CCL2 responses to Mycobacterium tuberculosis are associated with disease severity in tuberculosis.

Abstract

Leucocyte activating chemokines such as CCL2, CCL3, and CXCL8 together with proinflammatory IFNgamma, TNFalpha and downmodulatory IL10 play a central role in the restriction of M. tuberculosis infections, but is unclear whether these markers are indicative of tuberculosis disease severity.
We investigated live M. tuberculosis- and M. bovis BCG-induced peripheral blood mononuclear cell responses in patients with tuberculosis (TB) and healthy endemic controls (ECs, n = 36). TB patients comprised pulmonary (PTB, n = 34) and extrapulmonary groups, subdivided into those with less severe localized extrapulmonary TB (L-ETB, n = 16) or severe disseminated ETB (D-ETB, n = 16). Secretion of CCL2, IFNgamma, IL10 and CCL3, and mRNA expression of CCL2, TNFalpha, CCL3 and CXCL8 were determined.
M. tuberculosis- and BCG-induced CCL2 secretion was significantly increased in both PTB and D-ETB (p<0.05, p<0.01) as compared with L-ETB patients. CCL2 secretion in response to M. tuberculosis was significantly greater than to BCG in the PTB and D-ETB groups. M. tuberculosis-induced CCL2 mRNA transcription was greater in PTB than L-ETB (p = 0.023), while CCL2 was reduced in L-ETB as compared with D-ETB (p = 0.005) patients. M. tuberculosis-induced IFNgamma was greater in L-ETB than PTB (p = 0.04), while BCG-induced IFNgamma was greater in L-ETB as compared with D-ETB patients (p = 0.036). TNFalpha mRNA expression was raised in PTB as compared with L-ETB group in response to M. tuberculosis (p = 0.02) and BCG (p = 0.03). Mycobacterium-induced CCL3 and CXCL8 was comparable between TB groups.
The increased CCL2 and TNFalpha in PTB patients may support effective leucocyte recruitment and M. tuberculosis localization. CCL2 alone is associated with severity of TB, possibly due to increased systemic inflammation found in severe disseminated TB or due to increased monocyte infiltration to lung parenchyma in pulmonary disease.

Full text

Page 1

CCL2 Responses to Mycobacterium tuberculosis Are
Associated with Disease Severity in Tuberculosis
Zahra Hasan1*, Jacqueline M. Cliff2, Hazel M. Dockrell2, Bushra Jamil1, Muhammad Irfan1, Mussarat
Ashraf1, Rabia Hussain1
1The Aga Khan University, Karachi, Pakistan, 2London School of Hygiene and Tropical Medicine, London, United Kingdom
Abstract
Background: Leucocyte activating chemokines such as CCL2, CCL3, and CXCL8 together with proinflammatory IFNc, TNFa
and downmodulatory IL10 play a central role in the restriction of M. tuberculosis infections, but is unclear whether these
markers are indicative of tuberculosis disease severity.
Methodology: We investigated live M. tuberculosis- and M. bovis BCG- induced peripheral blood mononuclear cell responses
in patients with tuberculosis (TB) and healthy endemic controls (ECs, n=36). TB patients comprised pulmonary (PTB, n=34)
and extrapulmonary groups, subdivided into those with less severe localized extrapulmonary TB (L-ETB, n=16) or severe
disseminated ETB (D-ETB, n=16). Secretion of CCL2, IFNc, IL10 and CCL3, and mRNA expression of CCL2, TNFa, CCL3 and
CXCL8 were determined.
Results: M. tuberculosis- and BCG- induced CCL2 secretion was significantly increased in both PTB and D-ETB (p,0.05,
p,0.01) as compared with L-ETB patients. CCL2 secretion in response to M. tuberculosis was significantly greater than to
BCG in the PTB and D-ETB groups. M. tuberculosis-induced CCL2 mRNA transcription was greater in PTB than L-ETB
(p=0.023), while CCL2 was reduced in L-ETB as compared with D-ETB (p=0.005) patients. M. tuberculosis –induced IFNc was
greater in L-ETB than PTB (p=0.04), while BCG-induced IFNc was greater in L-ETB as compared with D-ETB patients
(p=0.036). TNFa mRNA expression was raised in PTB as compared with L-ETB group in response to M. tuberculosis (p=0.02)
and BCG (p=0.03). Mycobacterium-induced CCL3 and CXCL8 was comparable between TB groups.
Conclusions: The increased CCL2 and TNFa in PTB patients may support effective leucocyte recruitment and M. tuberculosis
localization. CCL2 alone is associated with severity of TB, possibly due to increased systemic inflammation found in severe
disseminated TB or due to increased monocyte infiltration to lung parenchyma in pulmonary disease.
Citation: Hasan Z, Cliff JM, Dockrell HM, Jamil B, Irfan M, et al. (2009) CCL2 Responses to Mycobacterium tuberculosis Are Associated with Disease Severity in
Tuberculosis. PLoS ONE 4(12): e8459. doi:10.1371/journal.pone.0008459
Editor: T. Mark Doherty, Statens Serum Institute, Denmark
Received September 3, 2009; Accepted December 1, 2009; Published December 29, 2009
Copyright: ? 2009 Hasan et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This investigation received financial support from the United Nations Children’s Fund (UNICEF)/United Nations Development Programme (UNDP)/
World Bank/World Health Organization (WHO) and was funded by the Special Programme for Training in Tropical Diseases Research, TDR, WHO. The funders had
no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: zahra.hasan@aku.edu
Introduction
Tuberculosis (TB) causes 1.8 million deaths annually with 9.27
million incident cases of which the majority (55%) are in Asia [1].
Although the primary disease remains at pulmonary sites,
extrapulmonary disease is common especially in high TB burden
settings [2,3] or where there is a high rate of human
immunodeficiency virus (HIV) co-prevalence [4].
Protective immunity against Mycobacterium tuberculosis is depen-
dent on the interplay between activated T cells, macrophages and
other leucocytes. Proinflammatory cytokines such as, interferon
gamma (IFN)-c, tumor necrosis factor-alpha (TNF)-a, interleukin
(IL)-12 are essential for protective immunity against M. tuberculosis
[5], [6]. IL-10 produced by macrophages is important in
regulating the TH1 cytokine balance and down regulates
proinflammatory responses [7].
Small molecular weight (8–10 kDa) chemotactic cytokines or,
chemokines are responsible for regulating the migration, traffick-
ing, homing and activation of monocytes, macrophages and other
leucocytes. An effective granulomatous response is essential for the
restriction of M. tuberculosis infection. TNFa which is essential
for macrophage activation and granuloma formation [8,9] also
influences the expression of chemokines by macrophages and
mediates effective recruitment of leucocytes via the CC chemo-
kines; CCL2 (monocyte chemoattractant protein (MCP)-1), CCL3
(macrophage inflammatory protein (MIP)- 1a), CCL4 (macro-
phage inflammatory protein (MIP)- 1b), CCL5 (regulated on
activation normal T cell expressed and secreted: RANTES) and
CXC chemokines; CXCL8 (IL8), CXCL9 (monokine induced by
IFNc: MIG) and CXCL10 (IFNc inducible 10kD protein: IP10)
[10–13].
CCL2 and CCL3 are primarily secreted by monocytes,
macrophages and dendritic cells. Responsiveness to CCL2 is
dependent on its receptor CCR2, and CCL2 is a potent activator
of cells which express CCR2 such as, monocytes, macrophages,
CD4+ T cells and immature dendritic cells [14]. CCL2 is essential
PLoS ONE | www.plosone.org1December 2009 | Volume 4 | Issue 12 | e8459

