Akt promotes endocardial-mesenchyme transition.

Abstract

Endothelial to mesenchyme transition (EndMT) can be observed during the formation of endocardial cushions from the endocardium, the endothelial lining of the atrioventricular canal (AVC), of the developing heart at embryonic day 9.5 (E9.5). Many regulators of the process have been identified; however, the mechanisms driving the initial commitment decision of endothelial cells to EndMT have been difficult to separate from processes required for mesenchymal proliferation and migration. We have several lines of evidence that suggest a central role for Akt signaling in committing endothelial cells to enter EndMT. Akt1 mRNA was restricted to the endocardium of endocardial cushions while they were forming. The PI3K/Akt signaling pathway is necessary for mesenchyme outgrowth, as sprouting was inhibited in AVC explant cultures treated with the PI3K inhibitor LY294002. Furthermore, endothelial marker, VE-cadherin, was downregulated and mesenchyme markers, N-cadherin and Snail, were induced in response to expression of a constitutively active form of Akt1 (myrAkt1) in endothelial cells. Finally, we isolated the function of Akt1 signaling in the commitment to the transition using a transgenic model where myrAkt1 was pulsed only in endocardial cells and turned off after EndMT initiation. In this way, we determined that increased Akt signaling in the endocardium drives EndMT and discounted its other functions in cushion mesenchymal cells.

Full text

Page 1

BioMed Central
Page 1 of 9
(page number not for citation purposes)
Journal of Angiogenesis Research
Open Access
Research
Akt promotes Endocardial-Mesenchyme Transition
Kafi N Meadows1, Seema Iyer1, Mark V Stevens2, Duanning Wang2,
Sharon Shechter1, Carole Perruzzi1, Todd D Camenisch2 and
Laura E Benjamin*1
Address: 1Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA and 2Department of
Pharmacology and Toxicology, College of Pharmacy, The University of Arizona, Tucson, Arizona, USA
Email: Kafi N Meadows - knmeadows@gmail.com; Seema Iyer - siyer1@bidmc.harvard.edu; Mark V Stevens - stevens@pharmacy.arizona.edu;
Duanning Wang - dwang@pharmacy.arizona.edu; Sharon Shechter - sshechte@bidmc.harvard.edu;
Carole Perruzzi - cperruzz@bidmc.harvard.edu; Todd D Camenisch - camenisch@pharmacy.arizona.edu;
Laura E Benjamin* - llbenjami@bidmc.harvard.edu
* Corresponding author
Abstract
Endothelial to mesenchyme transition (EndMT) can be observed during the formation of
endocardial cushions from the endocardium, the endothelial lining of the atrioventricular canal
(AVC), of the developing heart at embryonic day 9.5 (E9.5). Many regulators of the process have
been identified; however, the mechanisms driving the initial commitment decision of endothelial
cells to EndMT have been difficult to separate from processes required for mesenchymal
proliferation and migration. We have several lines of evidence that suggest a central role for Akt
signaling in committing endothelial cells to enter EndMT. Akt1 mRNA was restricted to the
endocardium of endocardial cushions while they were forming. The PI3K/Akt signaling pathway is
necessary for mesenchyme outgrowth, as sprouting was inhibited in AVC explant cultures treated
with the PI3K inhibitor LY294002. Furthermore, endothelial marker, VE-cadherin, was
downregulated and mesenchyme markers, N-cadherin and Snail, were induced in response to
expression of a constitutively active form of Akt1 (myrAkt1) in endothelial cells. Finally, we isolated
the function of Akt1 signaling in the commitment to the transition using a transgenic model where
myrAkt1 was pulsed only in endocardial cells and turned off after EndMT initiation. In this way, we
determined that increased Akt signaling in the endocardium drives EndMT and discounted its other
functions in cushion mesenchymal cells.
Introduction
Prior to EndMT, the heart is a tube consisting of an inner
endocardium and an outer myocardium separated by a
thin layer of extracellular matrix called the cardiac jelly.
On E9.5, signals from the myocardium and cardiac jelly
induce a subset of endothelial cells in the endocardium to
transform into mesenchyme cells. They migrate into the
cardiac jelly and proliferate, eventually remodeling the
cardiac cushions into heart valve leaflets and septa for a
partitioned heart [1-4]. Several coordinated signals in the
endocardium and myocardium that modulate EndMT in
the AVC have been characterized. Developmental defects
in cardiac tissues of TGFβ2 knockout mice, resulting in
perinatal mortality, have been attributed to problems
with epithelial-mesenchymal transition which under-
scores that increased TGFβ2 expression between E8.5 and
Published: 21 September 2009
Journal of Angiogenesis Research 2009, 1:2 doi:10.1186/2040-2384-1-2
Received: 14 May 2009
Accepted: 21 September 2009
This article is available from: http://www.jangiogenesis.com/content/1/1/2
© 2009 Meadows et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 2

