A LuxRI-family regulatory system controls excision and transfer of the Mesorhizobium loti strain R7A symbiosis island by activating expression of two conserved hypothetical genes.

Abstract

The symbiosis island ICEMlSym(R7A) of Mesorhizobium loti R7A is an integrative and conjugative element (ICE) that carries genes required for a nitrogen-fixing symbiosis with Lotus species. ICEMlSym(R7A) encodes homologues (TraR, TraI1 and TraI2) of proteins that regulate plasmid transfer by quorum sensing in rhizobia and agrobacteria. Introduction of traR cloned on a plasmid induced excision of ICEMlSym(R7A) in all cells, a 1000-fold increase in the production of 3-oxo-C6-homoserine lactone (3-oxo-C6-HSL) and a 40-fold increase in conjugative transfer. These effects were dependent on traI1 but not traI2. Induction of expression from the traI1 and traI2 promoters required the presence of plasmid-borne traR and either traI1 or 100 pM 3-oxo-C6-HSL, suggesting that traR expression or TraR activity is repressed in wild-type cells by a mechanism that can be overcome by additional copies of traR. The traI2 gene formed an operon with hypothetical genes msi172 and msi171 that were essential for ICEMlSym(R7A) excision and transfer. Our data suggest that derepressed TraR in conjunction with TraI1-synthesized 3-oxo-C6-HSL regulates excision and transfer of ICEMlSym(R7A) through expression of msi172 and msi171. Homologues of msi172 and msi171 were present on putative ICEs in several alpha-proteobacteria, indicating a conserved role in ICE excision and transfer.

Full text

Page 1

A LuxRI-family regulatory system controls excision and
transfer of the Mesorhizobium loti strain R7A symbiosis
island by activating expression of two conserved
hypothetical genesmmi_6843 1141..1155
Joshua P. Ramsay,1†John T. Sullivan,1
Nuzul Jambari,1Catharine A. Ortori,2Stephan Heeb,3
Paul Williams,3David A. Barrett,2Iain L. Lamont4
and Clive W. Ronson1*
1Department of Microbiology and Immunology and
4Department of Biochemistry, University of Otago, PO
Box 56, Dunedin, New Zealand.
2Centre for Analytical Bioscience, School of Pharmacy
and3School of Molecular Medical Sciences, Centre for
Biomolecular Sciences, University of Nottingham,
Nottingham NG7 2RD, UK.
Summary
The symbiosis island ICEMlSymR7Aof Mesorhizobium
loti R7A is an integrative and conjugative element
(ICE) that carries genes required for a nitrogen-fixing
symbiosis with Lotus species. ICEMlSymR7Aencodes
homologues (TraR, TraI1 and TraI2) of proteins that
regulate plasmid transfer by quorum sensing in rhizo-
bia and agrobacteria. Introduction of traR cloned on a
plasmid induced excision of ICEMlSymR7Ain all cells,
a 1000-fold increase in the production of 3-oxo-C6-
homoserine lactone (3-oxo-C6-HSL) and a 40-fold
increase in conjugative transfer. These effects were
dependent on traI1 but not traI2. Induction of expres-
sion from the traI1 and traI2 promoters required the
presence of plasmid-borne traR and either traI1 or
100 pM 3-oxo-C6-HSL, suggesting that traR expres-
sion or TraR activity is repressed in wild-type cells by
a mechanism that can be overcome by additional
copies of traR. The traI2 gene formed an operon with
hypothetical genes msi172 and msi171 that were
essential for ICEMlSymR7Aexcision and transfer. Our
data suggest that derepressed TraR in conjunction
with TraI1-synthesized 3-oxo-C6-HSL regulates exci-
sion and transfer of ICEMlSymR7Athrough expression
of msi172 and msi171. Homologues of msi172 and
msi171 were present on putative ICEs in several
a-proteobacteria, indicating a conserved role in ICE
excision and transfer.
Introduction
Mobile genetic elements that mediate the horizontal trans-
fer of DNA between bacteria represent a major driving
force in prokaryotic evolution (Ochman et al., 2000; Frost
et al., 2005). Available genome sequence data suggest
that genomic islands represent a significant portion of
horizontally acquired DNA (Dobrindt et al., 2004; Binnew-
ies et al., 2006). For the majority of genomic islands little
is known about their origin or mobilization and as such
they are usually identified in silico by the presence of
atypical DNA sequence composition, integration adjacent
to tRNA genes and by their absence in related isolates
(Mantri and Williams, 2004; Yoon et al., 2005; Guy, 2006;
Ou et al., 2006). However, a recently defined subset of
mobile genomic islands termed ‘integrative and conjuga-
tive elements’ or ICEs (Burrus et al., 2002; Burrus and
Waldor, 2004) are able to excise from the chromosome,
transfer to recipient cells via conjugation and (re)-
integrate at a specific site in both recipient and donor. A
better understanding of the selective forces and mecha-
nisms that govern transfer of these ICEs will aid our
understanding of prokaryotic evolution.
The symbiosis island ICEMlSymR7Aof Mesorhizobium
loti strain R7A was discovered through the ability of the
strain to transfer genes required for a nitrogen-fixing
symbiosis with Lotus corniculatus to non-symbiotic
mesorhizobia (Sullivan et al., 1995). The 502 kb ICE is
inserted downstream of a phe-tRNA gene in the M. loti
chromosome and is flanked by a 17 bp direct repeat that
represents the core sequence of its attachment site (Sul-
livan and Ronson, 1998). ICEMlSymR7Acontains over 400
open reading frames including a gene at its left end intS
that encodes a P4 phage-like integrase required for the
island’s integration and excision (Sullivan et al., 2002;
Accepted 31 July, 2009. *For correspondence. E-mail clive.ronson@
otago.ac.nz; Tel. (+64) 3 479 7701; Fax (+64) 3 479 8540.
address: Department of Biochemistry, University of Cambridge, Cam-
bridge CB2 1QW, UK.
†Present
Molecular Microbiology (2009) 73(6), 1141–1155 ?
doi:10.1111/j.1365-2958.2009.06843.x
First published online 28 August 2009
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd

Page 2

Ramsay et al., 2006). Like other ICEs, ICEMlSymR7A
excises from the genome to form a circular intermediate
prior to conjugative transfer. Efficient excision and conju-
gative transfer require the ICEMlSymR7A-encoded recom-
bination directionality factor RdfS as well as IntS (Ramsay
et al., 2006). Genes encoding homologues of RdfS are
present in a conserved gene cluster together with genes
encoding homologues of TraF (the TrbC protease that is
essential for mating pore formation) and the ICEMlSymR7A
relaxase RlxS on several putative genomic islands in a
range of a- and b-proteobacteria (Ramsay et al., 2006).
Many of these islands also contain a trb gene cluster of
the same organization as the trb cluster found on
ICEMlSymR7A(Sullivan et al., 2002; Toussaint et al., 2003;
Ramsay et al., 2006) that is required for conjugative
transfer.
The proportion of cells in which ICEMlSymR7Ais excised
during culture in a laboratory medium varies depending
on the growth phase of the culture, ranging from approxi-
mately 0.06% of cells in exponentially growing cultures to
approximately 6% of cells in stationary phase (Ramsay
et al., 2006). This observation suggests that excision may
be regulated in response to growth phase or cell popula-
tion density. Many Gram-negative bacteria encode
N-acyl-homoserine lactone (AHL)-dependent quorum
sensing (QS) systems that regulate gene expression in
response to cell population density (Waters and Bassler,
2005; Williams et al., 2007). ICEMlSymR7Aencodes a
putative LuxR-family transcriptional regulator TraR and
two putative AHL synthases TraI1 and TraI2 (Sullivan
et al., 2002), which show homology to the TraR and TraI
proteins of Agrobacterium tumefaciens and Rhizobium
leguminosarum bv. viciae that regulate plasmid transfer
via QS (Piper et al., 1993; Fuqua and Winans, 1994;
Hwang et al., 1994; Danino et al., 2003; Sanchez-
Contreras et al., 2007; White and Winans, 2007). The
traR and traI2 genes are located upstream of and in the
same orientation as two hypothetical open reading frames
(ORFs) msi172 and msi171 while the traI1 gene is located
162 kb away in a single gene operon (Sullivan et al.,
2002). Introduction of a plasmid containing cloned traR
and traI2 genes into M. loti strain R7A resulted in excision
of ICEMlSymR7Ain 100% of cells and increased AHL pro-
duction, strongly suggesting that excision of ICEMlSymR7A
is regulated by QS (Ramsay et al., 2006).
In this study we further investigated the roles of the
ICEMlSymR7A-encoded traR, traI1 and traI2 genes in the
regulation of excision. We show that introduction of traR
alone on a plasmid resulted in 100% excision and a 1000-
fold increase in the production of 3-oxo-C6-homoserine
lactone (3-oxo-C6-HSL). Both phenotypes were depen-
dent on the presence of a functional copy of traI1. We also
show that when active, TraR in conjunction with AHLs
synthesized by TraI1 induces ICEMlSymR7Aexcision and
transfer through the expression of two conserved hypo-
thetical genes msi172 and msi171, which are encoded on
a TraR-regulated polycistronic mRNA initiating upstream
of traI2.
Results
Excision of ICEMlSymR7Aand AHL production are
induced by plasmid-borne traR
We previously developed a quantitative PCR (QPCR)
assay that determines the proportion of cells containing
ICEMlSymR7Ain excised form (Ramsay et al., 2006). The
assay measures the proportion of attP ICE attachment
sites and attB chromosomal attachment sites that are
formed upon ICEMlSymR7Aexcision, relative to the chro-
mosomal gene melR in a cell population. Use of this
assay showedthatplasmid
ICEMlSymR7AtraR and traI2 genes induces excision of
ICEMlSymR7Ain 100% of M. loti strain R7A cells; in the
absence of pJR206, ICEMlSymR7Ais excised in at most
6% of cells. In addition, strain R7A(pJR206) causes
strong induction of violacein production in the AHL indica-
tor strain Chromobacterium violaceum CV026 whereas
strain R7A shows weak or no induction of CV026
(Ramsay et al., 2006).
To determine whether the effects of pJR206 on excision
and AHL production required traI2, a derivative pJRtraR
containing only traR with its native promoter was
constructed. Strain R7A(pJRtraR) induced a strong
response in CV026 (Fig. 1A) identical to that previously
seen with R7A(pJR206), and QPCR assays of DNA
extracted from exponential and stationary-phase cultures
showed that the ICEMlSymR7Awas excised in 100% of
cells (Fig. 2A). In contrast, introduction of pJRtraR or
pJR206 into strain R7ANS, a derivative of R7A cured of
ICEMlSymR7A, did not enable the strain to induce violacein
production in CV026. These results indicate that the intro-
duction of a plasmid-borne copy of traR is sufficient to
induce AHL production and excision of ICEMlSymR7Ain
strain R7A and that AHL production requires additional
ICEMlSymR7Agenes.
pJR206carryingthe
traI1 but not traI2 is required for induction of violacein
production in CV026
To investigate if either of the putativeAHL synthases TraI1
or TraI2 were required for AHL synthesis, mutant strains
withmarkerlessin-frame
R7ADtraI1) and traI2 (strains R7ADtraI2* and R7ADtraI2)
were constructed. Strain R7ADtraI2* contained a deletion
beginning 22 bp upstream of the traI2 start codon, due to
theinadvertentuseofanincorrecttranslationalstartcodon
duringdesignofthedeletion,whereasthedeletioninstrain
deletions intraI1(strain
1142
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 3