Page 2

for granuloma formation [15] and plays a critical role in protection
against tuberculosis in the murine model [16]. Chemokines CCL3,
CCL4 and CCL5 function together with IFNc as type 1
proinflammatory chemokines [17]. M. tuberculosis infection of
macrophages results in the induction of CCL3, CCL4 and CCL5
and these are required for inhibition of its growth [18]. CXC
chemokines are predominantly secreted by polymorphonuclear
cells and CXCL8 is the most potent chemotactic agent for
neutrophils and T lymphocytes [19,20]. It plays a role in the
recruitment of lymphocytes and monocyte to pleural space in TB
patients [21], as a result of CXCL8 production by macrophages
and mesothelial cells [22].
It remains a challenge to try to identify molecular markers
which may be indicative of tuberculosis infection in the host. Most
TB studies have focused on patients with pulmonary tuberculosis
(PTB). However, it has been shown that the magnitude and
regulation of IFNc, CCL2 and CXCL9 may differ between the
host responses of patient with PTB or extrapulmonary TB (ETB)
[23–25]. In addition, within extrapulmonary TB, the relationship
between IFNc and IL10 regulates the outcome of infection and
affects the severity of disease [26]. TNFa gene expression has been
shown to be increased in patients with extrapulmonary TB [27].
CXCL8 levels are raised in the sera of patients with TB patients
and have been shown to be associated with unfavorable outcome
of the disease [28]. Most work on transcriptional profiles of M.
tuberculosis infected cells have been performed in the murine model
[29,30] or immortalized cells [31], with some recent work in
patients with tuberculous meningitis [32]. As these cytokines and
chemokines had previously been previously been shown to be
differentially secreted according to disease site (pulmonary and
extrapulmonary) and also disease severity, we chose to study
CCL2, IFNc, IL10, CCL3, TNFa and CXCL8 in response to
Mycobacterium infection of peripheral blood mononuclear cells
(PBMCs).
BCG vaccination coverage in the Pakistani population is
approximately 70% [33] TB but transmission rates remain high
with an incidence of 181/100,000 population [1]. Responses to
virulent M. tuberculosis can differ from those of attenuated avirulent
organisms such as, M. bovis BCG [34]. We have employed both
live virulent M. tuberculosis and non-pathogenic M. bovis BCG in
this study in order to assess whether it was possible to differentiate
between immune responses to virulent and avirulent mycobacteria
against a background of high transmission, in addition to
environmental exposure to cross mycobacteria and wide BCG
coverage. BCG vaccinated healthy controls (ECs) can be both
tuberculin test positive (TST+) and negative (TST-). It has been
shown recently that in clinically health individuals Mycobacterium-
specific immune responses differ between those with tuberculin
positive and negative reactions [35]. Therefore, we have separately
described responses of TST+ and TST- ECs and compared them
with those of patients with tuberculosis. We have investigated
chemokine and cytokine responses in tuberculosis patients with
differing clinical severity and sites including PTB and ETB, with a
view to identifying markers of clinical disease severity.
Materials and Methods
Ethics Statement
This work received approval from the Ethical Review
Committee, The Aga Khan University, Karachi, Pakistan.
Subject Selection
TB patients in this study are a subset of a larger study and have
been described previously [36]. Patients were recruited from the
out-patient clinics of the Aga Khan University Hospital and
Medical College (AKUH) and Masoomeen Hospital, Karachi.
The subjects were all unrelated. All study subjects were examined,
evaluated and recruited by infectious diseases consultants. The
patients were newly diagnosed with #7 days of anti-tuberculous
therapy (ATT). All samples were taken with written informed
consent from participants. Patients had no significant co-morbid
conditions including diabetes mellitus, chronic renal failure, and
chronic liver disease and were also not on any corticosteroid
therapy. Although Pakistan is a low HIV prevalence setting, all
patients were screened and found to be HIV negative. Patients
with pulmonary TB (PTB, n=34) were diagnosed by clinical
examination, chest X-ray, sputum acid fast bacillus (AFB) Ziehl
Neelsen straining, AFB culture and /or clinical response to
treatment (as assessed by resolution of fever, cough and weight
gain). Patients were diagnosed as having either minimal or
moderately advanced disease based on the extent of lung tissue
involvement [37,38]. Of the PTB patients, 9 had minimal, while
25 had moderately advanced disease.
Patients with extrapulmonary TB (ETB) were stratified into
disease severity groups according to the WHO ranking of clinical
disease severity based on extent of disease and anatomical site and
number of distal sites involved [39]. TB of the lymph nodes,
unilateral pleural effusion, bone (excluding spine), peripheral join
and skin was classified as less severe. TB of the meninges,
pericardium, peritoneal cavity, bilateral or extensive pleural
effusion, spine, intestines, or miliary TB was classified as severe.
Sixteen patients were placed in the category of less severe localized
ETB (L-ETB), comprising tuberculous lymphadenopathy. All
L-ETB patients were confirmed on histological findings consistent
with tuberculosis. Sixteen patients were classified as severe
disseminated ETB (D-ETB). Diagnostic criteria used for D-ETB
are provided in Table 1. Diagnosis of meningeal TB was based
on CSF biochemical findings, supported by AFB culture and
findings on contrast-enhanced CT scan and/or MRI. Pleural TB
was diagnosed on the basis of pleural fluid biochemical findings,
AFB culture, histopathological findings on pleural biopsy and
supportive radiological evidence on X-rays and/or contrast-
enhanced CT scan.
BCG-vaccinated asymptomatic healthy volunteers who were
staff at AKU with no known exposure to TB were used as endemic
controls (ECs). BCG vaccination was assessed based on the
presence of a BCG scar. No member of the control group had a
household member with tuberculosis nor did they have any
relationship to any of the patients recruited in the study. All
volunteers had a normal chest X-Ray. Tuberculin skin testing
(TST) was assessed by intradermal administration of five
tuberculin units on the volar surface of the right arm subcutane-
ously, and read by a single reader at 48 h. An induration of
$10mm was used as a cutoff for positive responses. Both TST-
(n=19) and TST+ (n=17) ECs were included in the study.
Mycobacterium Culture
M. tuberculosis (H37Rv) was acquired from ATCC and used as
described previously [40]. The M. bovis BCG Montreal vaccine
strain was used as the non-pathogenic strain. All strains were
grown to logarithmic phase in 7H9 Middlebrook medium
supplemented with 0.02% glycerol, 10% albumin dextrose
catalase (ADC) Middlebrook enrichment and 0.5% Tween-80
(all from Difco Laboratories, Detroit, MI, USA). Aliquots of
mycobacteria were frozen in growth medium containing 15%
glycerol and stored at -70uC. For the infection assay, aliquots of
mycobacteria were freshly thawed, washed three times in PBS and
diluted as required for the infection. To avoid mycobacterial
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org2 December 2009 | Volume 4 | Issue 12 | e8459

Page 3

clumping, the cell suspension was sonicated briefly then allowed to
stand for 5 min to allow large clumps to settle, leaving behind a
single cell suspension [40]. A mycobacterial innoculum was also
plated out for each assay to determine bacterial viability which was
greater than 80% in each case.
Infection of Peripheral Blood Mononuclear Cells with
Mycobacteria
Peripheral blood mononuclear cells (PBMCs) were obtained by
gradient separation of whole blood using Histopaque (GIBCO-
BRL, USA). Cells were counted using a hemacytometer and
plated at 106per well in a 24 well tissue culture plate in 1 ml. M.
tuberculosis and BCG inoculation of 106CFU/ml (infection ratio of
1) was added to each well containing PBMCs. The time course
and dose response to Mycobacterium infection of PBMCs has been
described previously [41]. All supernatants were collected at 18 h
post-stimulation for cytokine and chemokine measurements.
Samples were centrifuged to collect any cellular debris, aliquoted
and stored at 270 C until tested. Cell monolayers were harvested
directly in Trizol reagent (Invitrogen, USA) for extraction of total
RNA and stored at 270 C. M. tuberculosis-induced responses were
tested in all 66 TB patients recruited in this study. However, 63/66
were used for BCG-stimulation experiments due to a lower yield of
PBMCs from these 3 patients.
ELISA for IFNc, IL-10, CCL2 and CCL3
IFNc and IL-10 were detected in supernatants of stimulated
PBMCs by using standards and ELISA reagents obtained from
Endogen (Rockford, IL, USA). Cytokines were measured using a
sandwich ELISA technique according to the manufacturer’s
instructions and as reported previously [23]. Recombinant human
cytokine was used to obtain a dose response curve with a range of
detection from 3.9–1000 pg/ml. All experimental samples were
tested in duplicate. CCL2 and CCL3 standards and monoclonal
antibody pairs for capture and detection were obtained from R&D
Systems (Abingdon, UK). All measurements were carried out
according to the manufacturer’s recommendations and as
described previously [23]. Recombinant human chemokine was
used to obtain a dose response curve with a range of detection
from 6.25–500 pg/ml for CCL3, and 6.25–1000 pg/ml for
CCL2.
Real Time Quantitative RT-PCR for Cytokine Gene
Expression Quantification
RNA was extracted from PBMC samples stored in Trizol
reagent as per the manufacturer’s instructions. RNA was heated at
70uC to denature and quantified using the NanoDrop ND1000
(NanoDrop Technologies, USA). Total RNA (1 mg) was reverse
transcribed (RT) using MuLV reverse transcriptase (Invitrogen,
USA) in a volume of 20 ul and cDNA was further diluted to 25 ul
and used in PCR reactions.
The absolute quantification method was used to determined
gene expression in cells. Individual standards were prepared from
gene specific PCR products generated using a conventional PCR
machine, electrophoresed on an agarose gel and subsequently
extracted and quantified. Quantification of cDNA product was
carried out using a fluorescent quantification assay Quant-IT
DNA Assay (Molecular Probes, USA). dsDNA concentration was
calculated as copies/ul using the formula: Copies/ul = Xg/ul DNA
4 (product size in bpx660)66.02261023.
Standard curves were used 106–101copies/ well of each gene.
For each sample, gene expression PCR was carried out using 2 ml
of cDNA template with sequence specific primers. PCR was
performed for the human acidic ribosomal protein (HuPO) house
keepinggene [42]. Primers
CACCTGCTGTTAT, R- AGATCTCCTTGGCCACAATG)
for CCL2(F- CCCCAGT-
Table 1. Diagnostic criteria for patients with severe disseminated extrapulmonary tuberculosis (D-ETB).
No.Disease SiteAbscess Microscopya
Radiologyb
AFBCc
Histopathologyd
1Spine YesYes Positive
2SpineYes Yes Negative Positive
3 Spine YesYes
4Spine Yes Yes
5Spine YesYes
6Spine YesYes
7 SpineYesYes
8 Spine NegativeYes PositivePositive
9Intestinal YesPositive
10 Meningese
YesNegative
11 Meningese
YesNegative
12Meninges PositiveYes PositivePositive
13MeningesPositiveYes Positive
14 Meningese
Negative Yes Negative
15Meningese
Positive
16 MiliaryYes
aindicates acid fast bacilli staining of smears.
bincludes Xray, MRI or CT imaging characteristic of tuberculosis.
cacid fast bacilli culture using BACTEC radiometric assay, Becton Dickinson, USA.
dbiopsy results indicate caseating or necrotic granulomatous inflammation indicative of M. tuberculosis infection.
eshowed a favorable clinical response to anti-tuberculous treatment.
doi:10.1371/journal.pone.0008459.t001
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org3December 2009 | Volume 4 | Issue 12 | e8459

