is a novel structural
protein. Biochem Biophys Res Commun 2005, 330:286-292.
Voss D, Kern A, Traggiai E, Eickmann M, Stadler K, Lanzavecchia A, Becker S:
Characterization of severe acute respiratory syndrome coronavirus
membrane protein. FEBS Lett 2006, 580:968-973.
Oostra M, de Haan CA, de Groot RJ, Rottier PJ: Glycosylation of the severe
acute respiratory syndrome coronavirus triple-spanning membrane
proteins 3a and M. J Virol 2006, 80:2326-2336.
Tan YJ, Teng E, Shen S, Tan TH, Goh PY, Fielding BC, Ooi EE, Tan HC,
Lim SG, Hong W: A novel severe acute respiratory syndrome coronavirus
protein, U274, is transported to the cell surface and undergoes
endocytosis. J Virol 2004, 78:6723-6734.
Law PT, Wong CH, Au TC, Chuck CP, Kong SK, Chan PK, To KF, Lo AW,
Chan JY, Suen YK, et al: The 3a protein of severe acute respiratory
syndrome-associated coronavirus induces apoptosis in Vero E6 cells. J
Gen Virol 2005, 86:1921-1930.
Yuan X, Yao Z, Wu J, Zhou Y, Shan Y, Dong B, Zhao Z, Hua P, Chen J,
Cong Y: G1 phase cell cycle arrest induced by SARS-CoV 3a protein via
the cyclin D3/pRb pathway. Am J Respir Cell Mol Biol 2007, 37:9-19.
Tan YJ, Tham PY, Chan DZ, Chou CF, Shen S, Fielding BC, Tan TH, Lim SG,
Hong W: The severe acute respiratory syndrome coronavirus 3a protein
up-regulates expression of fibrinogen in lung epithelial cells. J Virol 2005,
79:10083-10087.
Akerstrom S, Mirazimi A, Tan YJ: Inhibition of SARS-CoV replication cycle
by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/
3b and S. Antiviral Res 2007, 73:219-227.
Lu W, Zheng BJ, Xu K, Schwarz W, Du L, Wong CK, Chen J, Duan S,
Deubel V, Sun B: Severe acute respiratory syndrome-associated
coronavirus 3a protein forms an ion channel and modulates virus
release. Proc Natl Acad Sci USA 2006, 103:12540-12545.
Freundt EC, Yu L, Goldsmith CS, Welsh S, Cheng A, Yount B, Liu W,
Frieman MB, Buchholz UJ, Screaton GR, et al: The ORF 3a Protein of SARS-
CoV Promotes Membrane Rearrangement and Cell Death. J Virol 2009.
Andries K, Pensaert M: Vomiting and wasting disease, a coronavirus
infection of pigs. Adv Exp Med Biol 1981, 142:399-408.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44. Song DS, Yang JS, Oh JS, Han JH, Park BK: Differentiation of a Vero cell
adapted porcine epidemic diarrhea virus from Korean field strains by
restriction fragment length polymorphism analysis of ORF 3. Vaccine
2003, 21:1833-1842.
Woods RD: Efficacy of a transmissible gastroenteritis coronavirus with an
altered ORF-3 gene. Can J Vet Res 2001, 65:28-32.
Donaldson EF, Yount B, Sims AC, Burkett S, Pickles RJ, Baric RS: Systematic
assembly of a full-length infectious clone of human coronavirus NL63. J
Virol 2008, 82:11948-11957.
Dijkman R, Jebbink MF, Wilbrink B, Pyrc K, Zaaijer HL, Minor PD, Franklin S,
Berkhout B, Thiel V, Hoek van der L: Human coronavirus 229E encodes a
single ORF4 protein between the spike and the envelope genes. Virol J
2006, 3:106.
Fielding BC, Suliman T: Comparative analysis of human coronavirus-NL63
ORF3 protein homologues. African Journal of Biotechnology 2009, 8:3175-
3178.