R7ADtraI2 began at the 41st codon of the gene. The
deletion end-point in both mutants was 36 bp before
the stop codon of traI2. The ability of the mutants, in
the presence or absence of pJRtraR, to induce violacein
production in CV026 was then assayed. Surprisingly,
strain R7ADtraI2* showed weak induction whereas
strains R7ADtraI1 and R7ADtraI2, like R7A, showed
no induction (Fig. 1A and data not shown). Strains
R7ADtraI2*(pJRtraR) and R7ADtraI2(pJRtraR) showed a
similar level of induction to that of R7A(pJRtraR) (data not
shown), whereas R7ADtraI1(pJRtraR) did not induce
detectable violacein production (Fig. 1A).
To further investigate the roles of traI1 and traI2 in AHL
synthesis, each gene was cloned downstream of the
IPTG-inducible tac promoter in an expression vector
pTH1227 and the resulting plasmids pJRtraI1E and
pJRtraI2E were introduced into Escherichia coli strain
DH5a and M. loti strains R7A and R7ANS. Both M. loti
derivatives and DH5a containing pJRtraI1E strongly
induced violacein production in CV026 when cultured in
the presence of IPTG. However, strains containing
pJRtraI2E showed no violacein induction.
AHLs produced by strain R7A and its derivatives
Reversed-phase thin-layer chromatography of dichlo-
romethaneextractsfromM. lotisupernatantsrevealedthat
strain R7A(pJRtraR) produced at least four AHLs capable
of inducing pigment production in CV026, while no AHLs
were detected in extracts from R7A (data not shown). To
identify and quantify the AHL species present in culture
supernatants of strain R7A and its derivatives, extracts
were analysed using liquid chromatography coupled to
hybrid quadrupole-linear ion trap mass spectrometry (LC-
MS/MS).The extracts were screened for molecules with 4,
6, 8, 10, 12 or 14 carbons with or without 3-oxo- or
3-hydroxy- substitutions (Table 1). Strain R7A produced
low levels of C4-HSL, 3-oxo-C6-HSL and 3-oxo-C12-HSL.
Strain R7A(pJRtraR) extracts contained over 1000-fold
more 3-oxo-C6-HSL than R7Aand substantial amounts of
several other C6 and C8AHLs. The amount of 3-oxo-C12-
HSL in R7A(pJRtraR) was similar to that in R7A. Strains
R7ADtraI1, R7ADtraR and R7ANS produced reduced
levels of 3-oxo-C6-HSL compared with wild type and wild-
type levels of 3-oxo-C12-HSL. The AHL profile of
R7ADtraI2*(pJRtraR) was similar to that of R7A(pJRtraR),
except that the amounts of most AHL species were three-
to eightfold increased and 3-oxo-C12-HSL was not
detected. Strain R7ADtraI2* showed an increased amount
of 3-oxo-C6-HSL compared with R7A and low amounts of
severalAHLsthatwerelikelypresent(giventheirpresence
in R7A/pJRtraR) but below the threshold of detection in
R7A (Table 1). As 3-oxo-C12-HSL was near the detection
limit of the assay in all strains where it was observed
including R7ADtraI2*, it is likely that it was present but
below the detection limit in R7ADtraI2*(pJRtraR).
To test if the increased AHL production in R7ADtraI2*
required a functional traI1, a double mutant R7ADtraI2*
DtraI1wasconstructedandpJRtraRorpJR206(traRtraI2)
introduced into it. Strains R7ADtraI2*DtraI1(pJRtraR) and
R7ADtraI2*DtraI1 (pJR206) did not induce violacein pro-
duction in CV026.
Taken together, these results suggest that TraI1 was
responsible for the substantial increase in synthesis of
3-oxo-C6-HSLand concomitant increases in several other
C6 and C8 AHLs observed in R7A(pJRtraR) and
R7ADtraI2*(pJRtraR), while additional AHL synthase(s)
encoded outside ICEMlSymR7Amay be responsible for the
production of very low amounts of 3-oxo-C6-HSL and
3-oxo-C12-HSL (Table 1).
QS mutants apart from R7ADtraI2* show similar
excision levels to wild type
It seemed likely that traR and traI1 were involved in both
AHL production and regulation of ICEMlSymR7Aexcision,
given that pJRtraR induced excision in 100% of R7A cells
and traI1 was required for the pJRtraR-dependent induc-
tion ofAHLproduction. However, excision of ICEMlSymR7A
was only slightly reduced in strains R7ADtraR and
R7ADtraI1 and, surprisingly, an increase in excision was
Fig. 1. Induction of violacein production in C. violaceum CV026 by
various M. loti strains. Stationary phase (64 h) M. loti cultures were
spotted on a TY plate (indicated by a white circle) and incubated
for 24 h, after which a CV026 overlay was applied and the plate
incubated overnight. A dark halo indicates where M. loti cultures
have induced strain CV026 to produce violacein through production
of AHLs.
A. Strains R7A, R7ADtraI1 and R7ADtraR with or without pJRtraR.
Strain R7ADtraI1 complemented with pJRtraI1 is also shown.
B. Strains R7A, R7ADmsi171 or R7ADmsi172 with or without
pJRtraR.
Regulation of ICEMlSymR7Aexcision
1143
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 4

still observed in stationary phase cultures (Fig. 2A). Like
R7A(pJRtraR), strain R7ADtraR(pJRtraR) induced higher
levels of violacein production in CV026 (Fig. 1A) and exci-
sion of ICEMlSymR7A(Fig. 2A) than R7A. Consistent with
its inability to produce AHLs above R7A levels, strain
R7ADtraI1(pJRtraR) showed similar excision levels to
R7A (Fig. 2A). To complement the DtraI1 mutation,
plasmid pJRtraI1 that contains traI1 and its upstream
sequence wasintroduced
R7ADtraI1(pJRtraI1) showed weak or no induction of vio-
lacein production in CV026 (Fig. 1A) and moderately
increased excision relative to that observed in R7A
(Fig. 2A), indicating that pJRtraI1 complemented and
likely overcompensated for the effect of the traI1 mutation
on excision. The above results indicate that, while the traR
gene when present on pJRtraR induced ICEMlSymR7A
excision in 100% of cells in a traI1-dependent manner,
other factors contributed to the dependence of excision on
growth phase in the wild-type R7A strain.
Next we investigated excision of ICEMlSymR7Ain the
two traI2 mutants (Fig. 2B). R7ADtraI2 showed a similar
intoR7ADtraI1. Strain
phenotype to R7A, but R7ADtraI2* showed markedly
reduced levels of excision, a phenotype that was not
corrected by addition of a cloned copy of traI2 in pJRtraI2
(Fig. 2B). Derivatives of R7ADtraI2* carrying pJRtraR or
pJR206 (traRtraI2) also had excision levels (Fig. 2B) that
were markedly reduced in comparison with those
observed in R7A carrying the same plasmids (Fig. 2A and
Ramsay et al., 2006).
TraR activates transcription of traI1 and traI2
To determine whether expression of traI1 and traI2 was
affected by pJRtraR, traI1 or traI2 mutant strains were
constructed by insertion of the suicide vector pFUS2. The
mutants contained a transcriptional fusion between the 5′
end of the respective traI gene, which was inactivated by
the insertion, and lacZ. The plasmid pJRtraR or its parent
vector pFAJ1700 were then introduced into each mutant
strain. The R7AtraI2::lacZ mutant containing pJRtraR
induced violacein production
R7AtraI1::lacZ strain containing pJRtraR did not, consis-
in CV026but the
Fig. 2. Excision of ICEMlSymR7Ain R7A and
tra gene mutants. QPCR of DNA templates
attP and attB was used as a measure of
ICEMlSymR7Aexcision relative to the
chromosome population detected by QPCR of
melR. Percentage attP and attB at 24 h
(exponential growth) are shown by black and
white bars respectively, while percentage attP
and attB at 64 h (stationary phase) are shown
by black bars/white hatching and white
bars/black hatching respectively. Cultures of
strain R7A(pJRtraI1E) were induced with
0.1 mM IPTG at the time of inoculation. Data
presented are the average of at least two
independent experiments (error bars
represent ? 1 standard deviation). Individual
QPCR measurements are the mean of
triplicate reactions for each amplicon.
Asterisks indicate samples with significant
deviation from the wild-type data
(*P < 0.05, **P < 0.01).
1144
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 5

