Bioinformatics and functional analysis define four distinct groups of AlkB DNA-dioxygenases in bacteria.

Abstract

The iron(II)- and 2-oxoglutarate (2OG)-dependent dioxygenase AlkB from Escherichia coli (EcAlkB) repairs alkylation damage in DNA by direct reversal. EcAlkB substrates include methylated bases, such as 1-methyladenine (m(1)A) and 3-methylcytosine (m(3)C), as well as certain bulkier lesions, for example the exocyclic adduct 1,N(6)-ethenoadenine (epsilonA). EcAlkB is the only bacterial AlkB protein characterized to date, and we here present an extensive bioinformatics and functional analysis of bacterial AlkB proteins. Based on sequence phylogeny, we show that these proteins can be subdivided into four groups: denoted 1A, 1B, 2A and 2B; each characterized by the presence of specific conserved amino acid residues in the putative nucleotide-recognizing domain. A scattered distribution of AlkB proteins from the four different groups across the bacterial kingdom indicates a substantial degree of horizontal transfer of AlkB genes. DNA repair activity was associated with all tested recombinant AlkB proteins. Notably, both a group 2B protein from Xanthomonas campestris and a group 2A protein from Rhizobium etli repaired etheno adducts, but had negligible activity on methylated bases. Our data indicate that the majority, if not all, of the bacterial AlkB proteins are DNA repair enzymes, and that some of these proteins do not primarily target methylated bases.

Full text

Page 1

Bioinformatics and functional analysis define
four distinct groups of AlkB DNA-dioxygenases
in bacteria
Erwin van den Born1, Anders Bekkelund1, Marivi N. Moen2, Marina V. Omelchenko3,
Arne Klungland2,4and Pa ˚l Ø. Falnes1,2,*
1Department of Molecular Biosciences, University of Oslo, PO Box 1041 Blindern, 0316 Oslo, Norway,
2Centre for Molecular Biology and Neuroscience, Institute of Medical Microbiology, Oslo University
Hospital and University of Oslo, N-0027 Oslo, Norway,3National Center for Biotechnology Information,
National Institutes of Health, Bethesda, MD 20894, USA and4Institute of Basic Medical Sciences,
University of Oslo, PO Box 1018 Blindern, N-0315 Oslo, Norway
Received June 18, 2009; Revised and Accepted September 3, 2009
ABSTRACT
The iron(II)- and 2-oxoglutarate (2OG)-dependent
dioxygenase AlkB from Escherichia coli (EcAlkB)
repairsalkylation damage
reversal. EcAlkB substrates include methylated
bases,suchas1-methyladenine
3-methylcytosine (m3C), as well as certain bulkier
lesions,for example
1,N6-ethenoadenine (eA). EcAlkB is the only bacterial
AlkB protein characterized to date, and we here
present an extensive bioinformatics and functional
analysis of bacterial AlkB proteins. Based on
sequence phylogeny, we show that these proteins
can be subdivided into four groups: denoted 1A, 1B,
2A and 2B; each characterized by the presence of
specific conserved amino acid residues in the
putative nucleotide-recognizing domain. A scat-
tered distribution of AlkB proteins from the four dif-
ferent groupsacross
indicatesasubstantial
transfer of AlkB genes. DNA repair activity was
associatedwithalltested
proteins. Notably, both a group 2B protein from
Xanthomonas campestris and a group 2A protein
from Rhizobium etli repaired etheno adducts, but
had negligible activity on methylated bases. Our
data indicate that the majority, if not all, of the bac-
terial AlkB proteins are DNA repair enzymes, and
that some of these proteins do not primarily target
methylated bases.
in DNAby direct
(m1A)and
theexocyclic adduct
thebacterial
degree
kingdom
horizontalof
recombinantAlkB
INTRODUCTION
Alkylating agents can introduce several different types
of deleterious lesions into the nucleic acids DNA and
RNA. Such agents are abundant in the environment,
e.g. in the form of methyl halides (1,2). Alkylating
agents are also generated intracellularly as a result of
normal cellular metabolism, and S-adenosylmethionine,
which is the methyl donor in numerous enzyme-catalyzed
methylation reactions, also induces a low level of aberrant
methylations (3). Endogenous methylating agents may
also arise through cellular nitrosation reactions (4).
To protect their genomes against the harmful effects of
alkylatingagents,living
enzymes dedicated to remove alkylation damage from
DNA (5,6).
Alkylation repair enzymes were first discovered in the
bacterium Escherichia coli (E. coli), where three different
repair mechanisms have been identified (6). The expres-
sion of repair proteins is up-regulated as an adaptive
response to alkylation damage, governed by the alkylation
sensitivetranscriptionfactor
mechanisms is responsible for repairing a specific subset
of the lesions introduced by alkylation. One such mecha-
nism involves the E. coli AlkB protein (EcAlkB), which
directly reverses alkylations at the N1-position of purines
andtheN3-position of
1-methyladenine (m1A) and 3-methylcytosine (m3C); the
first EcAlkB substrates identified (7,8). EcAlkB belongs to
the superfamily of iron(II)- and 2-oxoglutarate (2OG)
dependent dioxygenases (9). As for other members of
this superfamily, EcAlkB
cofactor and 2-oxoglutarate as cosubstrate, which is decar-
boxylated, leading to formation of succinate and CO2.
organismspossessseveral
Ada.Eachof the
pyrimidines,for example,
requiresferrous ironas
*To whom correspondence should be addressed. Tel: +47 22854840; Fax: +47 22854443; Email: pal.falnes@imbv.uio.no
7124–7136
doi:10.1093/nar/gkp774
Nucleic Acids Research, 2009, Vol. 37, No. 21Published online 28 September 2009
? The Author(s) 2009. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.5/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 2

EcAlkB uses molecular oxygen to oxidize a deleterious
methyl group, and the resulting hydroxymethyl moiety is
spontaneously released as formaldehyde, leading to the
regeneration of the non-damaged base (7,8). The set of
EcAlkB substrates has later been shown, in addition
to m1A and m3C, to include the structurally analogous,
butless abundantlesions
3-methylthymine (10–12). EcAlkB can also repair bulkier
adducts such as ethyl and propyl groups (13,14), as well as
exocyclic etheno and ethano adducts (15–17).
Multicellular organisms generally possess several differ-
ent AlkB homologues (ALKBH), and initial bioinfor-
matics studies identified eight such proteins in mammals,
denoted ALKBH1-8 (initially named ABH1-8) (5,9,18).
In addition, it was recently found that the more distantly
related obesity-associated protein FTO also is a functional
ALKBH (19). ALKBH2, ALKBH3 and FTO have been
shown to possess a repair activity similar to that of
EcAlkB, while two somewhat conflicting reports have
implicated ALKBH1 both in epigenetic gene regulation
and in repair (20,21). The function of the remaining five
proteins remains unknown, but there are indications that
they may participate in processes other than DNA/RNA
repair (22,23). Interestingly, both EcAlkB and ALKBH3
also display activity on methyl lesions in RNA substrates
(24,25), and it has been shown that AlkB- or ALKBH3-
mediated repair of tRNA and mRNA is accompanied by
functional recovery of these molecules (26). Also, the
genomes of some plant-infecting single-stranded RNA
(ssRNA) viruses encode AlkB homologues capable of
removing methylation damage from RNA, strongly
indicating that some members of the AlkB family are
true RNA repair enzymes (27).
In the present work, we have performed an extensive
sequence analysis of bacterial AlkB proteins, and found
that they can be subdivided into four distinct groups: 1A,
1B, 2A and 2B. A rather scattered distribution of AlkB
proteins from the four resulting groups across the bacte-
rial kingdom suggested a high degree of horizontal
transfer of bacterial AlkB-encoding genes. We have func-
tionally characterized nine bacterial AlkB proteins, repre-
senting all four groups. These proteins were investigated
for their ability to repair alkylated nucleic acids in E. coli,
and recombinant enzymes were also tested for in vitro
repair activity. Finally, we discuss the likely functions of
the AlkB proteins from the four defined groups in light of
the results obtained by bioinformatics and experimental
analysis.
1-methylguanine and
MATERIALS AND METHODS
Sequence analysis and construction of phylogenetic trees
The selected set of bacterial AlkB proteins was identified
in the GenBank non-redundant (NR) protein sequence
database (NCBI, NIH) using the PSI-BLAST program
(28). Multiple sequence alignment was constructed using
the MUSCLE program (29). Maximum likelihood tree
was generated using the ProtML program of the
MOLPHY package (30) by optimizing the least-squares
tree with local rearrangements (Jones-Taylor-Thornton
evolutionary model (31) with adjustment for observed
amino acid frequencies). The reliability of the internal
tree branches was estimated with the RELL bootstrap
method (32) using the ProtML program.
The protein sequence alignments in Figure 2 were
constructed using the online version of the MAFFT
program (33), saved in .pir format, converted to .msf
format in Jalview (34), and the desired appearance of
the alignment was achieved in GeneDoc (http://www
.genedoc.us/).
When investigating the presence of AlkB proteins in
completely sequenced bacteria, protein sequence searches
were complemented by TBLASTN searches (where
genomes were translated in all six possible reading
frames) (35), due to the incomplete annotation of many
proteomes.
To generate a 16S ribosomal RNA-based phylogenetic
tree, an alignment of the relevant sequences was
downloaded from the ‘Ribosomal database project II’
(36). A phylogenetic tree based on the alignment was con-
structed by using the ‘Calculate tree—Average distance
using identity’ function in Jalview. The desired appearance
of the tree was obtained in FigTree v. 1.1.2 (http://tree.
bio.ed.ac.uk).
Plasmid construction and protein purification
Genes encoding AlkB were amplified by polymerase chain
reaction (PCR) from bacterial genomic DNA obtained
from the American Tissue Culture Collection (via LGC
Standards, Boras, Sweden), except in the case of
Mycobacterium tuberculosis and Rhizobium etli where
genomic DNA were kind gifts from T. Tønjum (Oslo
University Hospital, Norway) and Dr V. Gonza ´ lez
(Universidad Nacional
Cuernavaca, Mexico), respectively. The PCR products
were subsequently cloned into the NdeI and BamHI
sites in the plasmid pJB658 (37), which was used in bac-
terial reactivation assays. For expression and purification
of N-terminally 6xHis-tagged recombinant protein in
E. coli, expression plasmids were constructed by transfer-
ring the AlkB-encoding NdeI-BamHI fragments from
the pJB658-derived plasmids to pET-28a(+) (Novagen,
Darmstadt, Germany).
Recombinant EcAlkB was expressed and purified essen-
tially as previously described (24), whereas the other
recombinant bacterial AlkB proteins were obtained by a
single affinity purification step (27).
Auto ´ nomade Me ´ xico,
Phage reactivation assay
The experiments were performed essentially as previou-
sly described (24). Plasmid pJB658 carrying a gene
encoding a bacterial AlkB protein was transfected into
the F-pilus-expressing, AlkB-deficient E. coli strain,
HK82/F0. Expressionof
induced by the addition of 2mM toluic acid (Fluka/
Sigma-Aldrich, St. Louis, MO) when the bacterial
cultures had reached A600=0.1, after which they were
further grown until A600=0.8.
DNA phage M13 or RNA phage MS2 was treated for
30min at 30?C with different concentrations of methyl
recombinant proteinwas
Nucleic Acids Research, 2009,Vol.37, No. 217125

