Potent antidiabetic effects of rivoglitazone, a novel peroxisome proliferator-activated receptor-gamma agonist, in obese diabetic rodent models.

Abstract

The pharmacological effects of rivoglitazone, a novel thiazolidinedione-derivative peroxisome proliferator-activated receptor (PPAR)-gamma agonist, were characterized in vitro and in vivo. Rivoglitazone activated human PPARgamma more potently compared with rosiglitazone and pioglitazone and had little effect on PPARalpha and PPARdelta activity in luciferase reporter assays. In Zucker diabetic fatty (ZDF) rats, 14-day administration of rivoglitazone decreased the plasma glucose and triglyceride (TG) levels in a dose-dependent manner. The glucose-lowering effect of rivoglitazone was much more potent than those of pioglitazone (ED(50): 0.19 vs. 34 mg/kg) and rosiglitazone (ED(50): 0.20 vs. 28 mg/kg). In addition, rivoglitazone showed potent antidiabetic effects in diabetic db/db mice. In Zucker fatty rats, rivoglitazone at a dose of 0.1 mg/kg clearly ameliorated insulin resistance and lowered plasma TG levels by accelerating the clearance of plasma TG. Gene expression analysis in the liver and heart of ZDF rats treated with rivoglitazone for 14 days suggested that rivoglitazone may reduce hepatic glucose production and modulate the balance of the cardiac glucose/fatty acid metabolism in diabetic animals. In summary, we showed that rivoglitazone is a potent and selective PPARgamma agonist and has a potent glucose-lowering effect via improvement of the insulin resistance in diabetic animal models.

Full text

Page 1

155
Journal of Pharmacological Sciences
©2009 The Japanese Pharmacological Society
Full Paper
J Pharmacol Sci 111, 155 – 166 (2009)2
Potent Antidiabetic Effects of Rivoglitazone, a Novel Peroxisome
Proliferator–Activated Receptor-γ Agonist, in Obese Diabetic Rodent
Models
Shoichi Kanda1, Ryutaro Nakashima1, Kanako Takahashi1, Jun Tanaka1, Junko Ogawa1, Tsuneaki Ogata1,
Makoto Yachi2, Kazushi Araki1, and Jun Ohsumi1,*
1Biological Research Laboratories II and 2Pharmacology Research Laboratories, Daiichi Sankyo Co., Ltd.,
Tokyo 140-8710, Japan
Received March 16, 2009; Accepted August 6, 2009
Abstract.
The pharmacological effects of rivoglitazone, a novel thiazolidinedione-derivative
peroxisome proliferator–activated receptor (PPAR)-γ agonist, were characterized in vitro and in
vivo. Rivoglitazone activated human PPARγ more potently compared with rosiglitazone and
pioglitazone and had little effect on PPARα and PPARδ activity in luciferase reporter assays. In
Zucker diabetic fatty (ZDF) rats, 14-day administration of rivoglitazone decreased the plasma