tent with the phenotypes of the previously constructed
in-frame deletion mutants. The traI2::lacZ fusion was not
active (< 10 Miller units) in the absence of pJRtraR, even
when50 nM 3-oxo-C6-HSL
traI2::lacZ was strongly expressed (437 ? 22 Miller units)
when pJRtraR was present. As expected given that
R7ADtraI2(pJRtraR) makes large quantities of AHLs, the
addition of 50 nM 3-oxo-C6-HSL had no effect on expres-
sion (412 ? 20 Miller units). The traI1::lacZ fusion was not
expressed in the absence of 3-oxo-C6-HSL even in the
presence of pJRtraR. The addition of 3-oxo-C6-HSL at a
concentration of 100 pM induced strong expression of the
traI1::lacZ fusion only in the presence of pJRtraR (Fig. 3).
Several of the other AHLs (C6-HSL, 3-hydroxy-C6-HSL,
3-hydroxy-C8-HSL and 3-oxo-C8-HSL) produced by
R7A(pJRtraR) were also assayed for their ability to induce
b-galactosidase activity in strain R7AtraI1::lacZ(pJRtraR)
when added at 20 nM. All induced the fusion to a similar
level as 3-oxo-C6-HSL, indicating that TraR is able to
recognize several AHLs and may not have a single
cognate AHL. The results also showed that transcription
of both traI1 and traI2 was activated by pJRtraR and that,
for the traI1 promoter at least, this was dependent on the
presence of AHL species produced by TraI1. However, in
the wild-type strain the genes were poorly expressed
even in the presence of high levels of exogenous AHL.
was added. However,
AHL-dependent activation of excision by TraR is subject
to an additional level of regulation in strain R7A
To test whether increased traI1 expression induced exci-
sion of ICEMlSymR7Ain the absence of pJRtraR, the effect
Table 1. Abundance of AHLs in M. loti R7A and derivative strains.
Source of extract
Picomoles of AHL per sample ? standard deviationa
Acyl-chain length and 3C substituent
4-H
4-O
4-OH
6-H
6-O
6-OH
8-H
8-O
8-OH
10-O
10-OH
12-O
R7A
5.9 ? 8.4
–
–
–
19 ? 5.8
–
–
–
–
–
–
22 ? 2.3
R7A(pJRtraR)
91 ? 48
4.9 ¥ 102
? 2.5 ¥ 102
–
4.1 ¥ 103
? 1.3 ¥ 103
2.5 ¥ 104
? 7.4 ¥ 103
4.6 ¥ 102
? 1.9 ¥ 102
3.1 ¥ 103
? 4.0 ¥ 102
3.0 ¥ 103
? 2.4 ¥ 103
54
? 6.4 ¥ 10-1
1.3 ¥ 102
? 1.8 ¥ 102
6.3 ? 9.0
11 ? 9.7
R7ADtraR
–
–
–
–
5.1 ? 7.3
–
–
–
–
–
–
30 ? 10
R7ADtraI1
–
–
–
–
3.1 ? 4.4
–
–
–
–
–
–
21 ? 2.7
R7ADtraI1(pJRtraR)
–
–
–
–
45 ? 23
–
–
–
–
–
–
15 ? 15
R7ADtraI2*
7.3 ? 1.0
–
–
1.9 ¥ 102
? 2.6 ¥ 102
2.5 ¥ 102
? 3.3 ¥ 102
–
7.5
? 1.1 ¥ 102
21 ? 30
–
–
–
25 ? 1.4
R7ADtraI2*(pJRtraR)
1.8 ¥ 102
? 27
3.7 ¥ 103
? 1.3 ¥ 103
1.2 ¥ 102
? 12
6.1 ¥ 103
? 1.1 ¥ 103
4.8 ¥ 104
? 3.0 ¥ 103
3.8 ¥ 103
? 2.4 ¥ 103
7.2 ¥ 103
? 2.0 ¥ 103
1.0 ¥ 104
? 2.6 ¥ 103
4.3 ¥ 102
? 1.0 ¥ 102
2.8 ¥ 102
? 3.3 ¥ 102
24 ? 23
–
R7ANS
–
–
–
–
2.3 ? 3.2
–
–
–
–
–
2.4 ? 3.4
13 ? 18
a. The data presented are the average and standard deviation of results from two independent experiments. For each experiment, sample data were calculated by averaging LC-MS/MS data from
three extractions, each from 8 ml of culture, and normalizing to individual reference standards after taking into account extraction efficiencies.
0.0010.01 0.1
1
10 1001000
200
400
600
800
1000
1200
1400
1600
nM 3-oxo-C -HSL
6
ß-galactosidase (Miller Units)
Fig. 3. Transcriptional response of the traI1 promoter to
3-oxo-C6-HSL in the presence or absence of plasmid-borne traR.
Filled circles, R7AtraI1::lacZ(pJRtraR); filled triangles,
R7AtraI1::lacZ(pFAJ1700). Cultures were grown in TY medium in
the presence of the indicated concentration of 3-oxo-C6-HSL for
48 h and washed cells then assayed for b-galactosidase activity,
expressed as Miller units. The mean values of two to four
replicates together with the standard errors are shown.
Regulation of ICEMlSymR7Aexcision
1145
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 6

of the traI1 expression plasmid pJRtraI1E was tested.
Strain R7A (pJRtraI1E) induced a similar violacein pro-
duction response in CV026 as R7A(pJRtraR) (data not
shown), indicating increased production of AHLs as
expected. However, excision only increased to approxi-
mately 1% in exponential phase and to less than 50% in
stationary phase, compared with the 100% excision
induced by pJRtraR in both growth phases (Fig. 2A). The
analogous plasmid containing traI2, pJRtraI2E, had no
effect on excision (data not shown). These results suggest
that an additional barrier must be overcome before AHL-
dependent activation of excision by TraR occurs. As
pJRtraR induced 100% excision of ICEMlSymR7A, the
presence of extra copies of traR and its upstream
sequence must overcome this barrier.
Mapping of the traI2 promoter
Directly downstream of traI2 are two ORFs msi172 and
msi171 in the same orientation that both encode con-
served hypothetical proteins (Fig. 4B). As there are few
nucleotides between each of the genes, it seemed likely
that traI2-msi172-msi171 formed an operon. To test this,
RNA was extracted from R7ADmsi170 [a strain with an
identical phenotype to R7A(pJRtraR) with respect to exci-
sion and AHL production; our unpublished data] and
cDNA synthesized using a primer (msi171SP1, Table S1)
specific for the 3′ end of msi171. PCR was carried out on
the resulting cDNA using primers specific for the 5′ end of
traI2 and a nested primer within the 3′ end of msi171
(Table S1,I2IPTGFand
Sequence analysis of the resulting PCR product con-
firmed that it contained all three ORFs and hence that the
three genes formed an operon.
An alignment of the DNA sequences upstream of traI1
and traI2 revealed the presence of an imperfect inverted
repeat upstream of each gene, which partially aligned with
msi171SP2 respectively).
the Ti plasmid tra-box half-site ‘ATGTGCAGA’ (Fuqua and
Winans, 1996; Pappas and Winans, 2003), offset by one
nucleotide (Fig. 4A). No other potential tra-boxes were
identified on ICEMlSymR7A. The tra-box elements that bind
TraR on the Ti plasmid are centred approximately 63 or
43 bp upstream of the transcriptional start site. To map the
transcriptional start site of the traI2-msi172-msi171
operon,thecDNA from
(extended from primer msi171SP1) was used in a
5′RACE experiment, using a primer complementary to
traI2. Sequencing of the PCR product revealed that the
transcriptional start site was located in the intergenic
region between traR and traI2, 44 bp downstream of the
centre of tra-box2 (Fig. 4A), consistent with this DNAmotif
being a tra-box-like element. These and the data
described above strongly suggest that TraR complexed
with a C6 or C8 AHL species activates transcription of the
traI2-msi172-msi171 operon by binding to tra-box2.
theprevious experiment
TraR-activated excision requires msi171 and msi172
The above results suggested that expression of the traI2-
msi172-msi171 operon was regulated by TraR but did not
require TraI2. Furthermore, the traI2 transcriptional start
site was mapped to 1 bp upstream of the start of the
deletion in strain R7ADtraI2* (Fig. 4A), suggesting that the
deletion may affect expression of the operon. These
observations, together with the lack of complementation
by traR and/or traI2 of the excision phenotypes in
R7ADtraI2* and the wild-type phenotypes of R7ADtraI2,
suggested that the R7ADtraI2* phenotypes may be due to
the loss or reduction of expression of the msi171 or
msi172 genes rather than deletion of the traI2 gene. To
test this idea, a cosmid pUT11G that contains the entire
traR-msi171 region plus flanking DNAwas introduced into
R7A and R7ADtraI2*. Both strains R7A and R7ADtraI2*
containing pUT11G showed close to 100% ICEMlSymR7A
traI2 CCTGTGCAAATGCACAGGCAGTCGCGGCATGAAGGTTCGCCTCCAATGGCAGGGT-CATA-CCTGCGAGGAGACCATC-ATG
traI1 GCTGTAAACGTCTACAGGCTGCATCGCTGTGCGCTTTGCCCTTCGATGGC-GGGAACACAACCCGCACGGAGGCGACGAATG
+1
traRmsi172 msi171traI2
1 kb
tra-box
B
A
Beginning of R7A∆traI2* deletion
Fig. 4. Genetic organization and transcription of traI2, msi172 and msi171.
A. A manual alignment of the DNA sequence upstream of the traI1 and traI2 coding sequences (start codon shown in bold italics). An inverted
repeat resembling the tra-box binding motif is indicated by inward facing arrows and nucleotides matching the Ti plasmid tra-box are shown in
bold (note that the match to the Ti plasmid consensus is offset by one nucleotide). Also indicated are the transcriptional start site (+1) and the
start point of the deletion in strain R7ADtraI2*.
B. Genetic organization of the traR-msi171 gene cluster.
1146
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 7