Journal of Angiogenesis Research 2009, 1:2http://www.jangiogenesis.com/content/1/1/2
Page 2 of 9
(page number not for citation purposes)
E9.5 is necessary for EndMT to occur [5,6]. This induction
is facilitated by endocardial activation of Notch which
also stimulates Snail transcriptional repression of vascular
endothelial (VE)-cadherin [7,8]. VE-cadherin becomes
delocalized from cell junctions, facilitating the formation
of the sprouting phenotype characteristic of mesenchyme
cells [9]. VE-cadherin downregulation is a requisite for
EndMT and, like EMT in epithelial cells, coincident N-cad-
herin upregulation marks the mesenchymal state. By
E10.5, VEGF localization in the myocardium causes the
cessation of EndMT [10,11]. It is unclear whether Akt
mediates any of these signals, however, PI3K-Akt signal-
ing has been established as a component of EndMT in a
number of systems.
In mammary epithelial cells and tumors isolated from
mouse mammary glands, Akt is activated in response to
EMT induction [12,13]. The inhibition of PI3K-Akt signal-
ing in metastatic breast tumor cells reduces EMT and tran-
scriptional responses promoted by TGFβ [14]. Moreover,
expression of myrAkt in squamous carcinoma cells is suf-
ficient to drive EMT including the relocation of epithelial
(E)-cadherin from cell junctions to cytoplasmic granules
and the induction of mesenchyme markers, N-cadherin
and vimentin [15]. Also, the importance of the Akt signal-
ing pathway in EndMT is underscored by a number of
downstream Akt pathways. Akt pathway targets including
βCatenin, Notch, and Snail are essential for EndMT and
regulate the formation of endocardial cushion [7,8,16].
Recently, PI3K signaling was determined to be necessary
for AVC mesenchyme outgrowth, as pharmacological
inhibition of Akt using an allosteric inhibitor (EMD Akt
inhibitor XI) stunted mesenchyme outgrowth in cardiac
cushion explants [17]. It is not clear from this pharmaco-
logical inhibition, which can target endocardial, myocar-
dial and mesenchyme cells, whether initiation of EndMT
is prevented or if there is a subsequent inhibition on the
migration and proliferation of mesenchyme cells since the
assay relies on counting the cells that have invaded the
collagen gel. We have investigated the hypothesis that Akt
signaling in endocardial cells initiates EndMT in the
developing heart cushions.
Materials and methods
In Situ Hybridization
In situ hybridization was performed on E10.5 CD-1
embryos as described in [18]. Specific riboprobes
designed to the 3' untranslated regions (3'UTRs) of Akt1
sense, 5' agactctgatcatcatccctgggt 3', and antisense, 5'
actctcgctgatccacatcctgag 3' were produced using the T3
transcription reaction kit and Digoxigenin (DIG)-labeling
(Roche).
Immunohistochemistry
Timed matings between VE-cadherin:tTA and either
TET:myrAkt1 mice or VE-cadherin:tTA and TET:lacZ were
used to generate embryos expressing VE-cadherin:tTA,
TET:myrAkt1, VE-cadherin:tTA/TET:myrAkt1, TET:lacZ,
and VE-cadherin:tTA/TET:lacZ. E11.5 embryos were fixed
in 3.7% paraformaldehyde, embedded in OCT, and sec-
tioned. MyrAkt embryos were stained with phospho-Akt1
(Upstate) to confirm transgene expression and localiza-
tion. LacZ embryos were stained with x-gal (Specialty
Media) to confirm LacZ localization and were counter-
stained with eosin.
Ex Vivo AVC Assay
The AVC explants were cultured as previously described in
[19]. Relative differences in mesenchyme outgrowth were
scored after 48 hours in culture (1 = monolayer growth, 2
= mesenchyme sprouts, 3 = mesenchyme sprouts with
extensive migration). Inhibitor used: 10 μM LY294002
(Sigma). Antibody: Cy3 conjugated α SMA (Sigma).
Isolation of primary mouse endothelial cells,
Immunofluorescence, Western Blot and RT-PCR
Primary endothelial cells were isolated from the hearts or
lungs of wildtype or VE-cadherin:tTA/TET:myrAkt1 mice
as described previously
TET:myrAkt1 cells were cultured in the presence of 2 μg/
ml TET (Fischer) to suppress myrAkt expression. Immun-
ofluorescent staining and western blot analysis were per-
formed according to standard protocols. Antibodies: N-
cadherin and VE-cadherin (BD-Biosciences), Snail
(Abcam), Tubulin (Calbiochem). RT-PCR analysis was
performed as described previously [21]. Primers: VE-cad-
herin sense, 5' ggccctggacagactgca 3' and antisense, 5'
ttcgtggaggagctgatc 3'. GAPDH sense, 5' ggcaaattcaacg-
gcacagt 3' and antisense, 5' aagatggtgatgggcttccc 3'.
[20]. VE-cadherin:tTA/
Results and Discussion
We analyzed the expression pattern of Akt mRNA in nor-
mal embryos by in-situ hybridization. All three Akt iso-
forms are expressed in the heart during the developmental
window where endocardial cushions are formed [22].
While Akt2 and Akt3 expression were more widespread in
all cells of the cardiac cushion (not shown), we found
Akt1 mRNA localized strictly to the endocardial layer of
E10.5 heart cushions (Figure 1A and 1B) suggesting that
Akt1 may have a unique role in EndMT. To examine the
role of Akt in EndMT, we utilized an AVC explant assay,
which recapitulates EndMT observed in vivo. The invad-
ing cells which grow out from AVCs explanted onto 3-
dimensional collagen are similar to the cushion cells of
the embryonic heart [23], and the time course of the
growth in this ex vivo culture recapitulates the onset of
EMT that occurs in vivo [24]. Control (DMSO-treated)
had numerous elongated cells sprouting into the collagen

