Proviral integrations and expression of endogenous avian leucosis virus during long term selection for high and low body weight in two chicken lines.
ABSTRACT Long-term selection (> 45 generations) for low or high juvenile body weight from a common founder population of White Plymouth Rock chickens has generated two extremely divergent lines, the LWS and HWS lines. In addition to a > 9-fold difference between lines for the selected trait, large behavioural and metabolic differences between the two lines evolved during the course of the selection. We recently compared gene expression in brain tissue from birds representing these lines using a global cDNA array analysis and the results showed multiple but small expression differences in protein coding genes. The main differentially expressed transcripts were endogenous retroviral sequences identified as avian leucosis virus subgroup-E (ALVE).
In this work we confirm the differential ALVE expression and analysed expression and number of proviral integrations in the two parental lines as well as in F9 individuals from an advanced intercross of the lines. Correlation analysis between expression, proviral integrations and body weight showed that high ALVE levels in the LWS line were inherited and that more ALVE integrations were detected in LWS than HWS birds.
We conclude that only a few of the integrations contribute to the high expression levels seen in the LWS line and that high ALVE expression was significantly correlated with lower body weights for the females but not males. The conserved correlation between high expression and low body weight in females after 9 generations of intercrosses, indicated that ALVE loci conferring high expression directly affects growth or are very closely linked to loci regulating growth.
-
Article: Avian leukosis virus subgroup J: a rapidly evolving group of oncogenic retroviruses.
[show abstract] [hide abstract]
ABSTRACT: A strain of avian leukosis virus (ALV) belonging to a new envelope subgroup J was isolated in the UK in 1988 from meat-type chickens. The disease caused by the members of this subgroup has since spread very rapidly worldwide and has become one of the major problems facing the broiler meat industry. Molecular characterisation of HPRS -103, the prototype of subgroup J, has shown that it has a structure of a typical ALV with gag, pol and env genes. However the env gene was distinct from that of other ALV s and was closely related to that of novel endogenous retroviral elements designated EAV - HP. As other regions of the genome were closely related to ALV s, it is believed that ALV-J has evolved by recombination with the env sequences of EAV - HP. ALV-J has a tropism for myeloid cells, a feature that may be associated with its ability to induce myeloid leukosis. Recent data show that ALV -J isolates evolve rapidly resulting in sequence changes within the variable regions of the env gene leading to antigenic variation. Eradication programmes established for other subgroups are proving to be effective in eradicating ALV-J from infected flocks.Research in Veterinary Science 11/1999; 67(2):113-9. · 1.65 Impact Factor -
Article: Influence of avian leukosis viral sequences on transmission to the egg and embryo.
[show abstract] [hide abstract]
ABSTRACT: Rous associated virus type-0 (RAV-0), a subgroup E replication-competent endogenous virus of chickens, is associated with a low efficiency of virus shedding into the egg albumen and failure to establish congenital transmission. In contrast, RAV-1, a subgroup A virus of exogenous origin, is efficiently shed into the albumen and readily infects the embryo. Among a series of in vitro constructed recombinants between RAV-0 and RAV-1, we have identified subgroup E recombinants that efficiently shed virus into the egg albumen but do not undergo efficient congenital transmission. The LTR region, subgroup-determining sequences in env, and sequences within a 375 bp Sacl-Xhol fragment at the 5' end of the genome each influenced the efficiency of virus shedding into the albumen. Egg inoculations with viruses differing only in env were used to confirm the low rate of congenital transmission of subgroup E viruses. These studies revealed that subgroup A envelope antigens are at least 100-fold more effective for the establishment of embryonic infection than subgroup E.Virology 04/1989; 169(1):222-6. · 3.35 Impact Factor -
Article: New findings on the congenital transmission of avian leukosis viruses.