excision, indicating that the cosmid restored excision in
R7ADtraI2* (Fig. 5). The high levels of excision presum-
ably reflect the presence of traR on pUT11G.
In-frame deletion mutants of msi171 and msi172 were
therefore constructed and analysed for excision of
ICEMlSymR7A.TheattP/attB
detected sporadically (once in six independent experi-
ments) at less than 0.02% in DNA extracted from either
R7ADmsi172 or R7ADmsi171 in exponential or stationary-
phase cultures (Fig. 5 and data not shown), demonstrat-
ing that deletion of either gene nearly abolished excision.
Next, pJRtraR was introduced into these mutants and the
resulting strains analysed by QPCR and CV026 bioassay.
Both mutants containing pJRtraR induced violacein pro-
duction in CV026 similarly to R7A(pJRtraR) (Fig. 1B), but
ICEMlSymR7Aexcision products were again only present
sporadically (once from three experiments) below 0.06%
(Fig. 5 and data not shown).
Cosmid pUT11G was then introduced into strains
R7ADmsi172 and R7ADmsi171. Strains R7ADmsi172
(pUT11G) (data not shown) and R7ADmsi171(pUT11G)
showed close to 100% excision of ICEMlSymR7Aas found
for R7A(pUT11G) (Fig. 5), indicating that the cosmid
complemented the defect
pNJmsi172E and pNJmsi171E containing msi172 and
msi171 downstream of a constitutive nptII promoter were
then introduced into both mutants. QPCR analysis of
these strains revealed that pNJmsi171E complemented
the mutation in strain R7ADmsi171 (Fig. 5); however,
pNJmsi172E did not complement the msi172 mutation
(data not shown), suggesting that this mutation may have
ampliconswere only
in excision.Plasmids
a polar effect on msi171 or that Msi171 and Msi172 were
produced in a non-functional stoichiometry in the strain. A
plasmid expressing both msi172 and msi171 from the
nptII promoter was also constructed, but this plasmid
could not be introduced into R7A or the mutants using
either electroporation or biparental mating. In summary,
these data suggested that mutation of msi171 and likely
also msi172 prevents excision irrespective ofAHLproduc-
tion, indicating that TraR controls excision through activa-
tion of msi172-msi171 expression.
Effects of pJRtraR and various mutations on conjugative
transfer of ICEMlSymR7A
The abilities of R7Aand the various mutant strains, with or
without pJRtraR, to transfer ICEMlSymR7Ato the non-
symbiotic M. loti strain N18 were determined (Table 2).
Strain R7A transferred ICEMlSymR7Aat a frequency per
donor of about 4 ¥ 10-5, while transfer from R7A(pJRtraR)
occurred at an approximately 40-fold higher frequency.
Transfer of ICEMlSymR7Afrom R7ADtraR to strain N18
was below the detection limit of 1 ¥ 10-8transconjugants
per donor, indicating that traR was required for conjuga-
tive transfer despite the mutant showing some excision.
Transfer from R7ADtraI1 was detected at a low frequency
that was not increased by the presence of pJRtraR.
Strains R7ADtraI2 and R7ADtraI2(pJRtraR) transferred
ICEMlSymR7Aat similar levels to R7A and R7A(pJRtraR),
respectively, whereas transfer from R7ADtraI2* was not
detected irrespective of the presence of pJRtraR. Neither
R7ADmsi171 nor R7ADmsi172 transferred ICEMlSymR7A
Fig. 5. Excision of ICEMlSymR7Ain R7ADmsi171 and strains containing pUT11G. QPCR of DNA templates attP and attB was used as a
measure of ICEMlSymR7Aexcision relative to the chromosome population detected by QPCR of melR. Percentage attP and attB at 24 h
(exponential growth) are shown by black and white bars respectively, while percentage attP and attB at 64 h (stationary phase) are shown by
black bars/white hatching and white bars/black hatching respectively. Data presented are the average of at least two independent experiments
(error bars represent ? 1 standard deviation). Individual QPCR measurements are the mean of triplicate reactions for each amplicon. Asterisks
indicate samples with significant deviation from the wild-type data (*P < 0.05, **P < 0.01). Amplicons from R7ADmsi171 and
R7ADmsi171(pJRtraR) samples were only detected once or not at all.
Regulation of ICEMlSymR7Aexcision
1147
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 8

in the absence of pJRtraR while a very low level of trans-
fer was detected from R7ADmsi172 but not R7ADmsi171
in the presence of pJRtraR. With the exception of the
result with R7ADtraR, these results are consistent with
those obtained using the excision assay, confirming that
conjugative transfer of ICEMlSymR7Ais inherently linked
with excision.
Msi172 and Msi171 homologues are encoded on a
large family of putative ICEs
The msi172 and msi171 genes encode 82- and 179-
amino-acid proteins respectively, and BLASTP analyses
indicated that they showed similarity to proteins of
unknown function, with Msi171 belonging to COG5419.
Previously,itwas shown
ICEMlSymR7Aencode proteins with similarity to those con-
served on the genomic island Tn4371 and related ele-
ments (Toussaint et al., 2003; Ramsay et al., 2006). A
search for proteins resembling Msi172 and Msi171 on
Tn4371 identified a single protein RO0034, which
resembled a fused product of Msi172 and Msi171 in that
order. The RO0034 protein is conserved on a number of
elements closely related to Tn4371 (Toussaint et al.,
2003). Further BLASTP analyses of Msi172 and Msi171
revealed the presence of homologues of Msi172 and/or
Msi171 encoded as single or separate ORFs in a
large number other proteobacterial species, including
most of the species identified by Ramsay et al. (2006)
as carrying homologues of RdfS. Interestingly, TraR/TraI
homologues were only found upstream of msi172/171
in M. loti MAFF303099 (ICEMlSymMAFF; NC_002678)
and on a putative ICE in Sphingomonas sp. SKA56
(NZ_AAQG01000007.1).
thatseveralgenes on
Discussion
In this study, we showed that excision of ICEMlSymR7Ain
M. loti was induced in 100% of cells upon introduction of
pJRtraR, a low-copy-number plasmid that carries a cloned
copy of the traR gene including its native promoter region.
The plasmid also caused a 1000-fold increase in the
production of 3-oxo-C6-HSLand concomitant increases in
several other C6 and C8 AHLs, and a 40-fold increase in
conjugation frequency. The increases in excision, AHL
production and conjugation were dependent on the
ICEMlSymR7A-encodedAHLsynthase gene traI1. Excision
and conjugal transfer of ICEMlSymR7Arequired the con-
served hypothetical genes msi172 and msi171 that are
part of a traI2-msi172-msi171 operon that is transcribed
from a TraR-regulated promoter, thus placing excision and
conjugation under N-acyl homoserine lactone-mediated
regulation.Homologuesofmsi172andmsi171arepresent
on a large family of putative genomic islands but in most
cases are not associated with traR or traI homologues.
Expression of traI1 in E. coli and M. loti R7ANS con-
ferred the ability to induce violacein production in strain
CV026 on these strains, indicating that traI1 encodes a
functional AHL synthase that is consistent with its require-
ment for both pJRtraR-mediated phenotypes. In contrast,
our experiments did not reveal a role for the second
putative AHL synthase-encoding gene traI2. Strain
R7ADtraI2 had the same phenotype as strain R7A with
respect to excision andAHL production. It also responded
in the same manner as R7A to the presence of plasmid-
borne traR. Finally constitutive expression of traI2 in
either E. coli or M. loti R7A or R7ANS did not lead to
CV026-detectable AHL production. Similar results with
respect to production of 3-oxo-C6-HSL production by
TraI1 and no detectable AHL production by TraI2 both in
M. loti and when overexpressed in E. coli were recently
found for orthologous proteins in M. loti strain NZP2213
(Yang et al., 2009). Nevertheless, the predicted traI1 and
traI2 gene products share 65% identity and are more
similar to each other than to any homologues from other
organisms. Hence, it seems possible that traI1 and traI2
arose from a gene duplication event or independent
acquisition from a common source and that traI2 subse-
quently became a pseudogene. However, CDD analysis
(Marchler-Bauer et al., 2007) indicates that TraI2 contains
all 16 residues that are invariant in the 13 members of
pfam00765 (autoinducer synthetases). Hence, it remains
possible that traI2 plays an as yet undetected role in AHL
production and the regulation of excision. Recent studies
have revealed that the variety of acyl-HSL signals synthe-
sized by LuxI homologues is greater than previously
appreciated (Krick et al., 2007; Schaefer et al., 2008). It is
therefore possible that TraI2 produces molecules that
were not detected by the assays used in this study.
Table 2. Transfer frequency of ICEMlSymR7Afrom R7A and QS
mutant strains with or without pJRtraR.
Donor strainRecipient strainTransfer frequencya
R7A
R7ADmsi171
R7ADmsi172
R7ADtraI1
R7ADtraI2
R7ADtraI2*
R7ADtraR
R7A
R7A(pJRtraR)
R7ADmsi171(pJRtraR)
R7ADmsi172(pJRtraR)
R7ADtraI1(pJRtraR)
R7ADtraI2(pJRtraR)
R7ADtraI2*(pJRtraR)
R7ADtraR(pJRtraR)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pFAJ1700)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
N18 (pPROBE-KT)
4.45 ¥ 10-5
< 1 ¥ 10-8
< 1 ¥ 10-8
1.63 ¥ 10-6
1.06 ¥ 10-5
< 1 ¥ 10-8
< 1 ¥ 10-8
3.14 ¥ 10-5
1.12 ¥ 10-3
< 1 ¥ 10-8
5.05 ¥ 10-7
1.04 ¥ 10-7
6.96 ¥ 10-3
< 1 ¥ 10-8
9.49 ¥ 10-4
a. Expressed as the average number of transconjugants per donor
from two experiments.
1148
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 9