Page 3

Journal of Angiogenesis Research 2009, 1:2http://www.jangiogenesis.com/content/1/1/2
Page 3 of 9
(page number not for citation purposes)
Akt promotes EndMT during endocardial cushion formation
Figure 1
Akt promotes EndMT during endocardial cushion formation. (A and B) E10.5 Akt1 mRNA is expressed in the endo-
cardial cushion (*) of the AVC, but not in the myocardium (M) of the ventricle (V), atria (A) or outflow track (OFT). The image
was taken under 4× (A) and 10× magnification (B). (C-F) AVC Explants were treated with DMSO (C and E) or pharmacological
inhibitor of PI3K (LY294002) (D and F). The mesenchyme outgrowth (arrows) detected in explants was significantly reduced in
explants treated with L294003, both in the brightfield images (C and D) DMSO treated as well as (E and F) α SMA stained flu-
orescent images. What outgrowth there was with LY294002 was the cobblestone morphology of an endothelial monolayer (D,
note bracket). These images were representative of multiple explants (n>10) in independent experiments.

Page 4

Journal of Angiogenesis Research 2009, 1:2http://www.jangiogenesis.com/content/1/1/2
Page 4 of 9
(page number not for citation purposes)
gel at the periphery of the explant after 48 hours in culture
(Figure 1C), while AVC explants treated with the PI3K
inhibitor LY294002, had stunted mesenchyme out-
growth, which was replaced by a cell monolayer with a
cobblestone morphology indicative of endothelial cell
growth (Figure 1D). We detected a dramatic reduction in
α-SMA positive mesenchymal cells in LY294002 treated
explants (Figure 1F) compared to controls (Figure 1E).
Akt activation and Snail induction have been clearly dem-
onstrated in a number of epithelial cell systems [12,25].
Snail acts as a transcriptional repressor of VE-cadherin
when it is induced in endothelial cells during EndMT [8].
Loss of VE-cadherin and induction of N-cadherin are not
only hallmarks of EndMT but likely facilitate loss of cell-
cell adhesion and the onset of a migratory phenotype. We
sought to determine whether Snail was induced in endo-
cardial cells in response to elevated Akt1 signaling by iso-
lating endothelial cells from neonatal mice with a
myrAkt1 transgene driven by the VE-cadherin promoter
[26]. This expression of myrAkt1 is repressible by tetracy-
cline, so we used media with and without tetracycline to
control Akt signaling allowing us to measure changes in
gene expression in response to the increased Akt1 signal.
EndMT markers were induced in VE-cadherin:tTA/TET:myrAkt1 Endothelial cells
Figure 2
EndMT markers were induced in VE-cadherin:tTA/TET:myrAkt1 Endothelial cells. (A) Protein lysates were har-
vested from VE-cadherin:tTA/TET:myrAkt1 endothelial cells and were treated with or without TET for 72 hours. In the pres-
ence of TET myrAkt1 is suppressed, while induction occurs in the absence of TET. An increase in N-Cadherin and Snail1 was
observed by Western Blot when myrAkt1 is expressed (-TET). (B) RT-PCR of RNA isolated from VE-cadherin:tTA/
TET:myrAkt1 endothelial cells shows a significant decrease in VE-cadherin mRNA expression when myrAkt1 was expressed,
*student T-test p-value = 0.015. (C) Endothelial cells cultured in the absence of tetracycline (increased myrAkt1) were stained
with VE-cadherin (green, b) and N-cadherin (red, c). The merged images reveal populations of cells, which had lost VE-cadherin
expression (a, arrows). These studies were representative of multiple experiments (n>2) in independent experiments.