Page 4

and CCL3 (F- TGCTGCTTCAGCTACACCTC, R- TTTCT-
GGACCCACTCCTCAC) were from RT primer DB (http://
rtprimerdb.org). CXCL8 (F- GCTCTGTGTGAAGGTGCAG,
R- TCTGCACCCAGTTTTCCTTG) and TNFa (F- TGCTT-
GTTCCTCAGCCTCTT, R- GGTTTGCTACAACATGGC-
TAC) sequences were by courtesy of Martin Holland, LSHTM,
UK. All assays employed incorporation of the SYBR Green dye
(BIORAD laboratories, USA). Cytokine gene expression ratios
were calculated in each case after normalization against HuPO (F-
GCTTCCTGGAGGGTGTCC, R- GGACTCGTTTGTACC-
CGTTG). Typical assay conditions employed were: initial
denaturation 50 C, 2 min; 95 C, 15 min; 40 cycles 95C, 15s, 60 C,
60 s. This was followed by a melting curve dissociation analysis to
check specificity of PCR products. All experiments were carried
out using an iCycler real-time PCR machine, BIORAD
Laboratories, USA. Data are depicted as fold increase in each
target gene per 100 copies. All genes were normalized to the
human acidic ribosomal protein (HuP0) housekeeping gene [43].
Fold increase in gene expression were determined based on results
of stimulated cells as a fold change in gene expression as compared
with basal levels in unstimulated cells. Of the total 66 TB patients
recruited in this study, gene expression studies were performed on
50 TB patients. Of these, PBMC gene expression data was
available on 50 donors stimulated with M. tuberculosis and 44 TB
patient PBMCs stimulated with BCG.
Statistical Analysis
All data were analyzed using the Statistical Package for Social
Sciences software (SPSS). Analysis of non-parametric data was
performed using the Mann-Whitney U test and the Kruskal-Wallis
test as was appropriate. P values#0.05 were considered to indicate
significant differences between groups.
Results
The hematological characteristics of patients and controls
included in the study are provided in Table 2, with each group
shown separately. While BCG vaccination is administered at
birth as part of the National Expanded Immunization Program
in the country its coverage is at best up to 70% [33]. Therefore,
we also documented the presence of a BCG scar in subjects to
determine whether they had a history of BCG vaccination. TB
transmission rates in the country are high with an incidence of
181/100,000 therefore only the TST- EC group can be
considered as un-infected by M. tuberculosis. The TST+ EC
group is also clinically healthy but it not possible to assess
whether their positive tuberculin reaction is attributable to BCG
vaccination or exposure to environmental mycobacteria or even
M. tuberculosis. Hence we have considered TST+ and TST- ECs
separately.
We found that there was a significant difference between the age
groups of patients with TB and healthy controls, (p=0.034).
Patients with both localized ETB and disseminated ETB were
older than PTB patients (p=0.011, p=0.042, respectively, using
Mann-Whitney U nonparametric analysis). As indicated, there was
a significant difference between BCG vaccinees in TB patient
groups, (p=0.029). Patients with L-ETB had greater numbers of
BCG vaccinees than those with either PTB or D-ETB. There was
no relationship between the age of patients and their BCG scar
status.
Data indicated an increase in lymphocyte, monocyte and
neutrophil counts in TB patients when compared with endemic
controls, and is in agreement with previous studies [44].
Increased M. tuberculosis – and BCG- Induced CCL2
Secretion in Patients with TB
It is important to understand the difference between M. bovis
BCG vaccination induced immunity and that elicited in response
to challenge by either M. tuberculosis or M. bovis BCG. In order to
establish the specificity of responses to Mycobacteria, we first
determined M. tuberculosis- and M. bovis BCG- induced chemokine
and cytokine responses in healthy endemic controls (ECs; TST-
(N=19), TST+ (N=17) as compared with those of patients with
tuberculosis. As shown in Table 3, spontaneous secretion of CCL2
from unstimulated PBMCs of controls and TB patients was
comparable. M. tuberculosis –induced CCL2 was significantly
greater in PBMCs of TB patients as compared with both TST-
and TST+ ECs (p,0.001). CCL2 responses to M. tuberculosis and
BCG showed a parallel trend although the magnitude of secretion
from TB patients in response to M. tuberculosis was significantly
greater as compared with BCG (p,0.001).
Table 2. Characteristics of tuberculosis patients and controls in the study.
GroupTST- ECsTST+ ECsPTBL-ETBD-ETBp-value
Median (IQR) Median (IQR) Median (IQR)Median (IQR) Median (IQRa)
N1917 3416 16
Age (y)25 (5) 26 (12.5)24.5 (12) 30 (20)31.5 (40.5) 0.034*
Male : Female 10 vs 96 vs 1113 vs 217 vs 98 vs 8
BCG vaccinees#(%) 100 10041.281.3 37.50.029 *
Hb (g/dL)13.6 (1.9) 12.8 (2.5)11.8 (2.4) 11.9 (3)11.9 (2.8)0.085
TLC (10e9/L) 7.5 (1.9)7.5 (1.9) 8.1 (4.6)7.1 (2.5)7.4 (4.1)0.403
Lymphocytes (10e9/L)2.3 (0.7) 2.3 (1.1)5.7 (4.6)3.7 (1.7)5.2 (3.4)
,0.001*
Monocytes (10e8/L)4.9 (2.3) 4.9 (2)13.6 (8.2) 18.6 (12.8)13.8 (7.1)
,0.001
Neutrophils (10e9/L)4.4 (1.2) 3.8 (1)0.5 (0.5)0.6 (0.3)0.5 (0.2)
,0.001*
TST, tuberculin skin test; TST+ individuals had an induration $10 mm in size.
PTB, pulmonary TB; localized extrapulmonary TB, L-ETB; disseminated ETB, D-ETB.
IQR, interquartile range between 25th and 75th percentile.
‘#’ based on presence of BCG scar.
‘*’ denotes p,0.05 using the Kruskal-Wallis nonparametric test, values in bold indicate those which are significantly higher.
doi:10.1371/journal.pone.0008459.t002
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org4 December 2009 | Volume 4 | Issue 12 | e8459