Yu CJ, Chen YC, Hsiao CH, Kuo TC, Chang SC, Lu CY, Wei WC, Lee CH,
Huang LM, Chang MF, et al: Identification of a novel protein 3a from
severe acute respiratory syndrome coronavirus. FEBS Lett 2004, 565:111-
116.
Yuan X, Li J, Shan Y, Yang Z, Zhao Z, Chen B, Yao Z, Dong B, Wang S,
Chen J, Cong Y: Subcellular localization and membrane association of
SARS-CoV 3a protein. Virus Res 2005, 109:191-202.
Duarte M, Tobler K, Bridgen A, Rasschaert D, Ackermann M, Laude H:
Sequence analysis of the porcine epidemic diarrhea virus genome
between the nucleocapsid and spike protein genes reveals a
polymorphic ORF. Virology 1994, 198:466-476.
McGoldrick A, Lowings JP, Paton DJ: Characterisation of a recent virulent
transmissible gastroenteritis virus from Britain with a deleted ORF 3a.
Arch Virol 1999, 144:763-770.
Tang X, Li G, Vasilakis N, Zhang Y, Shi Z, Zhong Y, Wang LF, Zhang S:
Differential stepwise evolution of SARS coronavirus functional proteins
in different host species. BMC Evol Biol 2009, 9:52.
Pyrc K, Dijkman R, Deng L, Jebbink MF, Ross HA, Berkhout B, Hoek van der
L: Mosaic structure of human coronavirus NL63, one thousand years of
evolution. J Mol Biol 2006, 364:964-973.
Huang C, Narayanan K, Ito N, Peters CJ, Makino S: Severe acute respiratory
syndrome coronavirus 3a protein is released in membranous structures
from 3a protein-expressing cells and infected cells. J Virol 2006, 80:210-
217.
Narayanan K, Huang C, Makino S: SARS coronavirus accessory proteins.
Virus Res 2008, 133:113-121.
Kanzawa N, Nishigaki K, Hayashi T, Ishii Y, Furukawa S, Niiro A, Yasui F,
Kohara M, Morita K, Matsushima K, et al: Augmentation of chemokine
production by severe acute respiratory syndrome coronavirus 3a/X1 and
7a/X4 proteins through NF-kappaB activation. FEBS Lett 2006, 580:6807-
6812.
Tan YJ, Lim SG, Hong W: Understanding the accessory viral proteins
unique to the severe acute respiratory syndrome (SARS) coronavirus.
Antiviral Res 2006, 72:78-88.
van Kuppeveld FJ, Melchers WJ, Willemse HF, Kissing J, Galama JM,
Logt van der JT: Detection of Mycoplasma pulmonis in experimentally
infected laboratory rats by 16S rRNA amplification. J Clin Microbiol 1993,
31:524-527.
Herzog P, Drosten C, Muller MA: Plaque assay for human coronavirus
NL63 using human colon carcinoma cells. Virol J 2008, 5:138.
Niedrig M, Lademann M, Emmerich P, Lafrenz M: Assessment of IgG
antibodies against yellow fever virus after vaccination with 17D by
different assays: neutralization test, haemagglutination inhibition test,
immunofluorescence assay and ELISA. Trop Med Int Health 1999, 4:867-
871.
Hattermann K, Muller MA, Nitsche A, Wendt S, Donoso Mantke O,
Niedrig M: Susceptibility of different eukaryotic cell lines to SARS-
coronavirus. Arch Virol 2005, 150:1023-1031.
Muller MA, Paweska JT, Leman PA, Drosten C, Grywna K, Kemp A, Braack L,
Sonnenberg K, Niedrig M, Swanepoel R: Coronavirus antibodies in African
bat species. Emerg Infect Dis 2007, 13:1367-1370.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
doi:10.1186/1743-422X-7-6
Cite this article as: Müller et al.: Human Coronavirus NL63 Open
Reading Frame 3 encodes a virion-incorporated N-glycosylated
membrane protein. Virology Journal 2010 7:6.
Müller et al. Virology Journal 2010, 7:6
http://www.virologyj.com/content/7/1/6
Page 12 of 12