Page 5

Journal of Angiogenesis Research 2009, 1:2 http://www.jangiogenesis.com/content/1/1/2
Page 5 of 9
(page number not for citation purposes)
When myrAkt1 was expressed, we observed increased
Snail and N-cadherin protein (Figure 2A) but decreased
VE-cadherin mRNA (Figure 2B), consistent with Snail's
transcriptional repression of VE-cadherin. This observa-
tion links to our previous observation that GSK3β phos-
phorylation is increased in myrAkt endothelial cells [20].
Unphosphorylated GSK3β negatively regulates Snail by
phosphorylating it at two consensus motifs, causing its
nuclear export and degradation [27]. Although consistent,
at this point we cannot be sure whether the phosphoryla-
tion and inactivation of GSK3β by myrAkt directly causes
Snail induction or if Snail is regulated through an alterna-
tive pathway. Also consistent with these findings, when
cultures were propagated in the absence of tetracycline, we
not only had increased growth and survival of the cells,
but also found that a population of VE-cadherin negative,
N-cadherin positive cells emerged (Figure 2C). The VE-
cadherin positive cells usually also contained N-cadherin,
but the subpopulation that became VE-cadherin negative
appeared by morphology to be less cobblestone and more
motile. This is consistent with published reports that VE-
cadherin expression in endocardial cells becomes down-
regulated once they become mesenchymal and invade the
endocardial cushion [16]. These observations suggest that
a subset of our cultures were indeed undergoing an
EndMT-like transition in the presence of constitutive Akt1
signaling. Because we isolated endothelial cells from the
whole heart, it is difficult to know whether this VE-cad-
herin negative subpopulation is derived from endocar-
dium or endothelial cells from the vessels in the heart.
There is a precedent for adult heart endothelial cells to
undergo EndMT after injury leading to scarring and fibro-
sis [28]. Thus it may be that endothelial cells from blood
vessels and not just endocardial cells are driven by Akt sig-
naling to EndMT.
Pharmacological inhibition in the AVC explants disrupts
the PI3K/Akt signaling pathway in myocardial, endocar-
dial, and mesenchyme cells. It is possible that Akt signal-
ing regulates multiple stages of endocardial cushion
formation including promoting survival, proliferation
and migration of mesenchymal cells. While it was clear
that the PI3K/Akt pathway is integral to EndMT, in part
based on the expression pattern of Akt1 that we observed
(Figure 1B), we hypothesized that the Akt1 signaling path-
way acts in endocardial cells to promote the commitment
decision to undergo EndMT before playing a role in mes-
enchymal cell biology. To investigate this we utilized our
inducible system of conditionally expressing myrAkt
driven by the VE-cadherin promoter in endothelial cells as
described in Figure 2. We validated that we have increased
Akt activity (pAkt) in the endocardial layer of the develop-
ing cardiac cushions (Figure 3A), though clearly we can
see some Akt signaling in cushion mesenchyme and other
embryonic tissues. Because EndMT leads to downregula-
tion of the VE-cadherin promoter, our expectation was
that VE-cadherin-driven myrAkt1 expression would be
downregulated once the endocardium undergoes EndMT.
To confirm this we examined hearts and heart explants
from a TET:lacZ reporter responder line bred to the VE-
cadherin-driven transcriptional activator (tTA) line. In
these mice, the VE-cadherin-driven tTA gene drives endo-
cardial expression of lacZ in the same location where it
drives myrAkt1 when crossed to the TET-myrAkt1 mouse.
We detected lacZ staining only in endocardial cells of the
developing cushions but not in cushion mesenchyme
(Figure 3B). Consistent with these in vivo observations, ex
vivo explants showed lacZ staining in many of the cobble-
stone endocardial cells growing out of the explant, but the
mesenchymal cells were lacZ negative (Figure 3C). These
data confirmed that myrAkt1 was expressed in the endo-
cardium and turned off during mesenchymal outgrowth.
To test whether we could drive EndMT by increasing Akt1
signaling only in the endocardium, we harvested the
hearts from double transgenic mice with the VE-cadherin
promoter driving myrAkt expression, bisected them and
placed them onto collagen gels to allow mesenchymal
outgrowth and invasion into the gel. Sustained activation
of myrAkt in all endothelial cells leads to embryonic
lethality from vascular malformations and edema [26]. To
circumvent this problem, we kept the pregnant mothers
on tetracycline until E8.5, just before induction of EndMT
in the AVC, and isolated embryos at E9.5 & E10.5. When
the AVC endocardial cushions from E9.5 myrAkt mice
were explanted onto collagen gel, we observed more inva-
sive mesenchyme outgrowth (Figure 4B) than the control
explants (Figure 4A). By E10.5 the AVC has already under-
gone EndMT and lost the potential to induce collagen gel
mesenchymal invasion. Control AVCs at this later stage
show decreased EndMT resulting in a more cobblestone
endothelial monolayer (Figure 4C). However, mesen-
chyme outgrowth potential was maintained in explants
from myrAkt AVCs (Figure 4D).
Since the tTA is turned off when the ve-cadherin promoter
is downregulated in EndMT, we interpret these data to
demonstrate that myrAkt expression in advance of EndMT
is sufficient to drive increased EndMT in the endocar-
dium. Together, these data establish a role for Akt1 as a
novel signaling component driving the endocardial com-
mitment to EndMT in the developing heart. Interestingly,
deletion of only Akt1 does not impair mesenchyme tran-
sition, as embryos from Akt1 null mice develop normally.
It is likely Akt3 compensates for the absence of Akt1 when
it is disrupted, as it is upregulated in endothelial cells iso-
lated from Akt1 knockout endothelial cells [29]. Further-
more, while disruption of no single Akt gene is lethal,
Akt1/Akt3 null embryos die between E11 and E12, and
have vascular defects and hemorrhages, implicating an