The two traI-containing operons on ICEMlSymR7Awere
both positively regulated by TraR as shown by reporter
gene assays, and both contained an inverted repeat in
their promoter regions that resembled the consensus of
tra-boxes found in promoter regions of QS-regulated
operons on the A. tumefaciens Ti plasmid and pRL1JI of
R. leguminosarum that are binding sites for TraR (Fuqua
and Winans, 1996; Pappas and Winans, 2003; McAnulla
et al., 2007). The sequence upstream of traI2 (tra-box2)
was centred 45 bp upstream of the determined transcrip-
tional start site of the traI2-msi172-msi171 operon, an
almost identical positioning to the Ti plasmid and pRL1JI
tra-boxes. It is likely that the transcriptional start site of
traI1 is in an analogous position relative to tra-box1. As
no other tra-box matches were found on ICEMlSymR7A,
TraR may directly mediate activation of only traI1 (auto-
induction) and the traI2 operon. The increased produc-
tion of AHLs in the DtraI2* mutant (in the presence and
absence of pJRtraR) compared with analogous R7A
strains was dependent on traI1 and may therefore reflect
increased traI1 transcription. This may reflect a greater
availability of TraR in the DtraI2* mutant cells due to it
not being sequestered for traI2 operon transcription,
implying that the amount of TraR in the cell is limiting for
transcription.
Our previous finding that excision of ICEMlSymR7Ais
increased in stationary-phase broth cultures led us to
propose a model in which excision is upregulated in
response to increased population density through QS
(Ramsay et al., 2006). However, our current results show
that deletion of either traR or traI1 only slightly reduced
the proportion of cells containing excised ICEMlSymR7A
and that excision still appeared to be upregulated in sta-
tionary phase cultures. Despite this, strain R7ADtraR
showed extremely reduced levels of conjugative transfer
compared with R7A. Furthermore, the traI2-msi172-
msi171 and traI1 operons were expressed at most at a
very low level (< 8 Miller units) in the absence of pJRtraR,
despite msi172 and msi171 being required for excision.
These results suggest that ICEMlSymR7Aexcision may be
under dual regulation with a mechanism other than QS
being at least partly responsible for the growth phase
response and the excision seen in cultures of R7A. The
abolition of ICEMlSymR7Atransfer in the DtraR mutant
suggests that the level of msi171/172 expression in these
cells is insufficient to induce all operons required for trans-
fer, although it is sufficient to allow some excision. The low
basal level of transfer observed with R7A under the con-
ditions used suggests that TraR may be activated in only
a small percentage of cells, the activation possibly being
an effect of stochastic processes.
A striking result was that expression from the traI1
promoter was fully induced in a traI1 mutant background
by supplying cells with exogenous 3-oxo-C6-HSL but only
when the strain carried a plasmid with a cloned copy of
traR. In the presence of pJRtraR, close to full induction
was obtained with as little as 100 pM 3-oxo-C6-HSL,
which equates to about one molecule of AHL per cell (Su
et al., 2008), indicating maximal signal sensitivity and
hence that very few molecules of TraR-3-oxo-C6-HSL are
required for full activation. In contrast, in the absence of
pJRtraR only weak induction of traI1 expression, to a level
about 5% of that in the presence of pJRtraR, was
observed in the presence of 1 nM 3-oxo-C6-HSL and no
further induction was observed even with 1 mM 3-oxo-C6-
HSL. These results strongly suggest that in the absence
of additional copies of traR, the amount of TraR in the cell
is very low and limits the transcriptional response irre-
spective of the quantity of AHL signal present. Consistent
with this, only a moderate increase in excision of
ICEMlSymR7Awas observed in strain R7A(pJRtraI1E) that
carries traI1 fused to an IPTG-inducible promoter. This
strain exhibited an elevated level of AHL production,
similar to or greater than that produced by R7A(pJRtraR)
that maintains ICEMlSymR7Ain excised form in 100% of
cells. The effects of pJRtraR must be manifested by
increased TraR production either at the level of traR tran-
scription or TraR translation or function. It is unlikely that
the cloned traR gene in pJRtraR is expressed from a
vector promoter, resulting in deregulated expression, as
the pFAJ1700 vector multiple cloning site is protected
against read-through transcriptional activity of vector
sequences by the trpA transcriptional terminator (Dom-
brecht et al., 2001), and similar results were obtained with
the complementing cosmid pUT11G. Taken together, the
above results indicate that there are additional as yet
unidentified factors regulating excision, both with respect
to the response of TraR to AHLs and with respect to
growth phase.
Whether the traR gene on ICEMlSymR7Ais regulated at
the transcriptional level is currently unknown. The expres-
sion of traR on plasmid pRL1JI of R. leguminosarum
requires activation by a second LuxR-family protein BisR,
which is activated by 3-OH-7-cis-C14:1-HSL (Danino et al.,
2003), whereas the expression of traR on the Agrobacte-
rium Ti plasmids requires activation or derepression by a
transcriptional regulator in response to opines produced
by crown gall tumours (Fuqua and Winans, 1994; Piper
et al., 1999; White and Winans, 2007). Several LuxR and
LuxI homologues are present in the sequenced M. loti
strain MAFF303099 (Kaneko et al., 2000), which is
closely related to R7A. It is possible that homologues of
these proteins in strain R7Ainteract with the ICEMlSymR7A
QS system. Indeed, the LC-MS/MS data showed that
M. loti strain R7A produces very low amounts of 3-oxo-
C12-HSL and Yang et al. (2009) have shown that this
production is due to a conserved AHL synthase encoded
on the M. loti chromosome.
Regulation of ICEMlSymR7Aexcision
1149
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 10

Both Ti plasmids and pRL1JI also encode the QS anti-
activator TraM (Fuqua et al., 1995; Hwang et al., 1995;
Danino et al., 2003), which directly inhibits TraR through
protein–protein interactions (Chen et al., 2007; Qin et al.,
2007). In A. tumefaciens, the low level of TraR present
due to basal traR expression in the absence of opines is
prevented from prematurely activating Ti plasmid transfer
by TraM (Khan et al., 2008; Su et al., 2008). In the
absence of TraM, Ti plasmid conjugative transfer is maxi-
mally induced by 100 pM acyl-HSL signal, the theoretical
maximum sensitivity given that each TraR dimer requires
two signal molecules, and hence transfer is not respon-
sive topopulationcelldensity
ICEMlSymR7Adoes not contain a homologue of TraM nor
is a homologue present in the MAFF303099 genome.
However, it is possible that another protein may be an
antiactivator of QS and that the extra copies of traR on
pJRtraR result in sufficient TraR protein to overcome this
inactivation. As noted above, only very few molecules of
activated TraR and 3-oxo-C6-HSL are required for the
transcriptional response and so whether a particular cell is
able to activate ICEMlSymR7Aexcision and transfer may
depend on the relative levels of TraR and an antiactivator
in that cell. Further investigations into transfer events at
the single-cell level are required to fully understand both
the transfer mechanisms and evolutionary strategy of
ICEMlSymR7Aand related mobile elements.
Our data showed that msi172 and msi171 are required
for excision of ICEMlSymR7A. The translated products of
these genes have no matches to other proteins in the
databases apart from hypothetical proteins. In each case,
the Msi172/171 homologues are encoded near genes
encoding homologues of the ICEMlSymR7Arecombination
directionality factor RdfS. We have previously shown that
the presence of RdfS defines a large family of genomic
islands that are likely to have a conserved transfer
(Su et al.,2008).
mechanism (Ramsay et al., 2006). In some genomic
islands such as Tn4371 (Toussaint et al., 2003), the
Msi172/171 homologue is present as a single protein,
indicating that Msi172 and Msi171 are likely to function
cooperatively on a common target or targets. This is also
consistent with the phenotype of the mutated strains.
They are unlikely to be part of the nucleoprotein complex
required for excision as only the integrase IntS is required
along with RdfS for efficient excision of a mini-ICE in the
non-symbiotic strain R7ANS (Ramsay et al., 2006).
Neither protein has a known DNA-binding domain and
hence it seems likely that Msi172 and Msi171 exert a
regulatory effect through interaction with other proteins
conserved between the ICEMlSym genomic island family
members or possibly as RNA-binding proteins.
Most of the putative genomic islands containing
Msi172/171 homologues do not contain TraR/TraI homo-
logues, suggesting that the QS regulatory system has
been superimposed on an existing regulatory system
in a recent evolutionary event to allow regulation
of ICEMlSymR7Atransfer in response to autoinducer
molecules.As noted above, traI1 and traI2 probably arose
from a common source. We propose that traR-traI2 were
acquired upstream of msi172, and traI1 elsewhere on
ICEMlSymR7Aeither through a duplication event followed
by translocation or in a separate acquisition event. This
event would have allowed divergent evolution of the traI1
and traI2 loci and therefore permitted fine-tuning of AHL
production by TraI1 independently of TraR-activated exci-
sion of ICEMlSymR7Athrough expression of traI2-msi172-
msi171.
In summary, our data suggest the following model
(Fig. 6). Excision and transfer of ICEMlSymR7Aare abso-
lutely dependent on Msi171 and Msi172 and hence on
expression of the traI2-msi172-msi171 operon. This
operon is normally expressed at a low basal level that is
Fig. 6. Model for the regulation of
ICEMlSymR7Aexcision and transfer. See text
for details.
traI1
TraR
TraI1
3-oxo-C6-HSL
TraR(3-oxo-C6-HSL)
traRtraI2 172msi171
Msi171 (Msi172?)
rdfS traF msi107 rlxS
traG msi031trbB trbC trbD trbE trbJ
trbL trbF trbG trbI msi021
Repression?
Stimulation of excision, oriT
processing and transfer
Mating-pore formation
1150
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 11