Page 3

methanesulphonate (MMS; Sigma-Aldrich) or chloroace-
taldehyde (CAA; Sigma-Aldrich) to introduce methyl or
etheno adducts, respectively. One hundred microliters of
various dilutions of the treated phage was mixed with
300ml of induced bacteria and 3ml LB top agar, and
plated onto LB plates that were placed overnight at
37?C. Phage survival was scored by counting the resulting
plaques. All treatments and dilutions of the phages were
performed in M9 minimum salt medium.
Bacterial survival assay
Cultures of E. coli strain HK82/F0transformed with
pJB658-derivedplasmids
proteins were induced with toluic acid as described
above and grown until A600=0.5. Bacteria in 500ml of
the culture were pelleted, resuspended in 250ml of M9
minimum salt medium, and then mixed with an equal
volume of M9 minimum salt medium containing the
appropriate MMS concentration, followed by 30min
incubation at 30?C. Treated bacteria were diluted
10000-fold and plated onto LB plates and incubated over-
night at 37?C.
encodingbacterialAlkB
Assay for oxidative demethylation of [3H]methylated
ssDNA oligonucleotides
The [3H]methylated ssDNA oligonucleotide (sequence:
TAAAATAATAAATTAAA) was prepared by methy-
lation with N-[3H]methyl-N-nitrosourea as described
previously (7). [3H]methylated ssDNA was incubated
with 100pmol of recombinant, bacterial AlkB for
30min at 37?C in a 50ml reaction mixture containing
50mM HEPES–KOH pH 7.5, 2mM ascorbic acid,
100mM 2-oxoglutarate, 50mg/ml
FeSO4. The released ethanol-soluble radioactivity was
measuredbyscintillation
described (7).
BSAand 40mM
counting as previously
In vitro repair of oligonucleotides containing
site-specific lesions
DNA oligonucleotides (sequence: TAGACATTGCCATT
CTCGATAGGATCCGGTCAAACCTAGACGAATTC
CG) containing m1A, m3C or 1,N6-ethenoadenine (ea) at a
specific position(underlined)
ChemGenes, Wilmington, MA (m1A and m3C) and
Midland Certified Reagent Company Inc., Midland, TX
(eA). Corresponding 50-[32P]-labelled double-stranded
DNA (dsDNA) substrates were generated as previously
described (38,39). Repair reactions were performed essen-
tially as described (39). Briefly, 100pmol of bacterial AlkB
was incubated with 16.6nM m1A, m3C or (ea-containing
50-[32P]-labelled DNA in 50mM Tris–HCl pH 8.0, 2mM
ascorbic acid, 100mM 2-oxoglutarate, and 40mM FeSO4
in a final volume of 50ml at 37?C for 30min. Reactions
were terminated by the addition of 18mM EDTA, 0.4%
SDS and 0.4mg/ml proteinase K, and incubated at
37?C for 30min. The DNA was precipitated with
ethanol, dissolved in H2O, and then subjected to diges-
tion with 20U of DpnII for 1h at 37?C. The reaction
products were separated by 20% denaturing PAGE, and
were synthesizedby
visualized by phosphor imaging (Molecular Dynamics,
Sunnyvale, USA).
RESULTS
Sequence analysis of bacterial AlkB proteins
We have previously generated a limited sequence phylog-
eny of bacterial AlkB proteins, based on ?60 protein
sequences retrieved by PSI-BLAST searches, and divided
these proteins into two major groups, denoted 1A and 1B,
as well as the minor, heterogeneous group 2 (40). Since
then, the number of sequenced bacterial genomes has
increased considerably, reflected by the ?360 protein
sequences retrieved through a new PSI-BLAST search.
The phylogenetic tree based on an updated sequence align-
ment of bacterial AlkB proteins indicated that group 2
could be more appropriately subdivided into groups 2A
and 2B (Figure 1). Group 2A represents an outgroup,
while group 2B appears to be related to group 1B.
The recently published three-dimensional structures of
EcAlkB in complex with various substrates have identified
key residues involved in substrate recognition, and showed
that the 216 aa protein consists of the following three
domains: an N-terminal extension (aa 1–45) followed by
a ‘nucleotide-recognition lid’ (NRL; aa 46–89), and a
C-terminal dioxygenase domain, ‘the catalytic core’ (aa
90–216) (41,42). The dioxygenase domain is found in all
members of the AlkB family of proteins and several
conserved residues/motifs within this domain define the
AlkB family of proteins (18). The NRL domain of
EcAlkB is involved in binding the nucleic acid substrate,
and appears to be unique to the AlkB proteins repairing
DNA or RNA (42). The bacterial AlkBs are quite uniform
in size (typically from 190 to 220 aa), and generally consist
of a conserved dioxygenase domain and a less conserved
N-terminalregion(Supplementary
reasoned that this N-terminal part may contain key
determinants of substrate specificity. To reveal possible
similarities in this region, iterative PSI-BLAST searches
were performed with the N-terminal part of different
AlkB proteins as the initial query. It was found that
group 1B members were retrieved in searches where this
region from group 2B protein was the initial query, and
vice versa. Accordingly, groups 1B and 2B proteins shared
several conserved amino acids in the NRL domain (Figure
2A). When similar searches were performed with proteins
from groups 1A and 2A, only proteins from the same
group were retrieved. Although the iterative BLAST
searches did not reveal sequence similarity between the
N-terminal parts of the 1A and 1B proteins, they still
appeared to share some conserved key residues in their
NRL domain (Figure 2A), including residues of EcAlkB
(Trp69 and Tyr76) that have been implicated in substrate
binding (42). Notably, the regions of group 1B proteins
displaying homology to group 1A or 2B proteins were
non-overlapping and adjacent (Figure 2A). The observa-
tion that the NRL domain of group 1B proteins displayed
sequence homology to both 1A and 2B proteins suggested
to us that proteins from these three groups may recognize
similar substrates.
FigureS2).We
7126Nucleic Acids Research, 2009,Vol.37, No. 21