Page 6

Journal of Angiogenesis Research 2009, 1:2http://www.jangiogenesis.com/content/1/1/2
Page 6 of 9
(page number not for citation purposes)
The VE-cadherin-tTA transgene drives responder expression only in the endocardium, not the cardiac cushion mesenchyme
Figure 3
The VE-cadherin-tTA transgene drives responder expression only in the endocardium, not the cardiac cushion
mesenchyme. (A) E11.5 VE-cadherin:tTA/TET:myrAkt embryos stained with phospho-Akt showed increased Akt activation
in the endocardium. (B) LacZ staining of E11.5 VE-cadherin:tTA/TET:LacZ embryos confirmed the endothelial specificity of the
VE-cadherin promoter. (C) In ex vivo heart cushion explants (e), endothelial layer monolayer (m) outgrowth expressed lacZ
but the mesenchymal outgrowth cells (red arrowheads) did not, again confirming the VE-cadherin-tTA gene would not be
expressed and thus not drive TET-promoter expression in the mesenchyme. The figures shown are representative images
from n>5 double transgenic explants assessed. Each litter gives 25% double transgenic offspring.

Page 7

Journal of Angiogenesis Research 2009, 1:2 http://www.jangiogenesis.com/content/1/1/2
Page 7 of 9
(page number not for citation purposes)
myrAkt promotes mesenchyme outgrowth
Figure 4
myrAkt promotes mesenchyme outgrowth. (A-D) AVC explants (e) cultured on 3-D collagen gels had increased mesen-
chyme outgrowth of E9.5 VE-cadherin:tTA/TET:myrAkt AVCs (arrows) (B) when compared to control (A). This was more
pronounced in E10.5 VE-cadherin:tTA/TET:myrAkt AVCs explants (D), where explants were still sprouting mesenchyme
(arrows), while outgrowth of the control AVC explants was composed of an endothelial monolayer (m) (C). (E) Scoring of rel-
ative differences in mesenchymal invasion showed an increase in mesenchyme outgrowth of VE-cadherin:tTA/TET:myrAkt
AVCs at E9.5 and E10.5 compared to control explants. The figures shown are representative images from n>5 double trans-
genic explants assessed. Each litter gives 25% double transgenic offspring.