Page 5

Decreased M. tuberculosis – and BCG- Induced IFNc and
Increased IL10 Secretion in Patients with TB
IFNc in coordination with IL10 plays a key role in protective
immunity against M. tuberculosis by regulating effector responses in
tuberculosis. M. tuberculosis-induced IFNc levels were significantly
lower in TB patients (p=0.042, Kruskal Wallis analysis; Table 3). M.
tuberculosis-induced IFNc did not differ significantly between the TST
stratified EC groups. However, responses of TB patients were
significantlylowerthanTST+ECs(p=0.022,Mann-WhitneyUtest),
and although there was trend that M. tuberculosis-induced IFNc was
also lower in patients than TST- ECs, this did not reach significance.
BCG-induced IFNc secretion was significantly lower in TB
patients as compared with ECs (p,0.01, Kruskal Wallis analysis).
TB patients showed lower IFNc responses compared to both TST-
and TST+ ECs (p,0.001, p,0.001, respectively, Mann Whitney
U test). This suggests that although the trend of M. tuberculosis- and
BCG-induced IFNc secretion was similar in TB patients, the
responses differed in TST+ and TST- ECs control groups
indicating that the immune responses measured here were specific
to the mycobacterial stimulus. Also, increased IFNc responses in
the TST+ EC group may reflect previous exposure leading to
increased IFNc responses due to activation of effector T memory
cells in this group.
M. tuberculosis-induced IL10 levels were significantly raised in TB
patients as compared with both TST- and TST+ ECs (p,0.001,
Kruskal Wallis test). Similarly, BCG-induced IL10 was also greater
in TB patients as compared with both TST- and TST+ ECs
(p,0.001, Kruskal Wallis test).
Mycobacterium tuberculosis – and BCG- Induced CCL3
Secretion in Patients with TB
CCL3 has been shown to be inhibitory for M tuberculosis growth
in macrophages [45] and has been shown to be upregulated in M.
tuberculosis infected macrophages [46]. We determined Mycobacte-
rium- induced CCL3 secretion in PBMCs and found that neither
M. tuberculosis- nor BCG-induced levels of CCL3 differed between
patients and healthy controls (Table 3).
Reduced CCL2 but Increased IFNc Secretion to M.
tuberculosis in Patients with Localized ETB Compared to
PTB
Previous studies have shown that Mycobacterium induced host
immune responses differ in pulmonary and extrapulmonary TB
[23,25]. We investigated the association between chemokine and
cytokine activation in the tuberculosis patients and the clinical
severity of their disease by studying patients with either pulmonary
(PTB) or extrapulmonary disease (ETB). Patients were further
stratified into either minimal (min-PTB) or moderately advanced
(mod-PTB) disease in the pulmonary group on the basis of lung
tissue involvement [37] Extrapulmonary tuberculosis patients were
stratified accordingly to WHO clinical severity guidelines [47] into
less severe localized disease (L-ETB) or severe disseminated disease
(D-ETB).
We found no significant differences between M. tuberculosis-
induced CCL2 responses from PBMCs of patients with minimal or
moderately advanced PTB (median; min-PTB, 31.5; mod-PTB,
1712 pg/ml, p=0.16), although the trend of CCL2 secretion was
greater in mod-PTB patients. The PTB patient groups were
combined for comparison with those of ETB group. As shown in
Figure 1A, M. tuberculosis –induced CCL2 was significantly greater
in patients with PTB as compared with L-ETB (p=0.001). In
addition, CCL2 secreted levels from L-ETB patients were also
reduced as compared with those with D-ETB (p,0.001).
M. tuberculosis-induced IFNc responses did not differ significantly
between patients with min-PTB and mod-PTB (median: minPTB,
298.1; mod-PTB, 233 pg/ml, p=0.841). M. tuberculosis- induced
IFNc secretion in the combined group of PTB patients was
significantly lower than responses observed in the L-ETB group
(p=0.04, Fig. 1B). Surprisingly, no difference was observed
between IFNc levels from D-ETB and L-ETB which may be due
to the variability in IFNc responses between donors within each
patient group.
BCG-Induces Reduced CCL2 and IFNc Secretion from
PBMCs of Patients with D-ETB
We also determined BCG-induced chemokine and cytokine
responses (Fig. 1 C and D) in PBMCs of patients with pulmonary
and extrapulmonary TB, in order to investigate a relationship
Table 3. Increased M. tuberculosis- and M. bovis
BCG - induced CCL2 and IL10 and decreased IFNc responses in
TB patients.
Unstimulated cells
Group (n)CCL2IFNc
IL10CCL3
Median (IQR) Median (IQR)Median (IQR)Median (IQR)
TST- ECs
(n=19)
0 (173)11 (86) 0 (2)197 (1384)
TST+ ECs
(n=17)
832 (1266)12 (39)6.1 (39)618 (2458)
TB (n=66) 0 (415)5.1 (33)6 (42)211 (996)
p value0.1470.4910.0510.195
M. tuberculosis-induced responses
Group (n)
d CCL2
d IFNcd IL10
d CCL3
Median (IQR)Median (IQR)Median (IQR)Median (IQR)
TST- ECs
(n=19)
0 (0) 798 (1446) 0 (47) 1827 (1679)
TST+ ECs
(n=17)
0 (0) 1740 (2564)0 (0) 1441 (2342)
TB (n=66) 1234 (4993)389 (945)217 (549) 1114 (1677)
p value
,0.001 *0.042 *
,0.001 *0.84
BCG-induced responses
Group (n)
d CCL2
d IFNcd IL10
d CCL3
Median (IQR)Median (IQR)Median (IQR)Median (IQR)
TST- ECs
(n=19)
0 (0)707 (786) 0 (12) 1992 (1420)
TST+ ECs
(n=17)
0 (0) 1279 (1824)0 (0.8)763 (2348)
TB (n=63)204 (798)405 (669)92 (221) 1194 (1487)
p value
,0.001 *
,0.01 *
,0.001 *0.363
ECs, healthy endemic controls; TST, tuberculin skin test; TB, patients with
tuberculosis.
‘d’ denotes cytokine secretion after background subtraction in each case.
‘*’ denotes p,0.05 using the Kruskal-Wallis nonparametric test; values in bold
indicate those which are significantly higher.
IQR, interquartile range between 25thand 75thpercentile.
doi:10.1371/journal.pone.0008459.t003
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org5 December 2009 | Volume 4 | Issue 12 | e8459

Page 6

between cytokine induction and disease severity in the groups.
Overall, BCG-induced CCL2 levels from PTB patients were
significantly raised as compared with those from patients with
L-ETB (p,0.001, Fig. 1C). BCG-induced CCL2 levels of patients
with D-ETB were also greater than those observed in the L-ETB
group (p,0.001), Fig. 1C.
BCG-induced IFNc from PBMCs of L-ETB patients on the
other hand was significantly greater than those from patients with
D-ETB (p=0.036), Fig. 1D. Within PTB patients, BCG-induced
CCL2 did not differ significantly between minimal and moderate
disease (median: min-PTB, 0; mod-PTB, 167.4 pg/ml; p=0.189)
and BCG-induced IFNc also showed the same trend (median:
min-PTB, 673; mod-PTB, 597 pg/ml; p=0.906).
M. tuberculosis – and BCG-Induced IL10 and CCL3
Responses Do Not Differ between PTB and ETB Severity
Groups
M. tuberculosis-induced IL10 levels were comparable between
PTB and ETB groups (Figure S1A) but there was an increasing
trend of IL10 in the disseminated ETB group (median: PTB, 56;
L-ETB, 134; D-ETB, 282 pg/ml). Within the PTB patients a
higher trend in IL10 was noted in mod-PTB as compared with
min-PTB group (median: min-PTB, 22.6 pg/ml; mod-PTB,
483 pg/ml, p=0.078), however this difference was not significant.
M. tuberculosis- induced CCL3 concentrations were found to be
comparable between the pulmonary and extrapulmonary TB
patients studied (Fig. S1B: median; PTB, 1306; L-ETB, 999 D-
ETB, 1471 pg/ml, respectively), as well as between PTB patients
with either minimal or moderate disease (median; min-PTB, 974;
mod-PTB, 1425; p=0.653).
BCG-induced IL10 levels were comparable between PTB and
E-TB groups (Fig. S1C) although there was an increasing trend of
IL10 in the disseminated ETB group (median: PTB, 36; L-ETB,
69; D-ETB, 93 pg/ml). Although not significant, again BCG-
induced IL10 responses of PBMCs showed a higher trend in mod-
PTB as compared with min-PTB group (median: min-PTB,
35.9 pg/ml; mod-PTB, 311 pg/ml, p=0.228). Association of
IL10 with increasing pathology supports the hypothesis that IL10
may play a role in reducing collateral tissue damage [48].
Figure 1. Differential M. tuberculosis- and BCG- induced CCL2 and IFNc responses with TB clinical disease severity. PBMCs (106) were
infected with M. tuberculosis or BCG (106CFU) for 18 h after which cell supernatants were harvested for the measurement of cytokines and
chemokines. The box plots represent the data for each group after the level of cytokine secretion from unstimulated cells was subtracted. The
whiskers indicate the 25th and 75th quartiles, while a line indicating the median separates the two. ‘*’, denotes significant differences between
groups (p,0.05) using the Mann-Whitney U test. The data show A) M. tuberculosis-induced CCL2 responses of PBMCs from patients with pulmonary
tuberculosis (PTB, n=34) and extrapulmonary TB with less severe localized (L-ETB, n=16) and severe disseminated (D-ETB, n=16) disease, B) M.
tuberculosis-induced IFNc responses BCG-induced CCL2 responses (C) and IFNc responses (D) were obtained from PTB, n=33; L-ETB, n=16; D-ETB,
n=14.
doi:10.1371/journal.pone.0008459.g001
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org6December 2009 | Volume 4 | Issue 12 | e8459