[show abstract] [hide abstract]
ABSTRACT: RAV-0, an endogenous avian leukosis virus, does not undergo congenital transmission in infected K28 chickens. In contrast, avian leukosis viruses of exogenous origin undergo highly efficient congenital transmission. The relative abilities of endogenous and exogenous viruses to undergo congenital transmission appear to be determined by the p27 capsid proteins of these viruses.Science 08/1984; 225(4660):417-9. · 31.20 Impact Factor
Page 1
BioMed Central
Page 1 of 13
(page number not for citation purposes)
Retrovirology
Open Access
Research
Proviral integrations and expression of endogenous Avian leucosis
virus during long term selection for high and low body weight in two
chicken lines
Sojeong Ka1, Susanne Kerje1,2,4,5, Lina Bornold1, Ulrika Liljegren1,
Paul B Siegel3, Leif Andersson4,5 and Finn Hallböök*1
Address: 1Department of Neuroscience, Uppsala University, Uppsala, Sweden, 2Department of Medical Sciences, Uppsala University, Uppsala,
Sweden, 3Department of Animal and Poultry Sciences, Virginia Polytechnic Institute and State University, Blacksburg, USA, 4Department of
Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Uppsala, Sweden and 5Department of Medical Biochemistry and
Microbiology, Uppsala University, Uppsala, Sweden
Email: Sojeong Ka - sojeong.ka@neuro.uu.se; Susanne Kerje - Susanne.Kerje@medsci.uu.se; Lina Bornold - lina.bornold@gmail.com;
Ulrika Liljegren - ulrika.liljegren@neuro.uu.se; Paul B Siegel - pbsiegel@vt.edu; Leif Andersson - leif.andersson@imbim.uu.se;
Finn Hallböök* - finn.hallbook@neuro.uu.se
* Corresponding author
Abstract
Background: Long-term selection (> 45 generations) for low or high juvenile body weight from
a common founder population of White Plymouth Rock chickens has generated two extremely
divergent lines, the LWS and HWS lines. In addition to a > 9-fold difference between lines for the
selected trait, large behavioural and metabolic differences between the two lines evolved during
the course of the selection. We recently compared gene expression in brain tissue from birds
representing these lines using a global cDNA array analysis and the results showed multiple but
small expression differences in protein coding genes. The main differentially expressed transcripts
were endogenous retroviral sequences identified as avian leucosis virus subgroup-E (ALVE).
Results: In this work we confirm the differential ALVE expression and analysed expression and
number of proviral integrations in the two parental lines as well as in F9 individuals from an
advanced intercross of the lines. Correlation analysis between expression, proviral integrations and
body weight showed that high ALVE levels in the LWS line were inherited and that more ALVE
integrations were detected in LWS than HWS birds.
Conclusion: We conclude that only a few of the integrations contribute to the high expression
levels seen in the LWS line and that high ALVE expression was significantly correlated with lower
body weights for the females but not males. The conserved correlation between high expression
and low body weight in females after 9 generations of intercrosses, indicated that ALVE loci
conferring high expression directly affects growth or are very closely linked to loci regulating
growth.
Published: 15 July 2009
Retrovirology 2009, 6:68 doi:10.1186/1742-4690-6-68
Received: 17 April 2009
Accepted: 15 July 2009
This article is available from: http://www.retrovirology.com/content/6/1/68
© 2009 Ka et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Page 2
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 2 of 13
(page number not for citation purposes)
Background
Selection during more than 45 generations for low or high
body weight from a common founder population of
crosses among seven lines of White Plymouth Rock chick-
ens has generated two extremely divergent lines; the low
(LWS) and high weight selection (HWS) lines. The aver-
age body weight of individuals from each line differs by
more than 9-times at 56 days, the age of selection. Numer-
ous behavioural, metabolic, immunological, and endo-
crine differences between lines have evolved during the
course of the selection experiment [1-4]. Among the obvi-
ous correlated responses to the selection for body weight
were differences in feeding behaviour and food consump-
tion. While HWS chickens are hyperphagic compulsive
eaters and accumulate fat, LWS chickens are lean with low
appetite. Some LWS individuals are anorexic even when
fed ad libitum with 2 to 20% not surviving the first weeks
post hatch because they never start to eat [5]. HWS chicks
are put on a food restriction programme at 56 days to
avoid health issues associated with obesity. A neural
involvement in the development of the phenotypes was
implied by results after electrolytic lesions of the hypoth-
alamus [6]. We recently compared gene expression in
brain tissue using a global cDNA array analysis with the
purpose to reveal over-all expression differences between
the HWS and LWS lines that may be causally related to
their extremely different phenotypes. The results showed
that the long-term selection has produced minor but mul-
tiple expression differences in protein coding genes.
Genes that regulate neuronal development and plasticity
such as regulators of actin filament polymerization and
genes involved in lipid metabolism were over-represented
among differentially expressed genes [7].