Page 8

Journal of Angiogenesis Research 2009, 1:2 http://www.jangiogenesis.com/content/1/1/2
Page 8 of 9
(page number not for citation purposes)
endothelial defect. Furthermore, a requirement for Akt1
and Akt3 in heart function was demonstrated by the
observation that postnatal day 3 (P3) hearts from Akt1-/-
Akt3+/- mice are reduced in size and have enlarged atria
and ventricles indicative of a failing cardiovascular system
[22]. These mice were reported to have septation defects
and thickened valves, which implicates defects in endo-
cardial cushion development and maturation. Together,
these data suggest that Akt1 can drive EndMT, and there
can be functional redundancy in the Akt isoforms in the
absence of Akt1.
Recent studies indicating that endocardium undergoes
EndMT following heart injury and leads to fibrosis open
the possibility that Akt1 signaling may also participate in
pathological processes in adult hearts [28]. Further study
is required to investigate this possibility and to fully eluci-
date the signaling cascade driving Akt-mediated EndMT.
In addition, the unique contribution Akt has in the myo-
cardial and mesenchyme cell populations during endocar-
dial cushion formation need to be determined. Our study
defines for the first time a novel role for Akt1 at the earliest
stages of endocardial commitment to becoming a mesen-
chymal phenotype.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KNM carried out the ex vivo atrioventricular canal (AVC),
immunohistochemistry, immunofluorescence, and west-
ern blot studies, and drafted the manuscript. SI partici-
pated in the manuscript revisions and submission and
intellectual input. MS carried out in situ hybridization
studies. DW carried out in situ hybridization studies. SS
conducted the real-time polymerase chain reaction (RT-
PCR) experiments. CP isolated the primary mouse
endothelial cells and conducted immunofluorescence
experiments. TDC was the collaborating principle investi-
gator overseeing MS and DW for the in situ studies. LEB
was the primary principle investigator who participated in
the study conception, funding, execution, analysis, and
manuscript preparation. All authors read and approved
the final manuscript.
References
1. Armstrong EJ, Bischoff J: Heart valve development: endothelial
cell signaling and differentiation. Circ Res 2004, 95(5):459-470.
2.Nakajima Y, Yamagishi T, Hokari S, Nakamura H: Mechanisms
involved in valvuloseptal endocardial cushion formation in
early cardiogenesis: roles of transforming growth factor
(TGF)-beta and bone morphogenetic protein (BMP). Anat
Rec 2000, 258(2):119-127.
3.Potenta S, Zeisberg E, Kalluri R: The role of endothelial-to-mes-
enchymal transition in cancer progression. Br J Cancer 2008,
99(9):1375-1379.
4. Sucov HM: Molecular insights into cardiac development. Annu
Rev Physiol 1998, 60:287-308.
5.Camenisch TD, Molin DG, Person A, Runyan RB, Gittenberger-de
Groot AC, McDonald JA, Klewer SE: Temporal and distinct TGF-
beta ligand requirements during mouse and avian endocar-
dial cushion morphogenesis. Dev Biol 2002, 248(1):170-181.
Dickson MC, Slager HG, Duffie E, Mummery CL, Akhurst RJ: RNA
and protein localisations of TGF beta 2 in the early mouse
embryo suggest an involvement in cardiac development.
Development 1993, 117(2):625-639.
Noseda M, McLean G, Niessen K, Chang L, Pollet I, Montpetit R, Sha-
hidi R, Dorovini-Zis K, Li L, Beckstead B, et al.: Notch activation
results in phenotypic and functional changes consistent with
endothelial-to-mesenchymal transformation. Circ Res 2004,