Page 4

Sequence comparison of bacterial and eukaryotic
AlkB proteins
ALKBH2 and ALKBH3, which are functional vertebrate
homologues of EcAlkB, display the highest sequence sim-
ilarity to bacterial AlkB proteins from group 1B (40).
Indeed, ALKBH2, ALKBH3 and group 1B bacterial
AlkBssharenumerousconserved
region corresponding to the NRL domain of EcAlkB
(Figure 2B). Most of these residues are also shared
residuesinthe
between group 1B proteins and members of either group
1A or 2B (Figure 2; compare panels A and B), further
supporting our hypothesis that proteins from these three
groups may act on similar nucleic acid substrates.
Notably, the NRL residues that in a recently published
crystal structure of human ALKBH2 were shown to be
in close contact with a m1A-containing dsDNA substrate,
i.e. Arg110, Tyr122, Phe124 and Ser125 (41), are all
among these conserved, shared residues (Figure 2B).
Moreover, Phe102 in ALKBH2, which was shown to be
159184347|Alpha|Agrobacterium tumefaciens str- C58
115345714|Alpha|Roseobacter denitrificans OCh 114
67458989|Alpha|Rickettsia felis URRWXCal2
86360251|Alpha|Rhizobium etli CFN 42
86158437|Delta|Anaeromyxobacter dehalogenans 2CP-C
50
86742725|Actin|Frankia sp- CcI3
158312528|Actin|Frankia sp- EAN1pec
15840428|Actin|Mycobacterium tuberculosis CDC1551
21225578|Actin|Streptomyces coelicolor A3(2)
29827672|Actin|Streptomyces avermitilis MA-4680
54025596|Actin|Nocardia farcinica IFM 10152
86740838|Actin|Frankia sp- CcI3
91778839|Betap|Burkholderia xenovorans LB400
21230541|Gamma|Xanthomonas campestris str- ATCC 33913
113953643|Cyano|Synechococcus sp- CC9311
124023019|Cyano|Prochlorococcus marinus str- MIT 9303
24372682|Gamma|Shewanella oneidensis MR-1
110640165|Bacte|Cytophaga hutchinsonii ATCC 33406
15598502|Gamma|Pseudomonas aeruginosa PAO1
53717149|Betap|Burkholderia mallei ATCC 23344
91778258|Betap|Burkholderia xenovorans LB400
15601714|Gamma|Vibrio cholerae O1 biovar eltor str- N16961
21230106|Gamma|Xanthomonas campestris str- ATCC 33913
15837900|Gamma|Xylella fastidiosa 9a5c
70729777|Gamma|Pseudomonas fluorescens Pf-5
29827984|Actin|Streptomyces avermitilis MA-4680
21219556|Actin|Streptomyces coelicolor A3(2)
46445920|Chlam|Candidatus Protochlamydia amoebophila UWE25
23500280|Alpha|Brucella suis 1330
17989084|Alpha|Brucella melitensis 16M
123443816|Gamma|Yersinia enterocolitica subsp- enterocolitica 8081
16761192|Gamma| Salmonella enterica Typhi str- CT18
16130149|Gamma|Escherichia coli str- K12 substr- MG1655
24113597|Gamma|Shigella flexneri 2a str- 301
71735492|Gamma|Pseudomonas syringae pv- phaseolicola 1448A
70730772|Gamma|Pseudomonas fluorescens Pf-5
33591569|Betap|Bordetella pertussis Tohama I
17547287|Betap|Ralstonia solanacearum GMI1000
148547584|Gamma|Pseudomonas putida F1
108763595|Delta|Myxococcus xanthus DK 1622
27378074|Alpha|Bradyrhizobium japonicum USDA 110
91978060|Alpha|Rhodopseudomonas palustris BisB5
34498651|Betap|Chromobacterium violaceum ATCC 12472
16124265|Alpha|Caulobacter crescentus CB15
110677776|Alpha|Roseobacter denitrificans OCh 114
86355707|Alpha|Rhizobium etli CFN 42
13474252|Alpha|Mesorhizobium loti MAFF303099
2A
2B
1A
1B
Figure 1. Phylogenetic tree of selected bacterial AlkB proteins. Dots indicate tree nodes with bootstrap support ?70%. Numbers represent GenBank
Identifier (gi) numbers. Proteins included in the experimental part of the present work have been underlined, and the four identified subgroups are
indicated. Actin, Actinobacteria; Alpha, Alphaproteobacteria; Bacte, Bacteroidetes; Betap, Betaproteobacteria; Chlam, Chlamydiae; Cyano,
Cyanobacteria; Delta, Deltaproteobacteria; Gamma, Gammaproteobacteria. The scale bar represents the number of substitutions per 100 positions.
The alignment on which the tree was based is found in Supplementary Figure S1, and a more comprehensive alignment of bacterial AlkB proteins is
shown in Supplementary Figure S2.
Nucleic Acids Research, 2009,Vol.37, No. 217127

Page 5

important for flipping out the damaged base from the
dsDNA structure (41), is conserved as an aromatic
residue in ALKBH2 and group 1B proteins, but not in
ALKBH3 proteins, which are inactive on dsDNA
substrates(Figure2B),suggesting
proteins may also be active on dsDNA.
Among bacterial AlkB proteins, those from group
2A appeared as a small outgroup (Figure 1), whose
N-terminal part displayed little sequence similarity to
proteins belonging to the other three groups. However,
putative NRL domain of group 2A proteins displayed
thatgroup1B
substantial homology to a corresponding region in
ALKBH8 proteins (Figure 2C), which are found in most
multicellular eukaryotes and probably have a function
other than DNA repair (see Discussion section).
Distribution of AlkB proteins across bacterial species
Many, but not all bacteria possess an AlkB protein,
and an iterative PSI-BLAST search of 547 completely
sequencedand annotated
EcAlkB as query returned 215 bacterial AlkB proteins
bacterial genomesusing
Group 1A
Group 1B
Group 2B
Tyr76Trp69
Thr51
Pro52
Gly53
Tyr122
Phe102
Phe124
Arg110
Ser125
A
B
C
Group 1B
ALKBH3
ALKBH2
Group 2A
Plant ALKBH8
Animal ALKBH8
Figure 2. Sequence alignments of the region encompassing the putative nucleotide-recognition lid (NRL) of various AlkB proteins. (A) Alignments
of the NRL regions of AlkB of selected members of group 1A, 1B or 2B. Thr51, Pro52, Gly53, Trp69 and Tyr76, which in the three-dimensional
structure of EcAlkB were shown to interact with the DNA substrate, are indicated. Dashed lines indicate partially or fully conserved residues that are
shared between group 1B members and those from groups 1A (green) or 2B (red). (B) Alignment of the NRL region of group 1B bacterial proteins
and vertebrate ALKBH2 and ALKBH3. Arrows indicate residues that are conserved between group 1B bacterial AlkB proteins and ALKBH2 or
ALKBH3, as well as between group 1B proteins and proteins from groups 2B (red) or 1A (green). Indicated are the residues Phe102, Arg110, Tyr122,
Phe124 and Ser125, which in the three-dimensional structure of human ALKBH2 were shown to interact with the DNA substrate. (C) Alignment
of the NRL region of group 2A bacterial proteins and ALKBH8 from multicellular eukaryotes. Yen, Yersinia enterocolitis; Bsu, Brucella suis;
Pfl, Pseudomonas fluorescens; Ccr, Caulobacter crescentus; Vch, Vibrio cholerae; Pae, Pseudomonas aeruginosa; Son, Shewannella oneidensis; Ssp,
Synechococcus sp. CC9311; Pma, Prochlorococcus marinus MIT 9303; Fsp, Frankia sp. CcI3; Hs, Homo sapiens; Gg, Gallus gallus; Dr, Danio rerio;
Dm, Drosophila melanogaster; Rfe, Rickettsia felis; Rde, Roseobacter denitrificans; Os, Oryza sativa; At, Arabidopsis thaliana; Vv, Vitis vinifera.
Proteins included in the experimental part of this work are indicated by the abbreviations introduced in Table 2 (SC-1A, XC-1B, etc.).
7128Nucleic Acids Research, 2009,Vol.37, No. 21