glucose and triglyceride (TG) levels in a dose-dependent manner. The glucose-lowering effect of
rivoglitazone was much more potent than those of pioglitazone (ED50: 0.19 vs. 34 mg/kg) and
rosiglitazone (ED50: 0.20 vs. 28 mg/kg). In addition, rivoglitazone showed potent antidiabetic
effects in diabetic db/db mice. In Zucker fatty rats, rivoglitazone at a dose of 0.1 mg/kg clearly
ameliorated insulin resistance and lowered plasma TG levels by accelerating the clearance of
plasma TG. Gene expression analysis in the liver and heart of ZDF rats treated with rivoglitazone
for 14 days suggested that rivoglitazone may reduce hepatic glucose production and modulate the
balance of the cardiac glucose/fatty acid metabolism in diabetic animals. In summary, we
showed that rivoglitazone is a potent and selective PPARγ agonist and has a potent glucose-
lowering effect via improvement of the insulin resistance in diabetic animal models.
Keywords: thiazolidinedione, peroxisome proliferator–activated receptor (PPAR)-γ,
diabetes mellitus, insulin resistance, gene expression
Introduction
The major causes of type 2 diabetes (T2DM) are
impaired insulin secretion, increased hepatic glucose
production, and decreased insulin-stimulated glucose
uptake to the peripheral tissues (1). Increased hepatic
glucose production and decreased insulin-stimulated
glucose uptake are characterized as insulin resistance in
which insulin cannot cause sufficient effects on the
target organs. Moreover, it is often accompanied by
compensatory hyperinsulinemia. Insulin resistance with
hyperinsulinemia is a common abnormality in obesity as
well as T2DM and may increase susceptibility to other
disorders such as hyperlipidemia and hypertension and
lead to cardiovascular disease (2).
Pioglitazone and rosiglitazone are thiazolidinedione
(TZD) derivative antidiabetic agents available in clinical
practice. There is a great deal of evidence showing that
these drugs ameliorate insulin resistance in the liver
and skeletal muscle and preserve pancreatic β-cell
function, which makes them one of the most important
drug classes for the treatment of T2DM (3).
Pioglitazone and rosiglitazone have been shown to
act as activators of peroxisome proliferator–activated
receptor (PPAR)-γ and are thought to exert their anti-
diabetic effects via the activation of PPARγ (4). PPARs
are ligand-activated nuclear transcription factors that
modulate the expression of a large number of genes
associated with lipid and glucose metabolism and
consist of three subtypes, namely, PPARα, PPARγ, and
*Corresponding author. ohsumi.jun.uv@daiichisankyo.co.jp
Published online in J-STAGE on October 6, 2009 (in advance)
doi: 10.1254/jphs.09084FP