94(7):910-917.
Timmerman LA, Grego-Bessa J, Raya A, Bertran E, Perez-Pomares JM,
Diez J, Aranda S, Palomo S, McCormick F, Izpisua-Belmonte JC, et al.:
Notch promotes epithelial-mesenchymal transition during
cardiac development and oncogenic transformation. Genes
Dev 2004, 18(1):99-115.
Boyer B, Valles AM, Edme N: Induction and regulation of epithe-
lial-mesenchymal transitions. Biochem Pharmacol 2000,
60(8):1091-1099.
Dor Y, Camenisch TD, Itin A, Fishman GI, McDonald JA, Carmeliet P,
Keshet E: A novel role for VEGF in endocardial cushion for-
mation and its potential contribution to congenital heart
defects. Development 2001, 128(9):1531-1538.
Dor Y, Klewer SE, McDonald JA, Keshet E, Camenisch TD: VEGF
modulates early heart valve formation. Anat Rec A Discov Mol
Cell Evol Biol 2003, 271(1):202-208.
Strizzi L, Bianco C, Normanno N, Seno M, Wechselberger C, Wal-
lace-Jones B, Khan NI, Hirota M, Sun Y, Sanicola M, et al.: Epithelial
mesenchymal transition is a characteristic of hyperplasias
and tumors in mammary gland from MMTV-Cripto-1 trans-
genic mice. J Cell Physiol 2004, 201(2):266-276.
Tanaka H, Shirkoohi R, Nakagawa K, Qiao H, Fujita H, Okada F,
Hamada J, Kuzumaki S, Takimoto M, Kuzumaki N: siRNA gelsolin
knockdown induces epithelial-mesenchymal transition with
a cadherin switch in human mammary epithelial cells. Int J
Cancer 2006, 118(7):1680-1691.
Bakin AV, Tomlinson AK, Bhowmick NA, Moses HL, Arteaga CL:
Phosphatidylinositol 3-kinase function is required for trans-
forming growth factor beta-mediated epithelial to mesen-
chymal transition and cell migration. J Biol Chem 2000,
275(47):36803-36810.
Grille SJ, Bellacosa A, Upson J, Klein-Szanto AJ, van Roy F, Lee-Kwon
W, Donowitz M, Tsichlis PN, Larue L: The protein kinase Akt
induces epithelial mesenchymal transition and promotes
enhanced motility and invasiveness of squamous cell carci-
noma lines. Cancer Res 2003, 63(9):2172-2178.
Liebner S, Cattelino A, Gallini R, Rudini N, Iurlaro M, Piccolo S,
Dejana E: Beta-catenin is required for endothelial-mesenchy-
mal transformation during heart cushion development in
the mouse. J Cell Biol 2004, 166(3):359-367.
Nath AK, Brown RM, Michaud M, Sierra-Honigmann MR, Snyder M,
Madri JA: Leptin affects endocardial cushion formation by
modulating EMT and migration via Akt signaling cascades. J
Cell Biol 2008, 181(2):367-380.
Grapin-Botton A, Majithia AR, Melton DA: Key events of pancreas
formation are triggered in gut endoderm by ectopic expres-
sion of pancreatic regulatory genes. Genes Dev 2001,
15(4):444-454.
Camenisch TD, Spicer AP, Brehm-Gibson T, Biesterfeldt J, Augustine
ML, Calabro A Jr, Kubalak S, Klewer SE, McDonald JA: Disruption
of hyaluronan synthase-2 abrogates normal cardiac morpho-
genesis and hyaluronan-mediated transformation of epithe-
lium to mesenchyme. J Clin Invest 2000, 106(3):349-360.
Phung TL, Ziv K, Dabydeen D, Eyiah-Mensah G, Riveros M, Perruzzi
C, Sun J, Monahan-Earley RA, Shiojima I, Nagy JA, et al.: Pathological
angiogenesis is induced by sustained Akt signaling and inhib-
ited by rapamycin. Cancer Cell 2006, 10(2):159-170.
Phung TL, Eyiah-Mensah G, O'Donnell RK, Bieniek R, Shechter S,
Walsh K, Kuperwasser C, Benjamin LE: Endothelial Akt signaling
is rate-limiting for rapamycin inhibition of mouse mammary
tumor progression. Cancer Res 2007, 67(11):5070-5075.
Yang ZZ, Tschopp O, Di-Poi N, Bruder E, Baudry A, Dummler B,
Wahli W, Hemmings BA: Dosage-dependent effects of Akt1/
protein kinase Balpha (PKBalpha) and Akt3/PKBgamma on
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.