Page 7

BCG- induced CCL3 was comparable between patients with
either minimal or moderate PTB (median; min-PTB, 974; mod-
PTB, 1425; p=0.834). BCG- induced CCL3 concentrations were
found to be comparable between the pulmonary and extrapul-
monary TB patients studied (Fig. S1D; median: PTB, 1592; L-
ETB, 1056; D-ETB, 1296 pg/ml, respectively), indicating an
absence of association of CCL3 with TB disease severity.
Differential CCL2 and TNFa Gene Expression in
Pulmonary and Extrapulmonary Tuberculosis
Manyreportswhich haveinvestigatedchemokineresponsestoM.
tuberculosis in patients have focused on either protein secretion or
gene expression responses. To determine whether the secretory
patterns we observed matched gene expression trends we
investigated M. tuberculosis -induced mRNA transcripts in stimulated
PBMCs by studying CCL2 and CCL3 expression. As CCL2 and
CCL3 expression is regulated by TNFa, a critical activator of
macrophages [49,50] we also determined the expression of TNFa.
In addition, we investigated the expression of CXCL8, which is
responsiblefor neutrophil recruitment and has been shown to play a
role in tuberculosis infections [51]. We determined gene expression
in both pulmonary and extrapulmonary TB groups. M. tuberculosis
infection of PBMCs resulted in significantly greater CCL2
expression in PBMCs of PTB patients (Fig. 2A) as compared to
those with L-ETB (p=0.023). M. tuberculosis induced CCL2
expression was also increased in D-ETB patients as compared with
L-ETB (p=0.005). M. tuberculosis-induced TNFa was significantly
greater in PTB patients (Fig. 2B) as compared with L-ETB
(p=0.02). TNFa expression was also raised in D-ETB as compared
with L-ETB (p=0.09), although this difference was not significant.
BCG-induced CCL2 mRNA expression was lower in PTB as
compared with that induced by M. tuberculosis. No difference was
found between BCG-induced CCL2 mRNA expression between
TB groups (Fig. 2A). BCG-induced TNFa was greater in patients
with PTB than those with L-ETB (p=0.03), Fig. 2B.
M. tuberculosis- induced CCL3 and CXCL8 mRNA transcripts
were comparable between PTB, L-ETB and D-ETB groups, Figure
S2 A-B. BCG-induced CCL3 (Fig. S2C) and, –CXCL8 mRNA
expression (Fig. S2D) were also comparable between TB groups.
Discussion
Our data illustrates differences in the activation of immune
regulatory chemokines and cytokines in tuberculosis disease with
Figure 2. Differential M. tuberculosis-induced CCL2 and TNFa mRNA expression in pulmonary and extrapulmonary TB. RNA was
extracted from Mycobacterium-infected PBMCs after 18 h post stimulation and subjected to RTPCR for chemokine and cytokine genes. Box plots
depict fold increase in gene expression after normalization to the housekeeping gene HuPO. The whiskers indicate the 25th and 75th quartiles, while
a line indicating the median separates the two. ‘*’, p,0.05, indicate differences between groups using the Mann-Whitney U test. Data is depicted as
fold increase in each target gene per 100 copies. M. tuberculosis -induced mRNA expression of A) CCL2, and B) TNFa is shown for PTB, n=22; L-ETB,
n=15, D-ETB, n=13 patients. BCG-induced mRNA expression of C) CCL2 and D) TNFa is shown for PTB, n=16; L-ETB, n=14; L-ETB, n=14 patients. ‘*’,
p,0.05, indicate differences between groups using the Mann-Whitney U test, TNFa (TNFa).
doi:10.1371/journal.pone.0008459.g002
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org7 December 2009 | Volume 4 | Issue 12 | e8459

Page 8

differing site and severity. CCL2 has potent chemotactic and
activating properties for monocytes, macrophages, dendritic cells
and CD4+ T cells. The most significant finding was that CCL2
was consistently associated with severe disease. We propose that
CCL2 could be a useful adjunct marker of severity in tuberculosis.
To evaluate differences between background immune responses
due to BCG vaccination and environmental mycobacteria and
infection with M. tuberculosis, we investigated host immune
responses in vitro infection with virulent M. tuberculosis H37Rv
and avirulent M. bovis BCG vaccine strains. Both M. tuberculosis and
BCG elicited an increase in CCL2 in TB patients as compared
with controls. CCL2 is responsible for the recruitment of
leucocytes to the site of infection and therefore raised CCL2
may be characteristic of granuloma formation and the influx of
monocyte driven responses.
Our finding that M. tuberculosis infection results in reduced IFNc
secretion in patients as compared with TST+ ECs donors is
consistent with previous reports [52]. The BCG-induced IFNc
responses which were depressed in TB patients compared with
both TST- ECS and TST+ ECS healthy controls also confirm our
previous reports on pulmonary TB patients [53]. All of our ECs
were BCG vaccinated so the increased IFNc responses to BCG
may be related to the presence of T memory recall responses in
these individuals. The absence of similar T memory recall
responses in TB patients could be due to raised IL10 in TB
patients as compared with healthy controls, resulting in down
modulation of T cell responses in TB patients [54].
CCL3 is a macrophage and T cell attractant, activated by M.
tuberculosis infection of host cells [55,56]. We found M. tuberculosis
and BCG both induced CCL3 secretion and gene expression in
PBMCs. However, we found no association of CCL3 (either
protein levels or gene expression) between tuberculosis patients
and healthy controls in response to M. tuberculosis or BCG
stimulation.
While a number of studies have utilized both microarray and
RT-PCR studies to analyze Mycobacterium-induced expression in
macrophages, most of these studies have been performed in
murine cells [57,58]. A study by Ragno et al. showed M. tuberculosis
induced changes in the THP-1 monocytic cell line, where it was
reported that a number of chemokines such as CCL2, CCL3,
CXCL8 in addition to cell surface adhesion molecules ICAM and
integrins were upregulated post-infection [59]. There is limited
data on gene expression profiles in TB patients with differing
severity of disease.
While the value of BCG vaccination in early childhood to
prevent disseminated disease is widely accepted the value of BCG
vaccination in adult population particularly for pulmonary
disease has been challenged in high burden countries [60]. The
number of patients who were BCG vaccinated in the patient
groups varied; with a greater proportion in L-ETB (82%) than
those with D-ETB (40%). There is very limited data on the
protection provided by BCG in adult tuberculosis and although
this data is too small to draw any conclusions it suggests that
BCG vaccination may result in a preponderance of less severe
extrapulmonary TB disease.
The data available regarding age of ETB patients is variable
according to region and ethnicity of the study populations, with
ETB associated with younger age (,25) and females in African
and Asian patients [61–63]. Reports from Turkey show that the
predominant age range studies is 25–44 y for ETB patients [2].
Our TB patients were of the range 24.5–31.5 y, and within this we
found ETB patients to be older than those with PTB (p=0.034).
This may also not be a contradictory result as all of our patients
were already in a younger age range. A larger number of samples
with a broader age range need to be analyzed for further
confirmation.
When responses between patients with pulmonary and
extrapulmonary TB were compared, M. tuberculosis and BCG-
induced CCL2 secretion was found to be increased in patients with
pulmonary TB as compared with those with less severe localized
extrapulmonary TB. M. tuberculosis- induced secretion and mRNA
expression of CCL2 was greater in PTB than in L-ETB, and also
reduced in L-ETB as compared with D-ETB patients. Our
comparison of M. tuberculosis and BCG-induced responses in
patients illustrated that although the trend of response to the
mycobacteria was similar, the magnitude of responses to the
virulent mycobacteria was greater than that to attenuated BCG.
As the L-ETB group consisted of patients with tuberculous
lymphadenopathy, this may indicate more active monocyte and T
cell recruitment in disease localized to the lung parenchyma as
compared to lymph nodes. It also supports previous reports of
increased CCL2 secretion in cells of TB patients with pulmonary
disease [23,64].
The raised CCL2 responses in patients with severe disseminated
D-ETB (spinal, tuberculous meningitis and abdominal TB) as
compared with L-ETB, also indicate that increased CCL2 is
associated with increasing disease severity. This fits with previous
work which has shown that levels of inflammatory chemokines are
increased in body fluids of patients with extrapulmonary
disseminated infections TB such as in tuberculous meningitis,
spinal tuberculosis or miliary disease [65–67].
Raised M. tuberculosis - induced IFNc in localized L-ETB as
compared with pulmonary TB corresponds with previous studies
employing mycobacterial antigen ESAT6 driven responses [25].
The WHO clinical classification of tuberculosis disease severity
lists tuberculous lymphadenitis as the least severe form of TB. The
increased effector T cell IFNc response in the L-ETB group as
compared with pulmonary TB may reflect a reduction in IFNc
with increasing mycobacterial load, inflammation and clinical
severity. We have also previously reported an inverse relationship
of IFNc levels in response to M. tuberculosis culture filtrate proteins
with clinical severity in both PTB [68] and ETB [69]. BCG-
induced IFNc was raised in L-ETB but only when compared with
the D-ETB group. As there were more BCG vaccinees in the L-
ETB group this may reflect increased M. tuberculosis-specific T cell
responses than in the D-ETB group. This is consistent with the
role of IFNc as a potent activator of macrophages for
mycobacterial killing and stasis [70].
We did not observe any difference in M. tuberculosis induced
CCL3 secretion, or CCL3 mRNA expression between patients
with pulmonary or extrapulmonary TB with disease in single or
multiple sites. Reports by Qiu et al. have shown CCL3, CXCL10
and their receptors CCR3, CCR4 and CXCR3 to be upregulated
in an unbalanced manner in severe TB in the macaque model
[71]. However, in the same study they observed low antigen
specific cellular responses in the severely infected macaques [72],
indicating a reduced ability of the immune cells to respond to a
subsequent challenge with M. tuberculosis. Previously, increasing
levels of CXCL8 have been shown to be associated with fatal
tuberculosis [73]. Therefore, the lack of difference in CXCL8
transcription observed in localized and severe ETB may be due to
an antigen specific anergy in severe disease.
TNFa has previously been associated with increasing bacterial
load and to be responsible for disease progression in unregulated
granuloma formation [74]. Our data showing an increase in
CCL2 and TNFa in response to M. tuberculosis infection agrees
with previous work in murine bone marrow derived macrophages
by Kahnert et al. [75].
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org8December 2009 | Volume 4 | Issue 12 | e8459