Page 6

(as of February 2008), of which 186 remained after
removal of the redundancy corresponding to different
strains of the same bacterial species. Of these, 144
proteins were found in bacteria possessing a single AlkB
protein, whereas the rest were found in species having two
(18 species; 36 proteins) or three (2 species; 6 proteins)
AlkB proteins (Table 1). In our previous bioinformatics
study of bacterial AlkB proteins, we noted that several of
the group 2 proteins were found in bacteria possessing two
AlkB proteins, in most cases one from group 1 and one
from group 2 (40). This still holds partially true with the
considerably higher number of genomes analyzed here; of
34 group 2 proteins, 12 are found in bacteria that also
have a group 1 AlkB protein. However, no particular
combination of two AlkBs is particularly frequent, and
seven of the ten possible combinations (1A+1A,
1A+1B, 1A+2A, etc.) are actually found (Table 1).
To verify if the assignment of bacterial AlkB proteins to
four different groups also holds true in a natural microbial
community, we analyzed the AlkB sequences from the
NCBI environmental sample database, mainly consisting
of marine samples from the Sargasso Sea (43). A PSI-
BLAST search retrieved 143 protein sequences, and after
reducing redundancy (so that no sequence was >95%
identical to any other sequence) and removing sequences
of apparent eukaryotic origin, 86 sequences remained.
These sequences showed a distribution between the four
groups (1A:1B:2A:2B=23:50:6:7) which was not dramat-
ically different from that found when studying completely
sequenced bacteria (Table 1; 1A:1B:2A:2B=79:73:11:23).
To relate the distribution of bacterial AlkBs to bacterial
phylogeny, a phylogenetic tree of selected bacterial species
was constructed based on 16S ribosomal RNA sequences,
and the distribution of AlkB proteins across the four
groups has been indicated on this tree (Figure 3). As
previously reported (40), bacteria from certain phyla and
subdivisions,suchasfirmicutes,
e-proteobacteria appear to lack AlkB proteins altogether.
Members of some bacterial phyla tend to possess AlkBs
from certain groups; actinobacteria usually have group 2B
AlkBs, most cyanobacteria possess AlkBs from group 1B,
whereas a-proteobacteria usually contain an AlkB protein
from group 1A, and in some cases also one from group
2A. On the other hand, a more heterogeneous distribution
of AlkB proteins is found within the b- and g-subdivisions
of proteobacteria, and there are several examples that
closely related bacteria possess AlkB proteins from differ-
ent groups. For example, in the genus Pseudomonas,
species exist that have AlkBs from group 1A (P. putida
and P. syringae), group 1B (P. aeruginosa), as well as a
combination of the two (P. fluorescens). Also, a group 1A
AlkB is found in Yersinia enterocolitica, while no AlkB
encoding gene is present in Yersinia pestis (Figure 3).
spirochaetesand
In vivo repair of methylated ssDNA
For the experimental studies, AlkB proteins were selected
from three bacterial species that have two such proteins
and where genomic DNA was available through the
ATCC, i.e. Xanthomonas campestris (1B and 2B), and
Streptomycescoelicolorand Streptomyces
(both 1A and 2B). The six respective proteins were
designated accordingly; XC-1B, XC-2B, SC-1A, SC-2B,
SA-1A and SA-2B (Table 2). In addition, we included a
group 2A protein from Agrobacterium tumefaciens,
AT-2A, a group 2A protein from Rhizobium etli, RE-2A
(R. etli alsohas agroup1A protein)andagroup 2Bprotein
from Mycobacterium tuberculosis, MT-2B (Table 2).
To study the in vivo repair activity of the various
bacterial AlkB proteins, AlkB-deficient (AlkB?) E. coli
was transformed with expression plasmids encoding
bacterial AlkBs, and the effect of exposing bacterial or
bacteriophagegenomesto
assessed. When the ssDNA bacteriophage
exposed to methylmethanesulfonate (MMS), substantial
amounts of the AlkB substrates m1A and m3C are
introduced, and a dramatically lower number of progeny
phage is obtained with AlkB?E. coli relative to wild-type
E. coli, due to inefficient repair of replication blocking
lesions (44). This repair deficiency can be complemented
by expressing a functional AlkB protein (13,24), and we
found that all groups 1A and 1B proteins, (SA-1A, SC-1A
and XC-1B) as well as most of the group 2B proteins
(MT-2B, SA-2B, SC-2B) displayed a complementing
ability similar to, or slightly lower than that of EcAlkB
(Figure 4A). No complementation was observed for
RE-2A and XC-2B. The AT-2A protein was inactive in
this, as well as in subsequent, complementation assays
(data not shown), and since AT-2A also was insoluble
when expressed in E. coli, the negative results on
this protein have been omitted from figures and tables.
avermitilis
alkylatingagents was
M13 is
Table 1. Distribution of bacterial AlkB proteins in completely
sequenced genomes
No. of
AlkBs
Group(s)No. of
bacterial sp.
Bacterial genera/species
(examples)
11A65Escherichia, Salmonella,
Bradyrhizobium,
Rhodopseudomonas
Shewanella, Burkholderia,
Synechococcus, Xylella
Agrobacterium, Rickettsia
Mycobacterium, Nocardia
11B 61
1
1
2A
2B
6
12
1
2
2
All
1A
1A+1B
144
1
2
Ralstonia metallidurans
Marinobacter aquaeolei,
Pseudomonas fluorescens
Sinorhizobium, Rhizobium,
Roseobacter
Streptomyces, Rhodococcus
Acaryochloris marina
–
Xanthomonas, Burkholderia
xenovorans
–
–
Frankia
2 1A+2A5
2
2
2
2
1A+2B
1B
1B+2A
1B+2B
3
1
0
4
2
2
2
2A
2A+2B
2B
0
0
2
2
3
3
All
1A(2) +1B
1B
18
1
1
Burkholderia sp. 383
Flavobacterium johnsoniae
3
Any
All
All
2
164
Nucleic Acids Research, 2009,Vol.37, No. 217129

Page 7

These experiments indicate that most 1A/1B proteins, as
well as several 2B proteins, exhibit a repair function
similar to that of EcAlkB.
In vivo repair of etheno lesions in ssDNA
Etheno (e) lesions on DNA bases are characterized by a
C=C bridge connecting the exocyclic and heterocyclic
nitrogen atoms of adenine, cytosine, or guanine. Such
adducts are both mutagenic and cytotoxic, and can arise
from endogenous lipid peroxidation products, as well as
from environmental carcinogens, such as vinyl chloride.
Cytochrome P450 enzymes can convert vinyl chloride
to the reactive secondary metabolite chloroacetaldehyde
(CAA) (45), which is also frequently used as an
experimental tool for introducing e-adducts in vitro.
The main lesions induced by treatment of DNA with
CAA are 1,N6-ethenoadenine (eA), 3,N4-ethenocytosine
(eC),1,N2-ethenoguanine
N2,3-ethenoguanine(N2,3-eG)
(1,N2-eG),
with
and
thefollowing
Shewanella_oneidensis
Pseudomonas_aeruginosa
Rhizobium_etli
Burkholderia_xenovorans
Helicobacter_pylori
Cytophaga_hutchinsonii
Streptomyces_coelicolor
Roseobacter_denitrificans
*
Pseudomonas_syringae
Brucella_melitensis
*
Ehrlichia_canis
Agrobacterium_tumefaciens
*
*
Bradyrhizobium_japonicum
Streptococcus_pneumoniae
Nocardia_farcinica
Haemophilus_influenzae
Yersinia_pestis
Campylobacter_jejuni
Pasteurella_multocida
Shigella_flexneri_
Escherichia_coli
Pseudomonas_putida
Xanthomonas_campestris_
Myxococcus_xanthus
Anaeromyxobacter_dehalogenans
Brucella_suis
Chlamydia_muridarum
Borrelia_burgdorferi
Streptomyces_avermitilis
Rickettsia_felis
Caulobacter_crescentus
*
Bacillus_anthracis
Leptospira_interrogans
Rhodopseudomonas_palustris
Pseudomonas_fluorescens
Staphylococcus_aureus_
Mycobacterium_tuberculosis
Frankai_sp._Ccl3
Frankai_sp._EAN1
Wolinella_succinogenes
Neisseria_gonorrhoeae
Ralstonia_solanacearum
Prochlorococcus_marinus_MIT9303
Synechococcus_sp._CC9311
Yersinia_enterocolitica
Salmonella_enterica
Vibrio_cholerae
Xylella_fastidiosa
Lactobacillus_plantarum
Burkholderia_mallei
Chromobacterium_violaceum
Listeria_monocytogenes
Protochlamydia_amoebophila
Neisseria_meningitidis
Bordetella_pertussis
Clostridium_difficile_630
Bacteroides_fragilis
Mesorhizobium_loti
α-proteo-
bacteria
Y-proteo-
bacteria
β-proteo-
bacteria
Firmicutes
Cyanobacteria
δ-proteo-
bacteria
ε-proteo-
bacteria
bacteria
Actino-
Bacteroidetes
Spirochaetes
Chlamydiae
*
Group 1A
Group 1B
Group 2B
Group 2A
*
#
Figure 3. Distribution of AlkB proteins among bacterial species. A phylogenetic tree of selected bacterial species, including all species represented in
Figure 1, was generated based on 16S ribosomal RNA sequences. The distribution of AlkB proteins from the four groups has been indicated.
Additionally, AlkB homologs are found in the following lineages: Acidobacteria (Solibacter usitatus), Planctomycetes (Gemmata obscuriglobus),
Spirochaetes (Leptospira biflexa), GNS (green non-sulfur bacteria) bacteria (Dehalococcoides sp-VS), Chlamydiae/Verrucomicrobia group
(Verrucomicrobium spinosum).#This protein is only annotated as a partial AlkB sequence (92 aa) in the NCBI protein database, and has therefore
not been included in Figure 1.
Table 2. Bacterial AlkB proteins used in present study
AbbreviationOriginAccessionGi numberSize (aa)
AT-2Aa
MT-2B
RE-2A
SA-1A
SA-2B
SC-1A
SC-2B
XC-1B
XC-2B
EcAlkB
Agrobacterium tumefaciens
Mycobacterium tuberculosis
Rhizobium etli
Streptomyces avermitilis
Streptomyces avermitilis
Streptomyces coelicolor
Streptomyces coelicolor
Xanthomonas campestris
Xanthomonas campestris
Escherichia coli
NP_353535
NP_335465
YP_472140
NP_822618
NP_822306
NP_625335
NP_631357
NP_636023
NP_636458
NP_754639
15887854
15840428
86360251
29827984
29827672
21219556
21225578
21230106
21230541
26248599
209
205
189
222
208
216
210
201
211
216
aWhen this study was initiated the AT protein was annotated as indicated, but this protein has now been replaced
by NP_353535.2 [gi:159184347], representing translation initiation 42 nucleotides downstream, resulting in a protein
of 195 aa.
7130 Nucleic Acids Research, 2009,Vol.37, No. 21