Page 9

Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
BioMedcentral
Journal of Angiogenesis Research 2009, 1:2 http://www.jangiogenesis.com/content/1/1/2
Page 9 of 9
(page number not for citation purposes)
thymus, skin, and cardiovascular and nervous system devel-
opment in mice. Mol Cell Biol 2005, 25(23):10407-10418.
Bernanke DH, Markwald RR: Migratory behavior of cardiac
cushion tissue cells in a collagen-lattice culture system. Dev
Biol 1982, 91(2):235-245.
Runyan RB, Markwald RR: Invasion of mesenchyme into three-
dimensional collagen gels: a regional and temporal analysis
of interaction in embryonic heart tissue. Dev Biol 1983,
95(1):108-114.
Valdes F, Alvarez AM, Locascio A, Vega S, Herrera B, Fernandez M,
Benito M, Nieto MA, Fabregat I: The epithelial mesenchymal
transition confers resistance to the apoptotic effects of
transforming growth factor Beta in fetal rat hepatocytes.
Mol Cancer Res 2002, 1(1):68-78.
Sun JF, Phung T, Shiojima I, Felske T, Upalakalin JN, Feng D, Kornaga
T, Dor T, Dvorak AM, Walsh K, et al.: Microvascular patterning
is controlled by fine-tuning the Akt signal. Proc Natl Acad Sci
USA 2005, 102(1):128-133.
Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M, Hung MC: Dual
regulation of Snail by GSK-3beta-mediated phosphorylation
in control of epithelial-mesenchymal transition. Nat Cell Biol
2004, 6(10):931-940.
Zeisberg EM, Tarnavski O, Zeisberg M, Dorfman AL, McMullen JR,
Gustafsson E, Chandraker A, Yuan X, Pu WT, Roberts AB, et al.:
Endothelial-to-mesenchymal transition contributes to car-
diac fibrosis. Nat Med 2007, 13(8):952-961.
Ackah E, Yu J, Zoellner S, Iwakiri Y, Skurk C, Shibata R, Ouchi N, Eas-
ton RM, Galasso G, Birnbaum MJ, et al.: Akt1/protein kinase Bal-
pha is critical for ischemic and VEGF-mediated angiogenesis.
J Clin Invest 2005, 115(8):2119-2127.
23.
24.
25.
26.
27.
28.
29.