insufficient to allow expression of the conjugative transfer
apparatus. Under some set of unknown conditions, the
level of TraR in at least some cells in the population rises
above a threshold level. This leads to activation of TraR
followed by autoinduction of traI1-dependent AHL produc-
tion and maximally induced expression of msi172-171.
Production of Msi172 and Msi171 leads to stable expres-
sion of the conjugative apparatus as well as excision.
Future work will focus on determining the mechanism of
action of Msi172/Msi171 in activating excision as well as
identifying the factors that regulate traR expression or
TraR function, and the factors that lead to the growth
phase dependence of excision in cultures of the wild-type
strain and traR and traI1 mutants.
Experimental procedures
Bacteria, plasmids and growth conditions
The bacterial strains and plasmids used in this study are
listed in Table 3. Mesorhizobium strains were cultured at
28°C in either TY or RDM media with 10 mM glucose
(G/RDM) as described (Ramsay et al., 2006). E. coli strains
were cultured at 37°C in either 2YT medium or TY.
C. violaceum strain CV026 was cultured at 28°C in either LB
or TY medium. Media were supplemented with antibiotics
where required at the following concentrations: for E. coli
50 mg ml-1kanamycin, 12.5 mg ml-1tetracycline, 100 mg ml-1
ampicillin,25 mg ml-1
gentamicin;
2.0 mg ml-1tetracycline, 200 mg ml-1neomycin, 50 mg ml-1
gentamicin, 200 mg ml-1streptomycin. When required, media
formesorhizobia
Table 3. Bacterial strains and plasmids.
Strain/plasmidDescription Source or reference
Mesorhizobium
N18
R7A
R7ANS
R7ADmsi171
R7ADmsi172
R7ADtraI1
R7ADtraI2
R7ADtraI2*
Nonsymbiotic Mesorhizobium strain; field isolate
Field reisolate of ICMP 3153; wild-type symbiotic strain
Non-symbiotic derivative of R7A; lacks ICEMlSymR7A
Dmsi171; markerless in-frame deletion mutant
Dmsi172; markerless in-frame deletion mutant
DtraI1 (Dmsi039); markerless in-frame deletion mutant
DtraI2 (Dmsi173); markerless in-frame deletion mutant
DtraI2 (Dmsi173) mutant containing a markerless deletion of traI2 and 22 bp
of upstream sequence
DtraI2*DtraI1 double mutant
DtraR (Dmsi174); markerless in-frame deletion mutant
pFUS2 insertion duplication mutant; traI1 transcriptionally fused to lacZ
pFUS2 insertion duplication mutant; traI2 transcriptionally fused to lacZ
Ramsay et al. (2006)
Sullivan et al. (1995)
Ramsay et al. (2006)
This study
This study
This study
This study
This study
R7ADtraI2*DtraI1
R7ADtraR
R7AtraI1::lacZ
R7AtraI2::lacZ
E. coli
DH10B
This study
This study
This study
This study
F-, mcrA D(mrr-hsd RMS-mrcBC) (F80lacZDM15) DlacX74 deoR endA1
araD139 D(ara, leu)7697 galU galK l-rspL nupG
TpRSmRrecA thi pro hsdR-M+recA::RP4-2-Tc::Mu Km::Tn7 lpir
Grant et al. (1990)
S17-1 lpir
C. violaceum
CV026
Plasmids
pFAJ1700
pFAJ1708
pFUS2
pJQ200SK
pTH1227
pJRtraI1
pJRtraI1E
pJRtraI2
de Lorenzo et al. (1993)
cviI::mini-Tn5 derivative of ATCC 31532, KmR, AHL-
McClean et al. (1997)
Broad-host-range vector, oriVRK2TcR
Broad-host-range expression vector, PnptII oriVRK2TcR
oriVColE1oriTRK2lacZ transcriptional reporter; suicide vector, GmR
Suicide vector containing sacB gene, GmR
Broad-host-range plasmid containing lacIq-Ptac cassette, TcR
pFAJ1700 containing traI1 (XbaI fragment) and upstream intergenic sequence
pTH1227 carrying traI1 cloned downstream of lacIq-Ptac promoter
pFAJ1700 containing the overlap-extension PCR product used to create
R7ADtraR cloned as an XbaI fragment. Contains traI2 and DNA upstream
of traI2 and traR
pTH1227 carrying traI2 cloned downstream of lacIq-Ptac promoter
pFAJ1700 containing traR (BamHI fragment) amplified by PCR from pJR206
pUC8 containing PCR products spanning attP, attB and a region of melR,
linearized and used as a positive template control for QPCR reactions
and standard curves
pFAJ1700 containing traRtraI2 and upstream intergenic DNA
pFAJ1708 with msi171 cloned downstream of nptII promoter
pFAJ1708 with msi172 cloned downstream of nptII promoter
Broad-host-range vector, oriVpVS1oriVp15aNmR
Broad-host-range pIJ3200-based cosmid from R7A library; contains DNA
corresponding to nucleotides 198895 to 221662 of ICEMlSymR7A(msi163 to msi184)
Dombrecht et al. (2001)
Dombrecht et al. (2001)
Antoine et al. (2000)
Quandt and Hynes (1993)
Cheng et al. (2007)
This study
This study
This study
pJRtraI2E
pJRtraR
pJR201
This study
This study
Ramsay et al. (2006)
pJR206
pNJmsi171E
pNJmsi172E
pPROBE-KT
pUT11G
Ramsay et al. (2006)
This study
This study
Miller et al. (2000)
U. Sharma, this lab
Regulation of ICEMlSymR7Aexcision
1151
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 12

were supplemented with 0.1 mM or 1 mM IPTG for M. loti or
E. coli cultures respectively.
Strain and plasmid constructions
Primers used in this study are described in Table S1. Plas-
mids were introduced into E. coli and M. loti strains either by
biparental matings using E. coli S17-1 donor strains or by
electroporation, as previously described (Ramsay et al.,
2006). To construct the markerless in-frame deletion mutants,
overlap extension PCR was first used to create the deletions.
For each gene to be deleted, approximately 1 kb of DNA
flanking each side of the deletion was amplified by PCR using
a 5′ flanking primer and a reverse overlap primer or a forward
overlap primer and a 3′ flanking primer (see Table S2 for
arrangement of the primers). The two purified PCR products
were then used as templates in a PCR reaction containing
the 5′ and 3′ flanking primers. The purified PCR product from
this reaction was cloned into pJQ200SK as an XbaI fragment,
and the M. loti mutants then constructed using the allelic
replacement strategy previously described for the construc-
tion of R7ADrdfS (Ramsay et al., 2006). The deletions in each
mutant strain were confirmed by PCR and sequence
analysis.
Strains R7AtraI1::lacZ and R7AtraI2::lacZ were con-
structed by insertion duplication mutagenesis using the
suicide plasmid pFUS2. An internal region of each gene was
amplified by PCR using primers traiI1pfusL and traiIpfusR for
traI1 and trai2pfusL and trai2pfusR for traI2 (Table S1). The
PCR products were cloned into pFUS2 as HindIII/Asp718
(traI1) and HindIII/BamHI (traI2) fragments and the resultant
plasmids transferred into R7A by conjugation. Transconju-
gants were confirmed via Southern hybridization by probing
successively with pFUS2 and the PCR products used to
construct the mutants.
For construction of pJRtraI1, a 1.4 kb region containing
traI1 and upstream intergenic DNA was amplified by PCR
(primers traI1clone5 and traI1clone3) and cloned into
pFAJ1700 as an XbaI fragment. pJRtraR was constructed by
amplifying an 1.4 kb region containing traR and upstream
intergenic DNA by PCR (primers traRI2BamHI5 and traR-
BamHI3) and cloning into pFAJ1700 as a BamHI fragment.
The plasmid pJRtraI2 was constructed by subcloning the
overlap extension PCR product used to construct R7ADtraR
from pJQ200SK as an XbaI fragment into pFAJ1700. To
create plasmids expressing the traI1 or traI2 gene from an
IPTG-inducible promoter, each ORF was amplified by PCR
using primer pairs I1IPTGF and I1IPTGR or I2IPTGF and
I2IPTGR respectively, and cloned into pTH1227 as a XbaI-
HindIII or XbaI-PstI fragment, producing plasmids pJRtraI1E
and pJRtraI2E. To construct plasmids that expressed msi171
or msi172 from the constitutive nptII promoter, the msi171
andmsi172genes were
primers msi171FAJ08Land
or msi172FAJ08L and msi172FAJ08R (msi172). Primers
msi171FAJ08L, and msi172FAJ08L which anneal to the 5′
ends of the genes, contained stops in all three frames pre-
ceding a synthetic ribosome-binding site. The PCR products
were digested with XbaI and Asp718 and then cloned into
pFAJ1708 adjacent to the nptII promoter. All plasmid con-
structs were confirmed by DNA sequencing.
amplified
msi171FAJ08R
byPCR using
(msi171)
Cosmid pUT11G was isolated from a pIJ3200 library of
R7A genomic DNA (Sullivan and Ronson, 1998) by PCR
screening and end-sequenced using T3 and T7 primers to
determine its content (U. Sharma, pers. comm.).
DNA manipulations and sequence analysis
Mesorhizobium DNA was prepared as described previously
(Ramsay et al., 2006). PCR products were amplified using
the Phusion High-Fidelity PCR kit (Finnzymes) and purified
using the High-Pure PCR product purification kit (Roche).
Southern hybridizations and DNA sequencing were carried
out as described (Ramsay et al., 2006). Sequence compari-
sons with the NCBI nr database or RhizoBase (http://
bacteria.kazusa.or.jp/rhizobase/)
BLAST tools (Altschul et al., 1997). Sequence alignments were
carried out as described (Chen et al., 2007). The tra-box1
and tra-box2 motifs were initially identified by visual inspec-
tion, after which the sequences were used to create a motif
pattern using the online MEME tool (Bailey et al., 2006),
which was then used in a MAST search (Bailey and Gribskov,
1998) against the ICEMlSymR7Asequence to search for addi-
tional tra-boxes. No additional matches were identified.
wereperformed using
Quantitative PCR assays for excision
To quantify the attP and attB products of ICEMlSymR7Aexci-
sion, DNA was extracted from cell cultures at 24 h (exponen-
tial phase) or 64 h (stationary phase) and analysed by QPCR
as described previously (Ramsay et al., 2006). All data pre-
sented are the average of at least two biological replicates
and three QPCR replicates each sample.
RNA isolation, reverse transcriptase-PCR and 5-prime
RACE analysis
Mesorhizobium loti G/RDM cultures were grown to an OD600
of 0.4–0.6 and 8 ml culture was then added to 10 ml of boiling
lysis buffer [2% SDS, 30 mM NaAc (pH 5.5), 3 mM EDTA],
mixed thoroughly and incubated at 100°C for 3 min. Protein,
genomic DNAand other material were then removed from the
aqueous phase by thorough mixing with two 16 ml volumes of
acidified phenol (65°C), one 16 ml volume of Tris-equilibrated
phenol and one 16 ml volume of chloroform. Nucleic acids
were then precipitated with 2 vols of ethanol, after which
pellets were washed with 10 ml 70% ethanol and suspended
in 1 ml of DEPC-treated H2O containing 400 U of Invitrogen
RNaseOUT. Samples were then treated with Ambion TURBO
DNase and applied to Qiagen RNeasy columns as per manu-
facturer’s instructions. DNAwas still present in these samples
(detected by PCR using primers I2IPTGF and msi171SP1)
and so samples were treated a second time with DNase and
applied to a second RNeasy column that produced DNA-free
RNA samples.
A Roche 5′/3′ RACE second-generation kit was used to
map the transcriptional start site of traI2-msi172-msi171 as
per the manufacturer’s instructions. The primers msi171SP1,
traI2SP1 and traI2SP2 correspond to specific primers SP1,
SP2 and SP3, respectively, as referred to in the kit
1152
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 13