Page 8

efficiencies: eA>eC>N2,3-eG>1,N2-eG (46,47). It has
recently been shown that EcAlkB, as well as the mamma-
lian homologues ALKBH2 and ALKBH3, can remove
etheno adducts in a reaction where the etheno moiety is
released as glyoxal (15,17,39).
To study the ability of the various bacterial AlkB
proteins to repair etheno adducts, CAA-treated ssDNA
bacteriophage M13 was used to infect AlkB?E. coli
expressing the different AlkB proteins and the number
of resulting progeny phage was quantified. As expected,
expression of EcAlkB did cause a dramatic increase in the
number of progeny phage obtained from CAA-treated
M13, and similar, albeit in some cases slightly weaker,
effects were observed with all the tested proteins
(Figure 4B). Notably, RE-2A and XC-2B, which were
inactive on methylated M13, showed robust activity on
the CAA-treated phage.
Complementation of the methylation sensitive
phenotype of AlkB?E. coli
It was next tested whether the various bacterial AlkB
proteins could complement the MMS-sensitive phenotype
of AlkB?bacteria. This approach is similar to the ssDNA
BA
DC
ssDNA phage survival
(% of untreated)
10–4
102
10–3
10–2
10–1
100
101
102
EcAlkB
XC-1B
MT-2B
XC-2B
RE-2A
Control
MMS (mM)
01530
10–4
10–3
10–2
10–1
100
101
10–4
102
10–3
10–2
10–1
100
101
102
10–4
10–3
10–2
10–1
100
101
EcAlkB
SA-1A
SC-1A
SC-2B
SA-2B
Control
EcAlkB
XC-1A
MT-2B
XC-2B
RE-2A
Control
ssDNA phage survival
(% of untreated)
CAA (mM)
010 20
EcAlkB
SA-1A
SC-1A
SC-2B
SA-2B
Control
Bacterial survival
(% of untreated)
1
10
100
EcAlkB
XC-1B
MT-2B
XC-2B
RE-2A
Control
MMS (mM)
015 30
1
10
100
EcAlkB
SA-1A
SC-1A
SC-2B
SA-2B
Control
RNA phage survival
(% of untreated)
0.1
1.0
10.0
100.0
EcAlkB
XC-1B
MT-2B
XC-2B
RE-2A
Control
MMS (mM)
0204060 80
0.1
1.0
10.0
100.0
EcAlkB
SA-1A
SC-1A
SC-2B
SA-2B
Control
Figure 4. In vivo repair of DNA/RNA damage in E. coli by bacterial AlkB proteins. (A) Repair of methyl lesions in ssDNA. AlkB?E. coli
expressing the indicated bacterial AlkB proteins were infected with ssDNA bacteriophage M13 that had been treated with the indicated
concentrations of MMS. The results are presented as the percentage of plaque numbers obtained with untreated M13. ‘Control’ represents
bacteria transformed with the empty expression plasmid. (B) Repair of etheno adducts in ssDNA. Similar experiment as in (A), except that M13
was treated with CAA. (C) Ability to complement the MMS-sensitive phenotype of AlkB?bacteria. AlkB?E. coli expressing the indicated bacterial
AlkB proteins was treated with the indicated concentrations of MMS, and the bacterial survival was assessed. (D) Repair of methyl lesion in ssRNA.
Similar experiment as in (A), except that ssDNA phage M13 was replaced by RNA phage MS2. For all these assays, similar results were obtained in
three or more independent experiments.
Nucleic Acids Research, 2009,Vol.37, No. 217131

Page 9

phage reactivation experiments above, but lesions are
likely to be present also in dsDNA. When AlkB?E. coli
expressing different bacterial AlkBs was treated with
MMS, all 1A/1B proteins (SA-1A, SC-1A and XC-1B)
were found to increase the survival, but only one out of
four 2B proteins and none of the 2A proteins had such an
effect (Figure 4C). These results suggest that the 1A/1B
proteins may be more important than the 2A/2B proteins
for protecting bacteria against methylating agents.
In vivo repair of methylated ssRNA
It has been demonstrated that several AlkB proteins can
repair lesions in RNA as well as in DNA (24,27). To study
whether the different bacterial AlkBs were active on RNA,
they were expressed in AlkB?E. coli, which was infected
with MMS-treated RNA bacteriophage MS2. Expression
of EcAlkB increased the number of progeny from the
methylated MS2 phage (Figure 4D), in agreement with
previous observations (24). A similar effect was observed
for XC-1B, but not for any of the other bacterial AlkB
proteins. This suggests that DNA rather than RNA is the
preferred substrate for most bacterial AlkB proteins.
Demethylating activity of recombinant proteins on
[3H]methylated ssDNA
The nine bacterial AlkBs were expressed in E. coli and
purified as hexahistidine-tagged proteins (Figure 5A).
Judged by their ability to decarboxylate 2OG to succinate,
they all appeared to be purified in an active state
(Supplementary Figure S3). With the exception of
EcAlkB (and possibly XC-1B), the decarboxylation of
2OG by bacterial AlkBs was not stimulated by the
ribonucleoside 1-methyladenosine (Supplementary Figure
S3), in agreement with the observed inability of these
proteins to repair methylated RNA (Figure 4D).
For the next series of experiments, a [3H]m1A-
containing AlkB-substrate was generated by treating an
A-rich ssDNA oligonucleotide with the radiolabelled
methylating agent N-[3H]methyl-N-nitrosourea, as pre-
viously described (7). When this substrate was incubated
with the bacterial AlkB proteins, a robust demethylating
activity, although somewhat lower than that of EcAlkB,
was observed for all proteins, except RE-2A and XC-2B,
where only negligible activity was measured (Figure 5B).
These results are in very good agreement with those
obtained with MMS-treated M13 (Figure 4B), where
m1A also represents the major deleterious lesion (7).
Repair activity on DNA substrates containing
site-specific lesions
The presence of alkyl lesions in dsDNA can prevent
cleavage by certain restriction enzymes. Thus, AlkB-
mediatedrepair of site-specific
oligonucleotides may be observed as the regeneration of
a functional restriction site (38,48). To further explore the
repair activity of the bacterial AlkB proteins, 50-[32P]-end-
labelled oligonucleotides containing specific lesions at a
DpnII-site (recognition sequence: GATC), were utilized.
DpnII-mediated cleavage of the 49-nt oligonucleotide into
a 22-nt end-labelled (and 27-nt unlabelled) fragment will
lesionsindsDNA
only occur if the lesion has been repaired (Figure 6A).
When using a dsDNA oligonucleotide containing an
m1A lesion, we could detect repair activity above back-
ground levels in the case of EcAlkB, MT-2B and XC-1B
(Figure 6B). Strong repair activity towards an m3C-
containing oligo was observed for the majority of
the proteins, but weak or no activity was observed for
RE-2A, SC-2B and XC-2B (Figure 6B). Two of the
latter, RE-2A and XC-2B, showed strong repair activity
towards eA (Figure 6B), in good agreement with the
results of experiments with CAA-treated M13. Some
proteins, such as SA-1A and SC-1A, which were able to
efficiently reactivate CAA-treated M13 ssDNA in vivo,
did only show background levels of repair of the
eA-containing dsDNA substrate in vitro. To elucidate
this apparent discrepancy, which could reflect different
activities of the enzymes on ssDNA versus dsDNA, an
in vitro repair experiment was performed on a single-
stranded substrate prior to annealing to the complemen-
tary strand. The results were very similar to those
obtained for eA-containing dsDNA, but a weak activity
A
B
Released radioactivity
(% of EcAlkB)
20
40
60
80
100
120
MT-2B
RE-2A
SA-2B
SA-1A
SC-1A
SC-2B
XC-1B
EcAlkB
XC-2B
kDa
75
MW marker
EcAlkB
MT-2B
RE-2A
SA-1A SA-2BSC-1ASC-2BXC-1B XC-2B
50
37
25
20
15
Figure 5. In vitro characterization of bacterial AlkB proteins. (A)
Purified recombinant His-tagged AlkB proteins used in this study.
Proteins were visualized by Coomassie staining of a 12% SDS–PAGE
gel.(B)Activity ofAlkBproteins
[3H]methylated oligonucleotides were incubated with 100pmol of
AlkB and the ethanol soluble radioactivity released was measured by
scintillation counting. Error bars represent the range between duplicate
measurements.
on methylated ssDNA.
7132Nucleic Acids Research, 2009,Vol.37, No. 21