Page 2

S Kanda et al 156
PPARδ (5, 6). In general, PPARγ regulates genes
involved in fatty acid uptake and storage and glucose
homeostasis in adipose tissues, whereas PPARα regu-
lates genes involved in fatty acid uptake and oxidation
in the liver. PPARδ regulates genes involved in fatty
acid metabolism and lipid homeostasis.
Rivoglitazone, formerly CS-011, is a newly synthe-
sized TZD-derivative. In this study, we examined the
effect of rivoglitazone on the transactivation of human
PPARs (hPPARs) in vitro in a cell-based reporter assay
and the in vivo antidiabetic effects in diabetic animal
models in comparison with pioglitazone and rosiglita-
zone. In addition, the effects on triglyceride (TG) metabo-
lism and gene expression in the liver and heart were also
examined and compared with the effects of a PPARα
agonist.
Materials and Methods
Materials
Rivoglitazone hydrochloride, pioglitazone hydro-
chloride, and rosiglitazone maleate were synthesized at
Sankyo Co., Ltd. (Tokyo) and, hereafter, are indicated
as rivoglitazone, pioglitazone and rosiglitazone,
respectively. GW7647 was purchased from Sigma-
Aldrich Corporation (St. Louis, MO, USA). GW501516
was purchased from ALEXIS Corporation (Lausen,
Switzerland). Wy-14643 was purchased from Tokyo
Kasei Kogyo Co., Ltd. (Tokyo). The compounds were
dissolved in DMSO and added to the medium to the
final DMSO concentration of 0.03% (v/v) for the in
vitro studies. For the in vivo studies, rivoglitazone
and rosiglitazone were suspended in 0.5% (w/v)
carboxymethylcellulose (CMC) solution, pioglitazone
was suspended in distilled water, and Wy-14643 was
suspended in 0.5% (w/v) methylcellulose solution.
Cell culture and transfection
HT-1080 cells (American Type Culture Collection,
Manassas, VA, USA), derived from human fibrosarcoma,
were cultured in the Dulbecco’s Modified Eagle
Medium (DMEM) containing 10% heat-inactivated
fetal bovine serum (FBS) and 25 mM HEPES. Passages
of the cells were performed every 2 to 3 days. The
GAL4-hPPAR chimera receptor expression vectors
pM-hPPARα, pM-hPPARγ, or pM-hPPARδ, which
express the ligand-binding domain of each PPAR as a
fusion protein with the DNA-binding domain of GAL4,
were constructed by insertion of cDNA encoding amino
acids H168 – Y468 of hPPARα, H175 – Y475 of
hPPARγ2, or H140 – Y441 of hPPARδ, respectively
(GenBank accession numbers: S74349, X90563, and
L07592, respectively), into a plasmid pM (Invitrogen
Corporation, Carlsbad, CA, USA). Each expression
vector was cotransfected with the pG5luc vector
(Promega Corporation, Madison, WI, USA), which
codes firefly luciferase driven by GAL4, to the HT-1080
cells using Lipofectamine 2000 (Invitrogen Corporation).
Luciferase assay
HT-1080 cells cultured for about 6 h after transfection
were harvested, resuspended in DMEM without phenol
red containing 10% FBS, and seeded in 96-well plates.
After 22 – 23 h, the cells were treated with rivoglitazone,
pioglitazone, or rosiglitazone at 0.001, 0.01, 0.1, 1, and
10 μM and incubated for another 24 h until the luciferase
activity was determined. As a vehicle control, cells were
treated with 0.03% of DMSO. The luciferase activity
was determined using a Dual-Glo Luciferase Assay
System (Promega Corporation). The fold-increase of
the light intensity relative to the vehicle control was
calculated and then normalized by that of the positive
control (10 μM rosiglitazone for the PPARγ activity,
10 μM GW7647 for the PPARα activity, and 1 μM
GW501516 for the PPARδ activity) for the calculation
of the relative activity.
Animals
Male Zucker diabetic fatty (ZDF) rats (ZDF/Crl-
Leprfa) were purchased at 6 weeks of age from Charles
River Japan, Inc. (Kanagawa) and acclimatized until
they were 9-weeks-old. Male Zucker fatty (ZF) rats
[Crlj:ZUC-Leprfa (Leprfa/Leprfa)] were purchased at
7 weeks of age from Charles River Japan, Inc. and
acclimatized until they were 9-week-old. Male db/db
mice (BKS.Cg-+Leprdb/+Leprdb/Jcl) were purchased at
7 weeks of age from CLEA Japan, Inc. (Tokyo) and
acclimatized until they were 8-week-old. Rodent chow
(FR-2; Funabashi Farm Co., Ltd., Chiba) and water
were given ad libitum. The animals were housed 3 or 4
animals per cage for rats and 5 or 6 animals per cage
for mice at a room temperature of 23°C – 24°C,
humidity of 50% – 75%, and a 12-h light/dark cycle
(lighting: 7:00 – 19:00). All experimental procedures
were performed in accordance with the guidelines of the
Institutional Animal Care and Use Committee of Sankyo
Co., Ltd.
Administration and blood sampling
The suspensions of the compounds were orally
administered once a day for 7 – 15 days at a volume of
1 mL/kg for rats and 10 mL/kg for mice. The animals in
the control group were treated with 0.5% CMC solution.
The day the drug administration started was defined
as day 0. Blood was collected from the tip of the tails
of fed-state animals using capillary tubes before and