instructions. A single PCR product was obtained in both the
first and second rounds of PCR amplification and so this PCR
product was sequenced directly without cloning, using primer
traI2SP2.
Extraction of N-acyl homoserine lactones
Broth cultures of M. loti strains were grown in 50 ml of
G/RDM for 64 h. Aliquots (8 ml) of supernatant from each
culture were passed through 0.45 mm Millipore filters and
extracted twice with equal volumes of dichloromethane
(McClean et al., 1997). Extracts were then evaporated to
dryness in a vacuum centrifuge and resuspended in 50 ml
methanol.
CV026 bioassay
For analysis of M. loti AHL production, the AHL-sensitive bio-
assay strain C. violaceum CV026 (McClean et al., 1997) was
used either in agar overlays or streaked adjacent to M. loti
cultures on TY plates. TY broth cultures of M. loti were grown
for 64 h at 28°C, after which 10–20 ml of culture was spotted
onto a 20-cm-diameter TY agar plate and incubated for either
24 or 48 h. For overlays, a 100 ml LB broth was inoculated
from an overnight culture of CV026 and incubated overnight
at 28°C. One hundred millilitres of molten LB agar cooled to
40°C was mixed with the CV026 culture and quickly applied
to the agar plate. For streak-plate assays, a loopful of CV026
from an overnight LB agar plate culture was streaked adja-
cent to the M. loti culture. The resulting plate was then incu-
bated overnight at 28°C.
LC-MS/MS of M. loti AHLs
Liquid chromatography was carried out on a Shimadzu series
10AD VP LC system fitted with a Phenomenex Gemini
C18 150 mm ¥ 2 mm (5 mm particle size) column that was
used at 45°C. Mass spectrometry was conducted using a
4000 QTRAP hybrid triple-quadrupole-linear ion trap mass
spectrometer (Applied Biosystems), with a TurboIon ion
source operating in positive ion mode. AHL molecules were
identified by comparison with spectra generated from syn-
thetic AHL standards using precursor ion triggered enhanced
product ion spectra. Detailed synthetic and analytical
methods and instrument settings are given in Chhabra et al.
(1993; 2003) and Ortori et al. (2007). Quantification relative
to AHL calibration standards was performed using multiple
reaction monitoring (Gould et al., 2006; C. Ortori, et al., in
preparation). The lower limit of quantification for each AHL
molecule was 5 pmol per sample.
b-Galactosidase assays
b-Galactosidase assays were performed on washed cells
from M. loti TY broth cultures grown to stationary phase, as
described (Miller, 1972). AHLs were added to broths at the
time of inoculation where required.
Conjugative transfer of ICEMlSymR7A
Matings for transfer of ICEMlSymR7Ato non-symbiotic M. loti
strain N18 were carried out as previously described (Sullivan
and Ronson, 1998), except that the recipient strain contained
either pFAJ1700 (Dombrecht et al., 2001) or pPROBE-KT
(Miller et al., 2000) and either tetracycline or neomycin was
included in the medium to counterselect the donor.
Acknowledgements
J.P.R. thanks the University of Otago for a PhD scholarship
and for an Elman Poole Travelling Scholarship. We thank
Gabriella Stuart for carrying out some of the conjugation
experiments, Utsav Sharma for providing pUT11G, and Alex
Truman and Siri Ram Chhabra for AHL synthesis. This work
was supported by a grant from the Marsden Fund adminis-
tered by the Royal Society of New Zealand.
References
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J.,
Zhang, Z., Miller, W., and Lipman, D.J. (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein data-
base search programs. Nucleic Acids Res 25: 3389–3402.
Antoine, R., Alonso, S., Raze, D., Coutte, L., Lesjean, S.,
Willery, E., et al. (2000) New virulence-activated and
virulence-repressed genes identified by systematic gene
inactivation and generation of transcriptional fusions in Bor-
detella pertussis. J Bacteriol 182: 5902–5905.
Bailey, T.L., and Gribskov, M. (1998) Combining evidence
using p-values:application
searches. Bioinformatics 14: 48–54.
Bailey, T.L., Williams, N., Misleh, C., and Li, W.W. (2006)
MEME: discovering and analysing DNA and protein
sequence motifs. Nucleic Acids Res 34: W369–W373.
Binnewies, T.T., Motro, Y., Hallin, P.F., Lund, O., Dunn, D.,
La, T., et al. (2006) Ten years of bacterial genome
sequencing:comparative-genomics-based
Funct Integr Genomics 6: 165–185.
Burrus, V., and Waldor, M.K. (2004) Shaping bacterial
genomes with integrative and conjugative elements. Res
Microbiol 155: 376–386.
Burrus, V., Pavlovic, G., Decaris, B., and Guédon, G. (2002)
Conjugative transposons: the tip of the iceberg. Mol Micro-
biol 46: 601–610.
Chen, G., Jeffrey, P.D., Fuqua, C., Shi, Y., and Chen, L.
(2007) Structural basis for antiactivation in bacterial
quorum sensing. Proc Natl Acad Sci USA 104: 16474–
16479.
Cheng, J., Sibley, C.D., Zaheer, R., and Finan, T.M. (2007) A
Sinorhizobium meliloti minE mutant has an altered mor-
phology and exhibits defects in legume symbiosis. Micro-
biology 153: 375–387.
Chhabra, S.R., Stead, P., Bainton, N.J., Salmond, G.P.,
Stewart, G.S., Williams, P., and Bycroft, B.W. (1993) Auto-
regulation of carbapenem biosynthesis in Erwinia caroto-
vora by analogues of N-(3-oxohexanoyl) -L-homoserine
lactone. J Antibiot (Tokyo) 46: 441–454.
Chhabra, S.R., Harty, C., Hooi, D.S., Daykin, M., Williams, P.,
Telford,G.,et al.(2003)Syntheticanaloguesofthebacterial
signal (quorum sensing) molecule N-(3-oxododecanoyl)-L-
homoserine lactone as immune modulators. J Med Chem
46: 97–104.
tosequence homology
discoveries.
Regulation of ICEMlSymR7Aexcision
1153
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 14