Page 9

The differences in chemokine and cytokine responses of TB
patients elicited by M. tuberculosis and BCG indicate that M.
tuberculosis-specific immune responses remain detectable even in
highly endemic populations, where there may be high background
responses to environmental mycobacteria. However, such back-
ground variability is reflected in the highly variable responses
observed in all patient groups as well as in the control groups.
Tuberculosis represents an immune spectrum across clinical and
subclinical (latent) infection which can only be defined by the host
immune response [76,77]. Clinical studies in humans are therefore
limited due to the highly polymorphic and multifactorial nature of
the immune responses in a background of variable exposure to
cross reactive stimuli.
Overall, these data shows that using CCL2 could provide an
adjunct marker of disease severity. In less severe ETB we found the
highest IFNc responses, but lowest CCL2, TNFa and IL10
responses. The coordinate increase in CCL2 and TNFa responses
observed in the pulmonary TB group, may indicate active
monocyte recruitment to the lungs which are likely to facilitate
granuloma formation and localization of M. tuberculosis infection.
Only CCL2 was increased in severe ETB. Therefore, this suggests
that without supportive TNFa regulation CCL2 driven leucocyte
activation may not be effective. As a consequence, raised CCL2 in
itself may be associated with clinical disease severity and
dissemination of infection in the host. It is possible that CCL2
may have a better predictive power when combined with other yet
unidentified markers. Larger scale studies are required to further
define the role of CCL2 in clinical tuberculosis.
Supporting Information
Figure S1
responses in TB patients. PBMCs (106) were infected with M.
tuberculosis or BCG (106CFU) for 18 h after which cell
supernatants were harvested for the measurement of cytokines
and chemokines. The box plots represent the data for each group
after the level of cytokine secretion from unstimulated cells was
subtracted. The whiskers indicate the 25th and 75th quartiles,
while a line indicating the median separates the two. ‘*’ denotes
M. tuberculosis- and BCG- induced IL10 and CCL3
significant differences between groups (p,0.05) using the Mann-
Whitney U test. The data show A) M. tuberculosis-induced IL10 (A)
and CCL3 (B) responses of PBMCs from patients with pulmonary
tuberculosis (PTB, n=34) and extrapulmonary TB with limited
(L-ETB, n=16) and disseminated (D-ETB, n=16) disease. BCG-
induced IL10 (C) and CCL3 responses (D) were obtained from
PTB, n=33; L-ETB, n=16; D-ETB, n=14.
Found at: doi:10.1371/journal.pone.0008459.s001 (5.09 MB TIF)
Figure S2
mRNA expression in pulmonary and extrapulmonary TB patients.
RNA was extracted from M. tuberculosis- or BCG-infected PBMCs
after 18 h post stimulation and subjected to RTPCR for
chemokine and cytokine genes. Graphs depict fold increase in
gene expression after normalization to the housekeeping gene
HuPO. Data is depicted as fold increase in each target gene per
100 copies. Box plots depict fold increase in gene expression after
normalization to the housekeeping gene HuPO. The whiskers
indicate the 25th and 75th quartiles, while a line indicating the
median separates the two. ‘*’, p,0.05, indicate differences
between groups. M. tuberculosis -induced mRNA expression of A)
CCL3, and B) CXCL8 is shown for PTB, n=22; L-ETB, n=15,
D-ETB, n=13 patients. BCG-induced mRNA expression of C)
CCL3 and D) CXCL8 is shown for PTB, n=16; L-ETB, n=14;
L-ETB, n=14 patients.
Found at: doi:10.1371/journal.pone.0008459.s002 (4.85 MB TIF)
M. tuberculosis- and BCG-induced CCL3 and CXCL8
Acknowledgments
We thank Kausar Naseem, Seema Jamil, Rouknuddin Ali and Muniba
Islam for technical assistance. We thank Drs. Ghaffar Dawood, M. Aslam
Khan and Javaid Khan for help with patient recruitment.
Author Contributions
Conceived and designed the experiments: ZH. Performed the experiments:
ZH. Analyzed the data: ZH JMC MA RH. Contributed reagents/
materials/analysis tools: HMD BJ MI MA. Wrote the paper: ZH JMC
HMD RH.
References
1. World Health Organization (2009) Global tuberculosis control.
2. Cagatay AA, Caliskan Y, Aksoz S, Gulec L, Kucukoglu S, et al. (2004)
Extrapulmonary tuberculosis in immunocompetent adults. Scand J Infect Dis
36: 799–806.
3. Sharma SK, Mohan A (2004) Extrapulmonary tuberculosis. Indian J Med Res
120: 316–353.
4. Harries AD (1990) Tuberculosis and human immunodeficiency virus infection in
developing countries. Lancet 335: 387–390.
5. Orme IM (1993) Immunity to mycobacteria. Curr Opin Immunol 5: 497–502.
6. Jo EK, Park JK, Dockrell HM (2003) Dynamics of cytokine generation in
patients with active pulmonary tuberculosis. Curr Opin Infect Dis 16: 205–210.
7. Murray PJ, Young RA (1999) Increased antimycobacterial immunity in
interleukin-10-deficient mice. Infect Immun 67: 3087–3095.
8. Aarestrup FM, Sampaio EP, de Moraes MO, Albuquerque EC, Castro AP, et al.
(2000) Experimental Mycobacterium leprae infection in BALB/c mice: effect of
BCG administration on TNF-alpha production and granuloma development.
Int J Lepr Other Mycobact Dis 68: 156–166.
9. Bean AG, Roach DR, Briscoe H, France MP, Korner H, et al. (1999) Structural
deficiencies in granuloma formation in TNF gene-targeted mice underlie the
heightened susceptibility to aerosol Mycobacterium tuberculosis infection, which
is not compensated for by lymphotoxin. J Immunol 162: 3504–3511.
10. Algood HM, Chan J, Flynn JL (2003) Chemokines and tuberculosis. Cytokine
Growth Factor Rev 14: 467–477.
11. Collins HL, Kaufmann SH (2001) The many faces of host responses to
tuberculosis. Immunology 103: 1–9.
12. Flynn JL, Ernst JD (2000) Immune responses in tuberculosis. Curr Opin
Immunol 12: 432–436.
13. Ulrichs T, Kosmiadi GA, Jorg S, Pradl L, Titukhina M, et al. (2005) Differential
organization of the local immune response in patients with active cavitary
tuberculosis or with nonprogressive tuberculoma. J Infect Dis 192: 89–97.
14. Penido C, Vieira-de-Abreu A, Bozza MT, Castro-Faria-Neto HC, Bozza PT
(2003) Role of monocyte chemotactic protein-1/CC chemokine ligand 2 on
gamma delta T lymphocyte trafficking during inflammation induced by
lipopolysaccharide or Mycobacterium bovis bacille Calmette-Guerin.
J Immunol 171: 6788–6794.
15. Saunders BM, Britton WJ (2007) Life and death in the granuloma:
immunopathology of tuberculosis. Immunol Cell Biol 85: 103–111.
16. Kipnis A, Basaraba RJ, Orme IM, Cooper AM (2003) Role of chemokine ligand
2 in the protective response to early murine pulmonary tuberculosis.
Immunology 109: 547–551.
17. Dorner BG, Scheffold A, Rolph MS, Huser MB, Kaufmann SH, et al. (2002)
MIP-1alpha, MIP-1beta, RANTES, and ATAC/lymphotactin function together
with IFN-gamma as type 1 cytokines. Proc Natl Acad Sci U S A 99: 6181–6186.
18. Saukkonen JJ, Bazydlo B, Thomas M, Strieter RM, Keane J, et al. (2002) Beta-
chemokines are induced by Mycobacterium tuberculosis and inhibit its growth.
Infect Immun 70: 1684–1693.
19. Moser B, Wolf M, Walz A, Loetscher P (2004) Chemokines: multiple levels of
leukocyte migration control. Trends Immunol 25: 75–84.
20. Walz A, Peveri P, Aschauer H, Baggiolini M (1987) Purification and amino acid
sequencing of NAF, a novel neutrophil-activating factor produced by monocytes.
Biochem Biophys Res Commun 149: 755–761.
21. Kurashima K, Mukaida N, Fujimura M, Yasui M, Nakazumi Y, et al. (1997)
Elevated chemokine levels in bronchoalveolar lavage fluid of tuberculosis
patients. Am J Respir Crit Care Med 155: 1474–1477.
22. Park JS, Kim YS, Jee YK, Myong NH, Lee KY (2003) Interleukin-8 production in
tuberculouspleurisy:roleofmesothelial cellsstimulatedbycytokinenetworkinvolving
tumour necrosis factor-alpha and interleukin-1 beta. Scand J Immunol 57: 463–469.
23. Hasan Z, Zaidi I, Jamil B, Khan MA, Kanji A, et al. (2005) Elevated ex vivo
monocyte chemotactic protein-1 (CCL2) in pulmonary as compared with extra-
pulmonary tuberculosis. BMC Immunol 6: 14.
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org9December 2009 | Volume 4 | Issue 12 | e8459