Page 3

Antidiabetic Effects of Rivoglitazone157
after repeated drug administration. The collected blood
was centrifuged to obtain plasma. The plasma samples
were stored at −20°C for later measurement of the
biochemical parameters.
Measurement of pancreatic insulin content
The ZDF rats were sacrificed on day 15 by decapita-
tion and the pancreases were excised. The pancreases
were put in the 1.5% hydrochloric acid / 75% ethanol
solution and homogenized on ice. After overnight
incubation at 4°C, the homogenates were centrifuged at
3000 rpm for 15 min at 4°C. The insulin levels in the
supernatants were measured and the pancreatic insulin
content was calculated in μg/pancreas.
Hyperinsulinemic-euglycemic clamp
The hyperinsulinemic-euglycemic clamp study was
performed after 8-day administration of rivoglitazone at
a dose of 0.1 mg/kg to ZF rats. To infuse the insulin and
the glucose solution, an infusion catheter was inserted
into the jugular vein 2 days before the clamp study.
On day 8, under overnight fasting, the clamp study
was initiated by infusing the insulin solution at
20 mU⋅kg−1⋅min−1. The blood glucose levels in the
whole blood were monitored every 5 min and the 20%
(w/v) glucose solution was infused at variable rates to
keep the blood glucose levels around 100 mg/dL. The
blood samples were collected for insulin measurement at
80, 90, and 100 min after the initiation of the insulin
infusion. The blood glucose levels, plasma insulin levels,
and glucose infusion rate (GIR) at steady-state was
calculated as the mean values at 80, 90, and 100 min.
Whole-body TG elimination and production
ZF rats were treated for 7 days with rivoglitazone or
Wy-14643 at doses of 1 or 100 mg/kg, respectively. On
Day 7, the TG elimination and the TG production were
examined after 4-h fasting.
To examine the TG elimination, lipid emersion
(Intralipos 20%; Otsuka Pharmaceutical Factory, Inc.,
Tokushima) was injected into the tail vein at the volume
of 4 mL/kg. The blood was collected just before (0 min)
and at 10, 20, 30, 45, 60, and 90 min after the injection.
The 0 min value was subtracted from the value at each
time point and the area under the curve of the plasma
TG from 0 – 90 min (AUCTG, h⋅ mg/dL) was then
calculated using these values. The TG elimination rate
constant (min−1) was calculated using the plasma TG
levels at 20, 30, and 45 min assuming that the plasma TG
elimination rate at these time points follows first-order
kinetics.
To examine the TG production, tyloxapol (lipoprotein
lipase inhibitor) solution in saline (200 mg/mL, Sigma-
Aldrich Corporation) was injected into the tail vein at a
volume of 1 mL/kg. The blood was collected just before
(0 min) and at 30, 60, 90, 120, and 150 min after the
injection. The TG production rate (mg⋅dL−1⋅min−1) was
calculated using the plasma TG levels from 30 – 150 min
by linear regression.
Gene expression analysis in the liver and heart
ZDF rats were treated with rivoglitazone, pioglitazone,
or Wy-14643 for 14 days at doses of 1, 100, or
100 mg/kg, respectively. The rats were decapitated 6 h
after the final administration on day 14 and the liver
and heart were rapidly removed. The total RNA was
extracted with TRIzol reagent (Invitrogen Corporation)
and purified using an RNeasy Mini Kit (QIAGEN,
Hilden, Germany), and the cDNA was synthesized using
TaqMan Reverse Transcription Reagents (Applied
Biosystems, Foster City, CA, USA). The expression
levels of the following genes were analyzed by real time
PCR: acyl-coenzyme A oxidase 1 (ACO), carnitine
palmitoyltransferase 1b (CPT1b), enoyl-coenzyme A
hydratase / 3-hydroxyacyl coenzyme A dehydrogenase
(ECH/HAD), pyruvate dehydrogenase kinase isoenzyme
4 (PDK4), apolipoprotein C-III (ApoCIII), glucose-6-
phosphatase (G6Pase), phosphoenolpyruvate carboxy-
kinase 1 (PEPCK), liver pyruvate kinase [PK (liver)],
muscle pyruvate kinase [PK (muscle)], glucose trans-
porter 4 (GLUT4), medium chain acyl-coenzyme A
dehydrogenase (MCAD), myosin heavy chain alpha
(MHCα), myosin heavy chain beta (MHCβ), sarco
/endoplasmic reticulum Ca2+ ATPase 2 (SERCA2),
and acidic ribosomal phosphoprotein P0 (ARBP). The
primer and probe sets used in this study are shown in
Table 1. The real-time PCR was performed and the data
was analyzed using an ABI Prism 7900HT Sequence
Detection System with SDS 2.1.1 software (Applied
Biosystems). The relative expression levels were
calculated by dividing the expression levels by that of
the ARBP.
Analytical methods for biochemical parameters
The blood glucose levels were measured with a
blood glucose test meter (Glutest PRO R; Sanwa Kagaku
Kenkyusho Co., Ltd., Aichi). The plasma glucose levels
were measured by an automatic glucose analyzer
(Glucoroder-GXT; A&T Corporation, Kanagawa). The
plasma TG levels were measured with a colorimetric
assay kit (Triglyceride E-Test or L-Type Triglyceride
H; Wako Pure Chemical Industries, Ltd., Osaka). The
plasma nonesterified fatty acid (NEFA) levels were
measured with a colorimetric assay kit (NEFA C-Test;
Wako Pure Chemical Industries, Ltd.). The insulin and
adiponectin levels were measured by using radio-