Danino, V.E., Wilkinson, A., Edwards, A., and Downie, J.A.
(2003) Recipient-induced transfer of the symbiotic plasmid
pRL1JI in Rhizobium leguminosarum bv. viciae is regulated
by a quorum-sensing relay. Mol Microbiol 50: 511–525.
Dobrindt, U., Hochhut, B., Hentschel, U., and Hacker, J.
(2004) Genomic islands in pathogenic and environmental
microorganisms. Nat Rev Microbiol 2: 414–424.
Dombrecht, B., Vanderleyden, J., and Michiels, J. (2001)
Stable RK2-derived cloning vectors for the analysis of gene
expression and gene function in gram-negative bacteria.
Mol Plant Microbe Interact 14: 426–430.
Frost, L.S., Leplae, R., Summers, A.O., and Toussaint, A.
(2005) Mobile genetic elements: the agents of open source
evolution. Nat Rev Microbiol 3: 722–732.
Fuqua, C., and Winans, S.C. (1996) Conserved cis-acting
promoter elements are required for density-dependent
transcription of Agrobacterium tumefaciens conjugal trans-
fer genes. J Bacteriol 178: 435–440.
Fuqua, C., Burbea, M., and Winans, S.C. (1995) Activity of
the Agrobacterium Ti plasmid conjugal transfer regulator
TraR is inhibited by the product of the traM gene.
J Bacteriol 177: 1367–1373.
Fuqua, W.C., and Winans, S.C. (1994) A LuxR-LuxI type
regulatory system activates Agrobacterium Ti plasmid con-
jugal transfer in the presence of a plant tumor metabolite.
J Bacteriol 176: 2796–2806.
Gould, T.A., Herman, J., Krank, J., Murphy, R.C., and
Churchill, M.E. (2006) Specificity of acyl-homoserine
lactone synthases examined by mass spectrometry.
J Bacteriol 188: 773–783.
Grant, G.S.N., Jessee, F.R., Bloom, F.R., and Hanahan, D.
(1990) Differential plasmid rescue from transgenic mouse
DNAs into Escherichia coli methylation-restriction mutants.
Proc Natl Acad Sci USA 87: 4645–4649.
Guy, L. (2006) Identification and characterization of pathoge-
nicity and other genomic islands using base composition
analyses. Future Microbiol 1: 309–316.
Hwang, I., Li, P.L., Zhang, L., Piper, K.R., Cook, D.M., Tate,
M.E., and Farrand, S.K. (1994) TraI, a LuxI homologue, is
responsible for production of conjugation factor, the Ti
plasmid N-acylhomoserine lactone autoinducer. Proc Natl
Acad Sci USA 91: 4639–4643.
Hwang, I., Cook, D.M., and Farrand, S.K. (1995) A new
regulatoryelement modulates
mediated autoinduction of Ti plasmid conjugal transfer.
J Bacteriol 177: 449–458.
Kaneko, T., Nakamura, Y., Sato, S., Asamizu, E., Kato, T.,
Sasamoto, S., et al. (2000) Complete genome structure of
the nitrogen-fixing symbiotic bacterium Mesorhizobium loti.
DNA Res 7: 331–338.
Khan, S.R., Gaines, J., Roop, R.M., and Farrand, S.K. (2008)
Broad-host-range expression vectors with tightly regulated
promoters and their use to examine the influence of TraR
and TraM expression on Ti plasmid quorum sensing. Appl
Environ Microbiol 74: 5053–5062.
Krick, A., Kehraus, S., Eberl, L., Riedel, K., Anke, H., Kaesler,
I., et al. (2007) A marine Mesorhizobium sp. produces
structurallynovel long-chain
lactones. Appl Environ Microbiol 73: 3587–3594.
de Lorenzo, V., Eltis, L., Kessler, B., and Timmis, K.N. (1993)
Analysis of Pseudomonas gene products using lacIq/Ptrp-
homoserine lactone-
N-acyl-L-homoserine
lac plasmids and transposons that confer conditional
phenotypes. Gene 123: 17–24.
McAnulla, C., Edwards, A., Sanchez-Contreras, M., Sawers,
R.G., and Downie, J.A. (2007) Quorum-sensing-regulated
transcriptional initiation of plasmid transfer and replication
genes in Rhizobium leguminosarum biovar Viciae. Micro-
biology 153: 2074–2082.
McClean, K.H., Winson, M.K., Fish, L., Taylor, A., Chhabra,
S.R., Cámara, M., et al. (1997) Quorum sensing and Chro-
mobacterium violaceum: exploitation of violacein produc-
tion and inhibition for the detection of N-acylhomoserine
lactones. Microbiology 143: 3703–3711.
Mantri, Y., and Williams, K.P. (2004) Islander: a database of
integrative islands in prokaryotic genomes, the associated
integrases and their DNA site specificities. Nucleic Acids
Res 32: D55–D58.
Marchler-Bauer, A., Anderson, J.B., Derbyshire, M.K.,
DeWeese-Scott, C., Gonzales, N.R., Gwadz, M., et al.
(2007) CDD: a conserved domain database for interactive
domain family analysis. Nucleic Acids Res 35: D237–
D240.
Miller, J.H. (1972) Experiments in Molecular Genetics. Cold
Spring Harbor: Cold Spring Harbor Laboratory Press.
Miller, W.G., Leveau, J.H., and Lindow, S.E. (2000) Improved
gfp and inaZ broad-host-range promoter-probe vectors.
Mol Plant Microbe Interact 13: 1243–1250.
Ochman, H., Lawrence, J.G., and Groisman, E.A. (2000)
Lateral gene transfer and the nature of bacterial innovation.
Nature 405: 299–304.
Ortori, C.A., Atkinson, S., Chhabra, S.R., Cámara, M., Will-
iams, P., and Barrett, D.A. (2007) Comprehensive profiling
of N-acylhomoserine lactones produced by Yersinia
pseudotuberculosis using liquid chromatography coupled
to hybrid quadrupole-linear ion trap mass spectrometry.
Anal Bioanal Chem 387: 497–511.
Ou, H.Y., Chen, L.L., Lonnen, J., Chaudhuri, R.R., Thani,
A.B., Smith, R., et al. (2006) A novel strategy for the iden-
tification of genomic islands by comparative analysis of the
contents and contexts of tRNA sites in closely related
bacteria. Nucleic Acids Res 34: e3.
Pappas, K.M., and Winans, S.C. (2003) A LuxR-type regula-
tor from Agrobacterium tumefaciens elevates Ti plasmid
copy number by activating transcription of plasmid replica-
tion genes. Mol Microbiol 48: 1059–1073.
Piper, K.R., Beck von Bodman, S., and Farrand, S.K. (1993)
Conjugation factor of Agrobacterium tumefaciens regulates
Ti plasmid transfer by autoinduction. Nature 362: 448–450.
Piper, K.R., Beck Von Bodman, S., Hwang, I., and Farrand,
S.K. (1999) Hierarchical gene regulatory systems arising
from fortuitous gene associations: controlling quorum
sensing by the opine regulon in Agrobacterium. Mol Micro-
biol 32: 1077–1089.
Qin, Y.P., Su, S.C., and Farrand, S.K. (2007) Molecular basis
of transcriptional antiactivation – TraM disrupts the TraR-
DNA complex through stepwise interactions. J Biol Chem
282: 19979–19991.
Quandt, J., and Hynes, M.F. (1993) Versatile suicide vectors
which allow direct selection for gene replacement in gram-
negative bacteria. Gene 127: 15–21.
Ramsay, J.P., Sullivan, J.T., Stuart, G.S., Lamont, I.L., and
Ronson, C.W. (2006) Excision and transfer of the
1154
J. P. Ramsay etal.
?
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155

Page 15

Mesorhizobium loti R7A symbiosis island requires an inte-
grase IntS, a novel recombination directionality factor
RdfS, and a putative relaxase RlxS. Mol Microbiol 62:
723–734.
Sanchez-Contreras, M., Bauer, W.D., Gao, M., Robinson,
J.B., and Downie, J.A. (2007) Quorum-sensing regulation
in rhizobia and its role in symbiotic interactions with
legumes. Philos Trans R Soc Lond B 362: 1149–1163.
Schaefer, A.L., Greenberg, E.P., Oliver, C.M., Oda, Y.,
Huang, J.J., Bittan-Banin, G., et al. (2008) A new class of
homoserine lactone quorum-sensing signals. Nature 454:
595–599.
Su, S.C., Khan, S.R., and Farrand, S.K. (2008) Induction and
loss of Ti plasmid conjugative competence in response to
the acyl-homoserinelactone
J Bacteriol 190: 4398–4407.
Sullivan, J.T., and Ronson, C.W. (1998) Evolution of rhizobia
by acquisition of a 500-kb symbiosis island that integrates
into a phe-tRNA gene. Proc Natl Acad Sci USA 95: 5145–
5149.
Sullivan, J.T., Patrick, H.N., Lowther, W.L., Scott, D.B., and
Ronson, C.W. (1995) Nodulating strains of Rhizobium loti
arise through chromosomal symbiotic gene transfer in the
environment. Proc Natl Acad Sci USA 92: 8985–8989.
Sullivan, J.T., Trzebiatowski, J.R., Cruickshank, R.W.,
Gouzy, J., Brown, S.D., Elliot, R.M., et al. (2002) Compara-
tive sequence analysis of the symbiosis island of
Mesorhizobium loti strain R7A. J Bacteriol 184: 3086–
3095.
Toussaint, A., Merlin, C., Monchy, S., Benotmane, M.A.,
Leplae, R., Mergeay, M., and Springael, D. (2003) The
biphenyl- and 4-chlorobiphenyl-catabolic
quorum-sensingsignal.
transposon
Tn4371, a member of a new family of genomic islands
related to IncP and Ti plasmids. Appl Environ Microbiol 69:
4837–4845.
Waters, C.M., and Bassler, B.L. (2005) Quorum sensing:
cell-to-cell communication in bacteria. Annu Rev Cell Dev
Biol 21: 319–346.
White, C.E., and Winans, S.C. (2007) Cell-cell communica-
tion in the plant pathogen Agrobacterium tumefaciens.
Philos Trans R Soc Lond B 362: 1135–1148.
Williams, P., Winzer, K., Chan, W.C., and Cámara, M. (2007)
Look who’s talking: communication and quorum sensing in
the bacterial world. Philos Trans R Soc Lond B Biol Sci
362: 1119–1134.
Yang, M., Sun, K., Zhou, L., Yang, R., Zhong, Z., and Zhu, J.
(2009) Functional analysis of three AHL autoinducer syn-
thase genes in Mesorhizobium loti reveals the important
role of quorum sensing in symbiotic nodulation. Can J
Microbiol 55: 210–214.
Yoon, S.H., Hur, C.G., Kang, H.Y., Kim, Y.H., Oh, T.K., and
Kim, J.F. (2005) A computational approach for identifying
pathogenicity islands in
Bioinformatics 6: 184.
prokaryoticgenomes.BMC
Supporting information
Additional supporting information may be found in the online
version of this article.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing material)
should be directed to the corresponding author for the article.
Regulation of ICEMlSymR7Aexcision
1155
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1141–1155