Page 10

of SA-1A and SC-1A on eA-containing ssDNA could
indeed be observed.
DISCUSSION
We have here performed a sequence analysis of bacterial
AlkB proteins, showing that they can be subdivided into
four distinct groups: 1A, 1B, 2A and 2B. We found that
proteins from groups 1A and 2B shared several conserved
amino acids with the 1B proteins in the region correspond-
ing to the nucleotide recognition lid of EcAlkB, which
suggested that these three groups of proteins may act on
similar nucleic acid substrates.
Furthermore, we have undertaken a functional charac-
terization of nine different bacterial AlkB proteins, with a
particular focus on bacteria possessing two AlkBs. We
studied both the in vivo repair activity of the proteins
when expressed in E. coli, and the in vitro repair activity
of the purified recombinant proteins (summarized in
Table 3). In general, there is a good consistency within
the dataset obtained for any given protein, and the data
convincingly demonstrated that the groups 1A, 1B and 2B
proteins all possess DNA repair activity. Also, one of the
two tested group 2A proteins, RE-2A, displayed robust
repair activity. Intriguingly, RE-2A and XC-2B, which
are present in bacteria which also possess an AlkB from
groups 1A or 1B, efficiently repaired etheno lesions in
DNA, but displayed very low activity towards methyl
adducts.
Group 1A
The group 1A proteins are distributed among a wide range
of bacteria, including all the AlkB-containing subdivisions
of proteobacteria (Figure 3). This group includes the
founding member EcAlkB, and we have here studied
two other members, SA-1A and SC-1A, which both
come from the genus Streptomyces, and are 79% identical
on the protein sequence level. In accordance with this, the
two proteins displayed very similar properties and they
displayed robust repair activity in most of the assays.
These data strengthen the notion that group 1A consists
of proteins with a function similar to that of the founding
member EcAlkB.
Group 1B
The group 1B proteins are primarily found in the b- and
g-subdivisions of proteobacteria, as well as in cyano-
bacteria (Figure 3). These proteins are similar to the
ALKBH2/ALKBH3proteins,
proteins with a similar repair activity as EcAlkB.
Accordingly, the only group 1B protein studied here,
XC-1B, displayed repair activity in all assays. Our
bioinformaticsandexperimental
indicates that group 1B proteins are repair proteins with
a function similar to that of EcAlkB.
which are vertebrate
analysis,therefore,
Group 2B
Group
actinobacteria (Figure 3). However, they are also found
in some, but not all, subspecies of the root-associated
plant pathogens Xanthomonas (g-proteobacteria) and
Burkholderia(b-proteobacteria),
acquired their AlkBs by horizontal transfer from actino-
bacteria, most of which are soil bacteria (49). Protein
sequence analysis revealed that the proteins in groups 1B
and 2B shared several conserved residues in the NRL
region (Figure 2A), implying also the group 2B proteins
in DNA repair. Indeed, the investigated group 2B
proteins, MT-2B, SA-2B, SC-2B and XC-2B, displayed
2BAlkBproteinsaregenerallyfoundin
whichmayhave
A
B
m1Am3C
A
dR
dRdR
Repair reaction, DpnII digestion,
denaturing PAGE, phosphorimaging
5’ 32P
No repair (49 nt)
Repair (22 nt)
5’ 32P
3’
3’
GATC
CTAG
5’ 32P5’ 32P
5’5’
3’ 3’
3’3’
SA-1A
SA-2B
SC-2B
SC-1AXC-1B
XC-2B
MT-2B
EcAlkB
No enz.
49 nt
22 nt
m1A
dsDNA
dsDNA
εA
dsDNA
RE-2A
49 nt
22 nt
49 nt
22 nt
εA
ssDNA
49 nt
22 nt
m3C
Figure 6. In vitro repair of oligonucleotides containing site-specific
lesions. (A) Schematic representation of the experimental set-up.
Double-stranded (ds)
m3C, or eA in one strand of the DpnII restriction site GATC was
treated with repair enzyme, subsequently digested with DpnII, and
the products were separated by denaturing PAGE and visualized by
phosporimaging. To study repair activity on single-stranded DNA, the
lesion-containing32P-end-labelled 49-nt ssDNA substrate was subjected
to repair before annealing to the complementary strand. (B) Repair
activity of the different bacterial AlkB proteins on various dsDNA
and ssDNA substrates.
100pmol of the indicated proteins.
32P-end-labelled 49-nt DNA containing m1A,
32P-end-labelled substrate was incubated with
Nucleic Acids Research, 2009,Vol.37, No. 217133

Page 11

repair activity in most of the assays. However, the
substrate specificity of these proteins was quite diverse,
ranging from a protein (MT-2B) with high activity
towards methyl lesions and low activity on etheno
adducts, to the opposite (XC-2B).
Group 2A
The group 2A proteins are primarily found in the
a-subdivision of proteobacteria, such as Agrobacterium,
Rickettsia and Rhizobium species (Figure 3). Several of
these bacteria are plant pathogens that invade their
hosts, and exhibit substantial DNA exchange with the
host cell. In addition, Roseobacter denitrificans, which
also has a group 2A AlkB protein, is a marine bacterium
which populates the surfaces of green seaweeds (50).
Interestingly, group 2A AlkBs from several bacteria
(R. denitrificans, R.etli,
Sinorhizobium medicae) reside on plasmids rather than
on the chromosome, suggesting that they may have been
acquired from the host genome.
The group 2A AlkBs share strong homology with the
ALKBH8 proteins from plants and animals, which, by
bioinformatics analysis, have been implicated in tRNA
modification (22). This may suggest that group 2A
proteins are involved in tRNA modification rather than
in repair, in agreement with our inability to measure any
repair activity for AT-2A, but in apparent disagreement
with the observed activity of RE-2A on etheno adducts.
However, compared to AT-2A, RE-2A is considerably
more distantly related to the eukaryotic ALKBH8
proteins (Figure 2C), and this protein may, conceivably,
have evolved from a tRNA modification enzyme into a
repair protein. Unfortunately, due to its insolubility
when expressed in E. coli, we were not able to investigate
the enzymatic activity of AT-2A.
Sinorhizobium meliloti,
Distribution of bacterial AlkB proteins
Our phylogenetic analysis clearly showed that the phylog-
eny of bacterial AlkB protein sequences is very different
from that of the bacterial 16S RNA sequences, indicating
that a substantial degree of horizontal transfer of bacterial
AlkB genes has occurred. In particular, several bacterial
genera exist in which closely related species possess very
different AlkB proteins.
The somewhat patchy distribution of AlkB proteins
across bacterial species is similar to what is observed in
the case of plant-infecting RNA viruses (51). It has been
suggested that viruses exposed to a particularly high exog-
enous load of methylation damage may selectively
have acquired AlkBs (51). Similarly, bacteria exposed to
relatively high doses of methylating agents may profit
from possessing the AlkB function, whereas bacteria
experiencing less methylation damage may have disposed
of this function, or never acquired it, resulting in an
uneven distribution of AlkBs among bacterial species.
The lack of an AlkB function in many bacteria may also
be explained by the fact that certain bacteria have
translesion DNA polymerases that can efficiently bypass
AlkB-substrates, such as m1A and m3C, or that these
lesions are repaired through other cellular functions.
Indeed, it was recently found that the DNA alkylbase
glycosylase AlkA from the archaeon Archaeoglobus
fulgidus, which was active on typical AlkA substrates
such as 3-methyladenine (52), also acted on the AlkB
substrates m1A and m3C (53). Generally, archaea do not
possess AlkB proteins and it may be that all bacteria
lacking AlkB compensate for this by possessing a DNA
alkylbase glycosylase active on m1A and m3C. Another
possible explanation for the apparent lack of AlkB-
encoding sequences in some bacteria is that functional
AlkB homologues may exist that are not readily identifi-
able by current bioinformatics approaches.
The O2-dependent AlkB mechanism will not be
applicable in obligate anaerobic bacteria (23). Thus,
AlkB genes appear to be absent from typical anaerobes,
e.g. Clostridium,Fusobacterium,
Bacteroides, Bifidobacterium,
Thermotoga ssp.
Desulfitobacterium,
Propionobacteriumand
Function of bacterial AlkB proteins
In E. coli, the N-terminal part of the Ada protein (AdaA)
is an alkylation sensitive transcription factor which
mediates the up-regulation of AlkB and other alkylation
repair proteins in an adaptive response to alkylation
damage (54). Moreover, Ada and AlkB are in E. coli
part of the same operon, being encoded by a common
Table 3. Summary of experiments
Protein In vivo experimentsIn vitro experiments
ssDNA
(MMS)
ssDNA
(CAA)
Survival
(MMS)
ssRNA
(MMS)
[3H]Me-ssDNAdsDNA - m1A dsDNA - m3CdsDNA - eAssDNA - eA
SA-1A
SC-1A
XC-1B
RE-2A
MT-2B
SA-2B
SC-2B
XC-2B
++
++
++
?
++
++
++
?
++
++
+
++
+
++
+
++
+
++
++
?
?
+
?
?
?
?
++
?
?
?
?
?
+
+
+
?
+
+
+
?
?
?
++
?
++
?
?
?
++
++
++
+
++
++
+
?
?
?
++
++
?
+
?
++
+
+
++
++
?
+
?
++
++, activity comparable to, or slightly lower than, that of EcAlkB; +, substantially lower activity than EcAlkB; ?, no detectable activity.
7134Nucleic Acids Research, 2009,Vol.37, No. 21