Page 4

S Kanda et al158
immunoassay kits (Rat Insulin RIA Kit and Mouse
Adiponectin RIA Kit, respectively; Linco Research, Inc.,
St. Charles, MO, USA).
Statistical analysis
All data were expressed as the mean ± standard error
of the mean (S.E.M.). A multiple comparison between
Table 1.
Primers and probes used for analyzing gene expression
Gene name
GenBank
accession No.
Sequence
Acyl-coenzyme A oxidase 1 (ACO)NM_017340 Probe: CACCACTGCTCAGCAGGAGAAATGGA
Primer 1: TGTTGGCCTCAATTACTCCATGT
Primer 2: ATGAGTTCCGTGGCCCATC
Carnitine palmitoyltransferase 1b (CPT1b) NM_013200Probe: TACTTGGATTCTGTGCGGCCCTTGCT
Primer 1: AGTGTGCCAGCCACAATTCAC
Primer 2: TCCATGCGGAAATAGGCTTC
Enoyl-coenzyme A hydratase / 3-hydroxyacyl coenzyme A
dehydrogenase (ECH/HAD)
NM_133606 Probe: TCGCCACGGTTATGAGCTTGTCCAAA
Primer 1: TAGCCGATACTCTTCCCCTACTACC
Primer 2: CCACTACTCCAATCTTTCCGATCT
Pyruvate dehydrogenase kinase, isoenzyme 4 (PDK4) NM_053551 Probe: TCGAGCATCAAGAAAACCGCCCTTT
Primer 1: TGCCATGAGGGCCACG
Primer 2: TGGCCTCGACTGGTGTCAG
Apolipoprotein C-III (ApoCIII) NM_012501 Probe: AGAGGGATCCTTGCTGCTGGGCTCT
Primer 1: CTGCCCGAGCTGATGAGG 3'
Primer 2: TTGTTCCATGTAGCCCTGCA 3'
Glucose-6-phosphatase (G6P) NM_013098Probe: TGGCTGAAACTTTCAGCCACATCCG
Primer 1: AACGTCTGTCTGTCCCGGATCTA 3'
Primer 2: AGAAGGTGATGAGACAGTACCTCTGG
Phosphoenolpyruvate carboxykinase 1 (PEPCK)NM_198780Probe: CCATCTTCACCAACGTGGCTGAGACAA
Primer 1: 5' GGTGGAAAGTTGAATGTGTGG 3'
Primer 2: 5' TGATGGCCCTTAAGTTGCCT 3'
Liver pyruvate kinase (lPK) NM_012624 Probe: CGACTCAACTTCTCCCATGGCTCCC
Primer 1: TGATCAAAGCAGGGATGAACAT
Primer 2: CGATGGATTCTGCATGGTACTC
Muscle pyruvate kinase (mPK) NM_053297Probe: AGGCAGCCGTGTTCCACCGC
Primer 1: TTCGCATGCAGCACCTGATA
Primer 2: CGCGCAAGCTCTTCAAACA
Glucose transporter 4 (GLUT4)NM_012751Probe: CCTGGCCCCATCCCCTGGTTC
Primer 1: TGTGGCCTTCTTTGAGATTGG
Primer 2: CTGAAGAGCTCGGCCACAA
Medium chain acyl-coenzyme A dehydrogenase (MCAD)NM_016986 Probe: CCCGGTCGCCCCAGACTACGA
Primer 1: GGAAGTTTGCCAGAGAGGAAATAA
Primer 2: CGGGTATTCCCCGCTTTT
Myosin heavy chain alpha (MHCα) NM_017239Probe: CCGAAGTCAGCCATCTGGGCATC 3'
Primer 1: TGTGAAAAGATTAACCGGAGTTTAAG
Primer 2: TCTGACTTGCGGAGGTATCG
Myosin heavy chain beta (MHCβ) NM_017240Probe: CATCAGCTCCAGCATAGTTGGCAAACA
Primer 1: AAGTCCTCCCTCAAGCTCCTAAGT
Primer 2: TTGCTTTGCCTTTGCCC
Sarco/endoplasmic reticulum Ca2+ ATPase 2 (SERCA2)NM_017290 Probe: AACCTTTGCCACTCATTTTCCAGATCACAC
Primer 1: GTCCATGTCCCTTCACTTCTTG
Primer 2: CATCAGCCACTGGGTCAGA
Acidic ribosomal phosphoprotein P0 (ARBP)NM_022402 Probe: CAAGAACACCATGATGCGCAAGGC
Primer 1: GCTCCAAGCAGATGCAGCA
Primer 2: CCGGATGTGAGGCAGCAG
From left to right, the 5' to 3' end of the oligonucleotide sequences were expressed.