Page 10

24. Hasan Z, Jamil B, Khan J, Ali R, Khan MA, et al. (2009) Relationship between
circulating levels of IFN-gamma, IL-10, CXCL9 and CCL2 in pulmonary and
extrapulmonary tuberculosis is dependent on disease severity. Scand J Immunol
69: 259–267.
25. Hasan Z, Jamil B, Ashraf M, Islam M, Yusuf MS, et al. (2009) ESAT6-induced
IFNgamma and CXCL9 can differentiate severity of tuberculosis. PLoS One 4:
e5158.
26. Jamil B, Shahid F, Hasan Z, Nasir N, Razzaki T, et al. (2007) Interferon
gamma/IL10 ratio defines the disease severity in pulmonary and extra
pulmonary tuberculosis. Tuberculosis (Edinb) 87: 279–287.
27. Kim DK, Park GM, Hwang YI, Kim HJ, Han SK, et al. (2006) Microarray
analysis of gene expression associated with extrapulmonary dissemination of
tuberculosis. Respirology 11: 557–565.
28. Friedland JS, Hartley JC, Hartley CG, Shattock RJ, Griffin GE (1995) Inhibition
of ex vivo proinflammatory cytokine secretion in fatal Mycobacterium
tuberculosis infection. Clin Exp Immunol 100: 233–238.
29. Kahnert A, Seiler P, Stein M, Bandermann S, Hahnke K, et al. (2006)
Alternative activation deprives macrophages of a coordinated defense program
to Mycobacterium tuberculosis. Eur J Immunol 36: 631–647.
30. Mollenkopf HJ, Hahnke K, Kaufmann SH (2006) Transcriptional responses in
mouse lungs induced by vaccination with Mycobacterium bovis BCG and
infection with Mycobacterium tuberculosis. Microbes Infect 8: 136–144.
31. Ragno S, Romano M, Howell S, Pappin DJ, Jenner PJ, et al. (2001) Changes in
gene expression in macrophages infected with Mycobacterium tuberculosis: a
combined transcriptomic and proteomic approach. Immunology 104: 99–108.
32. Thuong NT, Dunstan SJ, Chau TT, Thorsson V, Simmons CP, et al. (2008)
Identification of tuberculosis susceptibility genes with human macrophage gene
expression profiles. PLoS Pathog 4: e1000229.
33. The Consultants Consortium Soc (2000) Third party evaluation of Expanded
Programme on Immunization, Punjab. Sec KEMC.
34. Hasan Z, Jamil B, Ashraf M, Islam M, Dojki M, et al. (2009) Differential live
Mycobacterium tuberculosis-, M. bovis BCG-, recombinant ESAT6-, and
culture filtrate protein 10-induced immunity in tuberculosis. Clin Vaccine
Immunol 16: 991–998.
35. Hussain R, Talat N, Shahid F, Dawood G (2009) Biomarker Changes Associated
with Tuberculin Skin Test (TST) Conversion: A Two-Year Longitudinal Follow-
Up Study in Exposed Household Contacts. PLoS ONE 4: e7444.
36. Hasan Z, Jamil B, Khan J, Ali R, Khan MA, et al. (2009) Relationship between
circulating levels of IFN-gamma, IL-10, CXCL9 and CCL2 in pulmonary and
extrapulmonary tuberculosis is dependent on disease severity. Scand J Immunol
69: 259–267.
37. Crofton J (1990) Clinical features of tuberculosis. In: Crofton and Douglas
Respiratory Diseases. Blackwell Scientific. pp 395–421.
38. Hussain R, Hasan R, Khurshid M, Sturm AW, Ellner JJ, et al. (1996) Pulmonary
tuberculosis in a BCG vaccinated area: relationship of disease severity with
immunological and hematological parameters and drug resistance patterns.
Southeast Asian J Trop Med Public Health 27: 257–262.
39. WHO (2008) Country Profile Pakistan. World Health Organization. pp
133–136.
40. Hasan Z, Shah BH, Mahmood A, Young DB, Hussain R (2003) The effect of
mycobacterial virulence and viability on MAP kinase signalling and TNF alpha
production by human monocytes. Tuberculosis (Edinb) 83: 299–309.
41. Hasan Z, Jamil B, Ashraf M, Islam M, Dojki M, et al. (2009) Differential live
Mycobacterium tuberculosis-, M. bovis BCG-, recombinant ESAT6-, and
culture filtrate protein 10-induced immunity in tuberculosis. Clin Vaccine
Immunol 16: 991–998.
42. Dheda K, Huggett JF, Bustin SA, Johnson MA, Rook G, et al. (2004) Validation
of housekeeping genes for normalizing RNA expression in real-time PCR.
Biotechniques 37: 112–119.
43. Dheda K, Huggett JF, Bustin SA, Johnson MA, Rook G, et al. (2004) Validation
of housekeeping genes for normalizing RNA expression in real-time PCR.
Biotechniques 37: 112–119.
44. Hussain R, Hasan R, Khurshid M, Sturm AW, Ellner JJ, et al. (1996) Pulmonary
tuberculosis in a BCG vaccinated area: relationship of disease severity with
immunological and hematological parameters and drug resistance patterns.
Southeast Asian J Trop Med Public Health 27: 257–262.
45. Saukkonen JJ, Bazydlo B, Thomas M, Strieter RM, Keane J, et al. (2002) Beta-
chemokines are induced by Mycobacterium tuberculosis and inhibit its growth.
Infect Immun 70: 1684–1693.
46. Volpe E, Cappelli G, Grassi M, Martino A, Serafino A, et al. (2006) Gene
expression profiling of human macrophages at late time of infection with
Mycobacterium tuberculosis. Immunology 118: 449–460.
47. World Health Organization (2008) Implementing the WHO Stop TB Strategy: a
handbook for National Tuberculosis Control Programmes.
48. O’Garra A, Vieira PL, Vieira P, Goldfeld AE (2004) IL-10 producing and naturally
occurring CD4+ Tregs: limiting collateral damage. J Clin Invest 114: 1372–1378.
49. Algood HM, Lin PL, Yankura D, Jones A, Chan J, et al. (2004) TNF influences
chemokine expression of macrophages in vitro and that of CD11b+ cells in vivo
during Mycobacterium tuberculosis infection. J Immunol 172: 6846–6857.
50. Chaly YV, Selvan RS, Fegeding KV, Kolesnikova TS, Voitenok NN (2000)
Expression of IL-8 gene in human monocytes and lymphocytes: differential
regulation by TNF and IL-1. Cytokine 12: 636–643.
51. Friedland JS, Hartley JC, Hartley CG, Shattock RJ, Griffin GE (1995) Inhibition
of ex vivo proinflammatory cytokine secretion in fatal Mycobacterium
tuberculosis infection. Clin Exp Immunol 100: 233–238.