Page 12

transcript. To investigate the possible involvement of
AdaA in regulating the expression of the various bacterial
AlkB proteins, we first found, by BLAST searches, that
the genomes of M. tuberculosis, R. etli, S. avermitilis
S. coelicolor, and X. campestris all encoded an AdaA
homologue (data not shown). However, adaA did not
form an operon with alkB in these bacteria, but rather
(in all cases except R. etli) with the genes encoding the
alkylbase glycosylase AlkA and DNA alkyltransferase
Ogt. Moreover, the alkB genes were generally not
localized adjacent to genes implicated in alkylation
repair (data not shown). Thus, the possible role of
AdaA in regulating the expression of these AlkB
proteinsmay best beaddressed
inducibility of the relevant genes in response to various
alkylating agents.
The results of the present study indicate that most
bacterial AlkBs have low activity on RNA, and that
AlkB-mediated RNA repair is rare, if not absent, in
bacteria. This is also supported by the observation that
the activity of EcAlkB on RNA substrates is ?10-fold
lower than on DNA (24,25). Bacterial mRNAs are
turned over very rapidly and may not acquire substantial
methylation damage during their life-time, thus obviating
the need for repair. We rather favor the idea that AlkB-
mediated RNA repair may be important in the case of
RNAs with a considerably longer lifespan, such as the
genomes of RNA viruses or long-lived mRNA species in
higher eukaryotes (26,27).
Due to the mutagenicity and carcinogenicity of etheno
adducts, their formation and repair has been subject of
extensive studies (55). Several different repair mechanisms
have been shown to target etheno adducts, but these also
act on additional substrates, thus making it hard to
address the significance of the observed activity. Indeed,
EcAlkB and the mammalian homologue ALKBH2, have
similar or stronger activity on m1A than on etheno
adducts, and the alkylbase DNA glycosylases AlkA
(E. coli) and AAG (mammals) prefer 3-methyladenine
over etheno lesions. Thus, two of the proteins studied
here, RE-2A and XC-2B, represents the first alkylation
repair enzymes which are active on etheno adducts, but
with low or no activity on methylated bases.
bystudying the
CONCLUSIONS
Our experiments firmly demonstrate that most, if not all,
bacterial AlkB proteins are DNA repair enzymes.
Moreover,theyindicate
preferentiallytargetetheno
proteins within each group do not represent an identical
repair function. Conceivably, AlkB proteins have the
ability to evolve different specificities, governed by the
type and amount of damaging agents encountered by
the individual bacteria.
thatsomeAlkB
and
proteins
that adducts,the
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
ACKNOWLEDGEMENTS
The [3H]methylated ssDNA AT-oligonucleotide was a
kind gift from Hanne Korvald and Ingrun Alseth. The
plasmidspJB658-EcAlkB
kindly provided by Hans Krokan. The authors are
thankful to T. Tønjum and V. Gonza ´ lez for providing
bacterial genomic DNA. We are grateful to Torbjørn
Rognesand Ophe ´ lieAussedat
bioinformatics analysis.
and pET28-EcAlkB were
for assistancewith
FUNDING
FRIBIOMOL and FUGE programs of the Research
Councilof Norwayand
Program of the National Library of Medicine at the
National Institutes of Health. Funding for open access
charge: National Institutes of Health Intramural Funds.
theIntramuralResearch
Conflict of interest statement. None declared.
REFERENCES
1. Keppler,F., Eiden,R., Niedan,V., Pracht,J. and Scholer,H.F. (2000)
Halocarbons produced by natural oxidation processes during
degradation of organic matter. Nature, 403, 298–301.
2. Redeker,K.R., Wang,N., Low,J.C., McMillan,A., Tyler,S.C. and
Cicerone,R.J. (2000) Emissions of methyl halides and methane
from rice paddies. Science, 290, 966–969.
3. Rydberg,B. and Lindahl,T. (1982) Nonenzymatic methylation
of DNA by the intracellular methyl group donor S-adenosyl-L-
methionine is a potentially mutagenic reaction. EMBO J., 1,
211–216.
4. Taverna,P. and Sedgwick,B. (1996) Generation of an endogenous
DNA-methylating agent by nitrosation in Escherichia coli.
J. Bacteriol., 178, 5105–5111.
5. Drablos,F., Feyzi,E., Aas,P.A., Vaagbo,C.B., Kavli,B.,
Bratlie,M.S., Pena-Diaz,J., Otterlei,M., Slupphaug,G. and
Krokan,H.E. (2004) Alkylation damage in DNA and RNA–repair
mechanisms and medical significance. DNA Repair (Amst), 3,
1389–1407.
6. Sedgwick,B. (2004) Repairing DNA-methylation damage. Nat. Rev.
Mol. Cell Biol., 5, 148–157.
7. Falnes,P.O., Johansen,R.F. and Seeberg,E. (2002) AlkB-mediated
oxidative demethylation reverses DNA damage in Escherichia coli.
Nature, 419, 178–182.
8. Trewick,S.C., Henshaw,T.F., Hausinger,R.P., Lindahl,T. and
Sedgwick,B. (2002) Oxidative demethylation by Escherichia coli
AlkB directly reverts DNA base damage. Nature, 419, 174–178.
9. Aravind,L. and Koonin,E.V. (2001) The DNA-repair protein AlkB,
EGL-9, and leprecan define new families of 2-oxoglutarate- and
iron-dependent dioxygenases. Genome Biol., 2, RESEARCH0007.
10. Delaney,J.C. and Essigmann,J.M. (2004) Mutagenesis, genotoxicity,
and repair of 1-methyladenine, 3-alkylcytosines, 1-methylguanine,
and 3-methylthymine in alkB Escherichia coli. Proc. Natl Acad. Sci.
USA, 101, 14051–14056.
11. Falnes,P.O. (2004) Repair of 3-methylthymine and 1-methylguanine
lesions by bacterial and human AlkB proteins. Nucleic Acids Res.,
32, 6260–6267.
12. Koivisto,P., Robins,P., Lindahl,T. and Sedgwick,B. (2004)
Demethylation of 3-methylthymine in DNA by bacterial and
human DNA dioxygenases. J. Biol. Chem., 279, 40470–40474.
13. Duncan,T., Trewick,S.C., Koivisto,P., Bates,P.A., Lindahl,T. and
Sedgwick,B. (2002) Reversal of DNA alkylation damage by two
human dioxygenases. Proc. Natl Acad. Sci. USA, 99, 16660–16665.
14. Koivisto,P., Duncan,T., Lindahl,T. and Sedgwick,B. (2003)
Minimal methylated substrate and extended substrate range
of Escherichia coli AlkB protein, a 1-methyladenine-DNA
dioxygenase. J. Biol. Chem., 278, 44348–44354.
Nucleic Acids Research, 2009,Vol.37, No. 217135