Page 5

Antidiabetic Effects of Rivoglitazone159
the control group and drug-treated groups was per-
formed by a Dunnett test and the simple comparison
between the control group and a drug-treated group was
performed by a t-test. A P value less than 0.05 was
considered statistically significant.
The EC50 for activation of hPPARγ was estimated
as the concentration required to increase the relative
activity to 50% by linear regression. The ED50 for the
plasma glucose or TG-lowering effect was defined as
the dose required to decrease the plasma glucose or TG
levels to half of the corresponding value of the control
group and was calculated by linear regression. SAS
System Release 8.2 (SAS Insutitute Inc., Cary, NC,
USA) was used for these calculations.
Results
Activation of PPARs in vitro
To investigate the selectivity for PPARs, we performed
a luciferase reporter assay using GAL4-fusion protein of
the ligand-binding domain of hPPARα, hPPARγ, and
hPPARδ. Rivoglitazone as well as rosiglitazone and
pioglitazone increased the hPPARγ reporter activity in
a concentration-dependent manner and the EC50s were
0.22, 0.79, and 3.6 μM, respectively (Fig. 1a). Rivoglita-
zone, rosiglitazone, and pioglitazone increased the
hPPARα activity by 29.8%, 8.0%, and 16.9% of the
positive control, GW7647, at 10 μM (Fig. 1b). These
compounds did not affect the hPPARδ activity at any
concentrations examined, whereas GW501516 in-
creased the activity concentration-dependently (Fig. 1c).
Antidiabetic effects of rivoglitazone in diabetic animal
models
Rivoglitazone was orally administered to male ZDF
rats, a severe insulin-resistant diabetic model, for
15 days. As shown in Fig. 2a, rivoglitazone as well as
pioglitazone decreased the plasma glucose levels in a
dose-dependent manner on day 14. The ED50s of the
hypoglycemic effect of rivoglitazone and pioglitazone
were 0.19 and 34 mg/kg, respectively. Rivoglitazone
and pioglitazone also decreased the plasma TG dose-
dependently and the ED50s were 0.21 and 17 mg/kg
(Fig. 2c). There was little change in the plasma insulin
levels, and the body weights were dose-dependently
increased by both rivoglitazone and pioglitazone. The
pancreases were excised on day 15 and the insulin
content was measured. Rivoglitazone as well as pioglita-
zone increased the pancreatic insulin content in parallel
with the decrease of the plasma glucose (Fig. 2e).
In comparison with rosiglitazone, rivoglitazone also
showed much more potent effects on the plasma
glucose– and plasma TG–lowering and preservation of
the pancreatic insulin content in ZDF rats (Fig. 2: b, d, f).
The ED50s of the plasma glucose–lowering effect were
0.20 and 28 mg/kg and those of the plasma TG–
lowering effect were 0.22 and 18 mg/kg for rivoglita-
zone and rosiglitazone, respectively.
Rivoglitazone also showed a potent glucose-lowering
effect after 14-day treatment in diabetic male db/db
mice compared with pioglitazone (Fig. 3a). The ED50s
of the hypoglycemic effect for rivoglitazone and
pioglitazone were 0.47 and 70 mg/kg, respectively. In
this model, the plasma adiponectin levels were strikingly
increased by rivoglitazone in comparison with pioglita-
zone (Fig. 3b).
Fig. 1.
Effects of rivoglitazone, rosiglitazone, and pioglitazone on hPPARγ (a), hPPARα (b), and hPPARδ (c) activity. HT-1080
cells were cotransfected with an expression plasmid coding the ligand-binding domain of hPPARγ, hPPARα, or hPPARδ fused to
a GAL4 DNA-binding domain and a luciferase reporter plasmid. The luciferase activity was measured after 24-h treatment with
rivoglitazone, pioglitazone, or rosiglitazone and was expressed as percentage of the positive controls (PPARγ activity: 10 μM
rosiglitazone; PPARα activity: 10 μM GW7647; PPARδ activity: 1 μM GW501516). Data are reported as the mean ± S.E.M.
(n = 4).