52. Hasan Z, Jamil B, Ashraf M, Islam M, Dojki M, et al. (2009) Differential live
Mycobacterium tuberculosis-, M. bovis BCG-, recombinant ESAT6-, and
culture filtrate protein 10-induced immunity in tuberculosis. Clin Vaccine
Immunol 16: 991–998.
53. Hasan Z, Jamil B, Ashraf M, Islam M, Dojki M, et al. (2009) Differential live
Mycobacterium tuberculosis-, M. bovis BCG-, recombinant ESAT6-, and
culture filtrate protein 10-induced immunity in tuberculosis. Clin Vaccine
Immunol 16: 991–998.
54. Hussain R, Talat N, Shahid F, Dawood G (2007) Longitudinal tracking of cytokines
after acute exposure to tuberculosis: association of distinct cytokine patterns with
protection and disease development. Clin Vaccine Immunol 14: 1578–1586.
55. Dorner BG, Scheffold A, Rolph MS, Huser MB, Kaufmann SH, et al. (2002)
MIP-1alpha, MIP-1beta, RANTES, and ATAC/lymphotactin function together
with IFN-gamma as type 1 cytokines. Proc Natl Acad Sci U S A 99: 6181–6186.
56. Saukkonen JJ, Bazydlo B, Thomas M, Strieter RM, Keane J, et al. (2002) Beta-
chemokines are induced by Mycobacterium tuberculosis and inhibit its growth.
Infect Immun 70: 1684–1693.
57. Kahnert A, Seiler P, Stein M, Bandermann S, Hahnke K, et al. (2006)
Alternative activation deprives macrophages of a coordinated defense program
to Mycobacterium tuberculosis. Eur J Immunol 36: 631–647.
58. Mollenkopf HJ, Hahnke K, Kaufmann SH (2006) Transcriptional responses in
mouse lungs induced by vaccination with Mycobacterium bovis BCG and
infection with Mycobacterium tuberculosis. Microbes Infect 8: 136–144.
59. Ragno S, Romano M, Howell S, Pappin DJ, Jenner PJ, et al. (2001) Changes in
gene expression in macrophages infected with Mycobacterium tuberculosis: a
combined transcriptomic and proteomic approach. Immunology 104: 99–108.
60. Fine P (2001) BCG: the challenge continues. Scan J Infect Dis 33: 243–245.
61. Forssbohm M, Zwahlen M, Loddenkemper R, Rieder HL (2008) Demographic
characteristics of patients with extrapulmonary tuberculosis in Germany. Eur
Respir J 31: 99–105.
62. Sreeramareddy C, Panduru K, Verma S, Joshi H, Bates M (2008) Comparison
of pulmonary and extrapulmonary tuberculosis in Nepal- a hospital-based
retrospective study. BMC Infectious Diseases 8: 8.
63. Ebdrup L, Storgaard M, Jensen-Fangel S, Obel N (2003) Ten years of
extrapulmonary tuberculosis in a Danish university clinic. Scan J Infect Dis 35:
244–246.
64. Sterling TR, Martire T, de Almeida AS, Ding L, Greenberg DE, et al. (2007)
Immunefunctioninyoungchildren withprevious pulmonaryor miliary/meningeal
tuberculosis and impact of BCG vaccination. Pediatrics 120: e912–e921.
65. Mastroianni CM, Lancella L, Mengoni F, Lichtner M, Santopadre P, et al.
(1998) Chemokine profiles in the cerebrospinal fluid (CSF) during the course of
pyogenic and tuberculous meningitis. Clin Exp Immunol 114: 210–214.
66. Sharma SK, Mitra DK, Balamurugan A, Pandey RM, Mehra NK (2002) Cytokine
polarization in miliary and pleural tuberculosis. J Clin Immunol 22: 345–352.
67. Thwaites GE, Simmons CP, Than Ha QN, Thi Hong CT, Phuong MP, et al.
(2003) Pathophysiology and prognosis in vietnamese adults with tuberculous
meningitis. J Infect Dis 188: 1105–1115.
68. Hussain R, Hasan R, Khurshid M, Sturm AW, Ellner JJ, et al. (1996) Pulmonary
tuberculosis in a BCG vaccinated area: relationship of disease severity with
immunological and hematological parameters and drug resistance patterns.
Southeast Asian J Trop Med Public Health 27: 257–262.
69. Jamil B, Shahid F, Hasan Z, Nasir N, Razzaki T, et al. (2007) Interferon
gamma/IL10 ratio defines the disease severity in pulmonary and extra
pulmonary tuberculosis. Tuberculosis (Edinb) 87: 279–287.
70. Flynn JL, Chan J, Triebold KJ, Dalton DK, Stewart TA, et al. (1993) An
essential role for IFN-c in resistance to Mycobacterium tuberculosis infection. J Exp
Med 178: 2249–2254.
71. Qiu L, Huang D, Chen CY, Wang R, Shen L, et al. (2008) Severe tuberculosis
induces unbalanced up-regulation of gene networks and overexpression of IL-22,
MIP-1alpha, CCL27, IP-10, CCR4, CCR5, CXCR3, PD1, PDL2, IL-3, IFN-
beta, TIM1, and TLR2 but low antigen-specific cellular responses. J Infect Dis
198: 1514–1519.
72. Qiu L, Huang D, Chen CY, Wang R, Shen L, et al. (2008) Severe tuberculosis
induces unbalanced up-regulation of gene networks and overexpression of IL-22,
MIP-1alpha, CCL27, IP-10, CCR4, CCR5, CXCR3, PD1, PDL2, IL-3, IFN-
beta, TIM1, and TLR2 but low antigen-specific cellular responses. J Infect Dis
198: 1514–1519.
73. Friedland JS, Hartley JC, Hartley CG, Shattock RJ, Griffin GE (1995) Inhibition
of ex vivo proinflammatory cytokine secretion in fatal Mycobacterium
tuberculosis infection. Clin Exp Immunol 100: 233–238.
74. Keane J, Shurtleff B, Kornfeld H (2002) TNF-dependent BALB/c murine
macrophage apoptosis following Mycobacterium tuberculosis infection inhibits
bacillary growth in an IFN-c independent manner 41. Tuberculosis 82: 55–61.
75. Kahnert A, Seiler P, Stein M, Bandermann S, Hahnke K, et al. (2006)
Alternative activation deprives macrophages of a coordinated defense program
to Mycobacterium tuberculosis. Eur J Immunol 36: 631–647.
76. Young DB, Gideon HP, Wilkinson RJ (2009) Eliminating latent tuberculosis.
Trends Microbiol 17: 183–188.
77. Hussain R, Talat N, Shahid F, Dawood G (2007) Longitudinal tracking of cytokines
after acute exposure to tuberculosis: association of distinct cytokine patterns with
protection and disease development. Clin Vaccine Immunol 14: 1578–1586.
CCL2 in Tuberculosis
PLoS ONE | www.plosone.org10December 2009 | Volume 4 | Issue 12 | e8459