Page 13

15. Delaney,J.C., Smeester,L., Wong,C., Frick,L.E., Taghizadeh,K.,
Wishnok,J.S., Drennan,C.L., Samson,L.D. and Essigmann,J.M.
(2005) AlkB reverses etheno DNA lesions caused by lipid oxidation
in vitro and in vivo. Nat. Struct. Mol. Biol., 12, 855–860.
16. Frick,L.E., Delaney,J.C., Wong,C., Drennan,C.L. and
Essigmann,J.M. (2007) Alleviation of 1,N6-ethanoadenine
genotoxicity by the Escherichia coli adaptive response protein AlkB.
Proc. Natl Acad. Sci. USA, 104, 755–760.
17. Mishina,Y., Yang,C.G. and He,C. (2005) Direct repair of the
exocyclic DNA adduct 1,N6-ethenoadenine by the DNA repair
AlkB proteins. J. Am. Chem. Soc., 127, 14594–14595.
18. Kurowski,M.A., Bhagwat,A.S., Papaj,G. and Bujnicki,J.M. (2003)
Phylogenomic identification of five new human homologs of the
DNA repair enzyme AlkB. BMC. Genomics, 4, 48.
19. Gerken,T., Girard,C.A., Tung,Y.C., Webby,C.J., Saudek,V.,
Hewitson,K.S., Yeo,G.S., McDonough,M.A., Cunliffe,S.,
McNeill,L.A. et al. (2007) The obesity-associated FTO gene
encodes a 2-oxoglutarate-dependent nucleic acid demethylase.
Science, 318, 1469–1472.
20. Pan,Z., Sikandar,S., Witherspoon,M., Dizon,D., Nguyen,T.,
Benirschke,K., Wiley,C., Vrana,P. and Lipkin,S.M. (2008) Impaired
placental trophoblast lineage differentiation in Alkbh1(-/-) mice.
Dev. Dyn., 237, 316–327.
21. Westbye,M.P., Feyzi,E., Aas,P.A., Vagbo,C.B., Talstad,V.A.,
Kavli,B., Hagen,L., Sundheim,O., Akbari,M., Liabakk,N.B. et al.
(2008) Human AlkB homolog 1 is a mitochondrial protein that
demethylates 3-methylcytosine in DNA and RNA. J. Biol. Chem.,
283, 25046–25056.
22. Falnes,P.O., van den Born,E. and Meza,T.J. (2009) Demethylation
of DNA and RNA by AlkB Proteins. In Grosjean,H. (ed.), DNA
and RNA Modification Enzymes: Structure, Mechanism, Function
and Evolution. Landes Bioscience, Austin, USA.
23. Sedgwick,B., Bates,P.A., Paik,J., Jacobs,S.C. and Lindahl,T. (2007)
Repair of alkylated DNA: recent advances. DNA Repair (Amst), 6,
429–442.
24. Aas,P.A., Otterlei,M., Falnes,P.O., Vagbo,C.B., Skorpen,F.,
Akbari,M., Sundheim,O., Bjoras,M., Slupphaug,G., Seeberg,E.
et al. (2003) Human and bacterial oxidative demethylases repair
alkylation damage in both RNA and DNA. Nature, 421, 859–863.
25. Falnes,P.O., Bjoras,M., Aas,P.A., Sundheim,O. and Seeberg,E.
(2004) Substrate specificities of bacterial and human AlkB proteins.
Nucleic Acids Res., 32, 3456–3461.
26. Ougland,R., Zhang,C.M., Liiv,A., Johansen,R.F., Seeberg,E.,
Hou,Y.M., Remme,J. and Falnes,P.O. (2004) AlkB restores the
biological function of mRNA and tRNA inactivated by chemical
methylation. Mol. Cell, 16, 107–116.
27. van den Born,E., Omelchenko,M.V., Bekkelund,A., Leihne,V.,
Koonin,E.V., Dolja,V.V. and Falnes,P.O. (2008) Viral AlkB
proteins repair RNA damage by oxidative demethylation.
Nucleic Acids Res., 36, 5451–5461.
28. Altschul,S.F., Madden,T.L., Schaffer,A.A., Zhang,J., Zhang,Z.,
Miller,W. and Lipman,D.J. (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res., 25, 3389–3402.
29. Edgar,R.C. (2004) MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res., 32, 1792–1797.
30. Hasegawa,M., Kishino,H. and Saitou,N. (1991) On the maximum
likelihood method in molecular phylogenetics. J. Mol. Evol., 32,
443–445.
31. Jones,D.T., Taylor,W.R. and Thornton,J.M. (1992) The rapid
generation of mutation data matrices from protein sequences.
Comput. Appl. Biosci., 8, 275–282.
32. Waddell,P.J., Kishino,H. and Ota,R. (2002) Very fast algorithms
for evaluating the stability of ML and Bayesian phylogenetic trees
from sequence data. Genome Inform., 13, 82–92.
33. Katoh,K., Misawa,K., Kuma,K. and Miyata,T. (2002) MAFFT:
a novel method for rapid multiple sequence alignment based on
fast Fourier transform. Nucleic Acids Res., 30, 3059–3066.
34. Clamp,M., Cuff,J., Searle,S.M. and Barton,G.J. (2004) The Jalview
Java alignment editor. Bioinformatics., 20, 426–427.
35. Gertz,E.M., Yu,Y.K., Agarwala,R., Schaffer,A.A. and
Altschul,S.F. (2006) Composition-based statistics and translated
nucleotide searches: improving the TBLASTN module of BLAST.
BMC Biol., 4, 41.
36. Cole,J.R., Chai,B., Farris,R.J., Wang,Q., Kulam-Syed-
Mohideen,A.S., McGarrell,D.M., Bandela,A.M., Cardenas,E.,
Garrity,G.M. and Tiedje,J.M. (2007) The ribosomal database
project (RDP-II): introducing myRDP space and quality controlled
public data. Nucleic Acids Res., 35, D169–D172.
37. Blatny,J.M., Brautaset,T., Winther-Larsen,H.C., Haugan,K. and
Valla,S. (1997) Construction and use of a versatile set of
broad-host-range cloning and expression vectors based on the RK2
replicon. Appl. Environ. Microbiol., 63, 370–379.
38. Ringvoll,J., Nordstrand,L.M., Vagbo,C.B., Talstad,V., Reite,K.,
Aas,P.A., Lauritzen,K.H., Liabakk,N.B., Bjork,A., Doughty,R.W.
et al. (2006) Repair deficient mice reveal mABH2 as the primary
oxidative demethylase for repairing 1meA and 3meC lesions in
DNA. EMBO J., 25, 2189–2198.
39. Ringvoll,J., Moen,M.N., Nordstrand,L.M., Meira,L.B., Pang,B.,
Bekkelund,A., Dedon,P.C., Bjelland,S., Samson,L.D., Falnes,P.O.
et al. (2008) AlkB homologue 2-mediated repair of
ethenoadenine lesions in mammalian DNA. Cancer Res., 68,
4142–4149.
40. Falnes,P.O. and Rognes,T. (2003) DNA repair by bacterial AlkB
proteins. Res. Microbiol., 154, 531–538.
41. Yang,C.G., Yi,C., Duguid,E.M., Sullivan,C.T., Jian,X., Rice,P.A.
and He,C. (2008) Crystal structures of DNA/RNA repair enzymes
AlkB and ABH2 bound to dsDNA. Nature, 452, 961–965.
42. Yu,B., Edstrom,W.C., Benach,J., Hamuro,Y., Weber,P.C.,
Gibney,B.R. and Hunt,J.F. (2006) Crystal structures of catalytic
complexes of the oxidative DNA/RNA repair enzyme AlkB.
Nature, 439, 879–884.
43. Venter,J.C., Remington,K., Heidelberg,J.F., Halpern,A.L.,
Rusch,D., Eisen,J.A., Wu,D., Paulsen,I., Nelson,K.E., Nelson,W.
et al. (2004) Environmental genome shotgun sequencing of the
Sargasso Sea. Science, 304, 66–74.
44. Dinglay,S., Trewick,S.C., Lindahl,T. and Sedgwick,B. (2000)
Defective processing of methylated single-stranded DNA by E. coli
AlkB mutants. Genes Dev, 14, 2097–2105.
45. el Ghissassi,F., Barbin,A. and Bartsch,H. (1998) Metabolic
activation of vinyl chloride by rat liver microsomes: low-dose
kinetics and involvement of cytochrome P450 2E1. Biochem.
Pharmacol., 55, 1445–1452.
46. Dosanjh,M.K., Chenna,A., Kim,E., Fraenkel-Conrat,H.,
Samson,L. and Singer,B. (1994) All four known cyclic adducts
formed in DNA by the vinyl chloride metabolite
chloroacetaldehyde are released by a human DNA glycosylase.
Proc. Natl Acad. Sci. USA, 91, 1024–1028.
47. Kim,M.Y., Zhou,X., Delaney,J.C., Taghizadeh,K., Dedon,P.C.,
Essigmann,J.M. and Wogan,G.N. (2007) AlkB influences the
chloroacetaldehyde-induced mutation spectra and toxicity in the
pSP189 supF shuttle vector. Chem. Res. Toxicol., 20, 1075–1083.
48. Lee,D.H., Jin,S.G., Cai,S., Chen,Y., Pfeifer,G.P. and
O’Connor,T.R. (2005) Repair of methylation damage in DNA
and RNA by mammalian AlkB homologues. J. Biol. Chem., 280,
39448–39459.
49. Madigan,M.T., Martinko,J.M. and Parker,J. (2003) Brock Biology
of Microorganisms. Prentice Hall, Upper Saddle River, NJ.
50. Shiba,T. (1992) The genus roseobacter. In Starr,M.P., Stolp,H.,
Tru ¨ pper,H.G., Balows,A. and Schelgel,H.G. (eds), The Prokaryotes:
a Handbook on the Biology of Bacteria: Ecophysiology, Isolation,
Identification, Applications. Springer, Berlin, pp. 202–206.
51. Martelli,G.P., Adams,M.J., Kreuze,J.F. and Dolja,V.V. (2007)
Family Flexiviridae: a case study in virion and genome plasticity.
Annu. Rev. Phytopathol., 45, 73–100.
52. Birkeland,N.K., Anensen,H., Knaevelsrud,I., Kristoffersen,W.,
Bjoras,M., Robb,F.T., Klungland,A. and Bjelland,S. (2002)
Methylpurine DNA glycosylase of the hyperthermophilic archaeon
Archaeoglobus fulgidus. Biochemistry, 41, 12697–12705.
53. Leiros,I., Nabong,M.P., Grosvik,K., Ringvoll,J., Haugland,G.T.,
Uldal,L., Reite,K., Olsbu,I.K., Knaevelsrud,I., Moe,E. et al. (2007)
Structural basis for enzymatic excision of N1-methyladenine and
N3-methylcytosine from DNA. EMBO J., 26, 2206–2217.
54. Sedgwick,B. and Lindahl,T. (2002) Recent progress on the
Ada response for inducible repair of DNA alkylation damage.
Oncogene, 21, 8886–8894.
55. Gros,L., Ishchenko,A.A. and Saparbaev,M. (2003) Enzymology
of repair of etheno-adducts. Mutat. Res., 531, 219–229.
7136Nucleic Acids Research, 2009,Vol.37, No. 21