The most differentially expressed transcripts were
sequences with similarities to endogenous retroviral
sequences (ERVs) that were identified as avian leucosis
virus subgroup-E (ALVE). Brain tissue of LWS individuals
contained higher levels of transcripts encoding ALVE than
that of HWS individuals. These results attracted our inter-
est because the occurrence and frequency of ALVE proviral
integrations in different chicken breeds have been shown
to be associated with altered physiology [8], disease resist-
ance [9] and reproduction efficiency [10]. The ALVE inte-
grations are transmitted in a Mendelian fashion [11] and
ALVE proviral integration frequency can change in
response to selection for specific traits [12-15]. These data
suggest that differences in ALVE integration between the
LWS and HWS lines indicated by the large difference in
expression may be related to the establishment of the
extreme phenotypes of these selected lines.
Periodic sampling of the selected lines and the establish-
ment of an advanced intercross line allowed us to test if
there was a link between the observed differential ALVE
transcript levels and body weights. Moreover, we were
able to determine if the different ALVE expression was
transmitted by inheritance or by congenital infection. The
extent of proviral integrations and their relation to levels
of ALVE expression were also analysed. The results show
that high ALVE expression among F9 birds was signifi-
cantly correlated with low body weight for the females but
not for males. The conserved correlation between high
expression and low body weight after 9 generations of
intercrosses, indicated that ALVE loci conferring high
expression are genetically linked to or constitute in part
the loci for a low body weight of the pullets.
Materials and methods
Animals and tissues
Lines LWS and HWS were developed from a common
founder population of crosses among seven inbred lines
of White Plymouth Rocks, a breed used for egg production
and broiler breeding. The selected lines have been main-
tained as closed populations by continuous selection for
low or high body weight at 56 days of age for more than
45 generations. The average LWS and HWS chicks weigh
0.2 kg and 1.8 kg respectively at selection age. Descrip-
tions of the selection programme and correlated
responses of these lines are provided elsewhere [5,16]. All
individuals sampled were from breeders of the same age,
hatched on the same day, and provided feed and water ad
libitum. Experimental procedures were approved by the
Virginia Tech Institutional Animal Care and Use Commit-
tee. The founder lines as well as subsequent intercrosses
were maintained at Virginia Polytechnic Institute and
State University, Blacksburg, Virginia. The two lines have
been kept in an identical and constant local environment
during the course of selection. For example, each selected
generation of the parental lines is hatched annually the
first Tuesday in March and dietary formulation has
remained constant throughout.
HWS and LWS chickens from generation 45 (G45, sche-
matic outline of the generations Fig. 1A) were used for the
cDNA array experiments and quantitative reverse tran-
scription polymerase chain reaction (qRT-PCR) validation
in peripheral as well as the brain tissues. Five or six males
and five females from each line were sampled at hatch and
at 56 days of age. Liver, pectoral muscle, adipose tissue
and the brain region containing diencephalon, mesen-
cephalon, pons, and medulla, were dissected on the day of
hatch and at 56 days after hatch, immediately frozen in
liquid nitrogen and stored at -70°C until used.
Reciprocal cross F1 chickens from G46 of the parental lines
were used to test inheritance of ALVE expression. The
intercross population between HWS and LWS chickens
was produced with the main purpose to identify genes
explaining the large difference in body weight and growth
Page 3
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 3 of 13
(page number not for citation purposes)
between the parental lines [16]. This intercross was initi-
ated from G41 of the parental lines (see Fig. 1A). Eight
HWS males were mated to 22 LWS females and 8 LWS
males were mated to 19 HWS females to generate the F1
generation. The number of animals in F9 from the
advanced intercross was 43 males and 43 females. Body
weights at 56 days were recorded for all individuals. Livers
were dissected for total RNA and genomic DNA prepara-
tion. Finally, 42 males and 38 females were used to meas-
ure relative mRNA amount of expressed ALVE with qRT-
PCR.
Genomic DNA was used to analyse proviral integration
number from HWS and LWS lines in both G41 and G45,
10 White Leghorn (WL) and 10 Red Jungle Fowl (RJF).
The WL line (Line 13) originated from a Scandinavian
selection and crossbreeding experiment [17] and was
maintained at the Swedish University of Agricultural Sci-
ences at a population size of 30 males and 30 females. The
RJF birds originated from Thailand and were obtained
from the Götala research station, Skara, Sweden. Informa-
tion about the Line13 and RJF is published [18-20].
Genomic DNA isolation
Genomic DNA from the parental lines and F1 chickens
were isolated from blood following standard genomic
DNA isolation method [21]. DNA from F9 chickens was
isolated from liver using automated nucleic acid purifica-
tion using GeneMole (Mole Genetics, Oslo, Norway)
according to the manufacturer's guide.
Total RNA isolation and cDNA synthesis
Each sample was homogenized into powder in presence
of liquid nitrogen, followed by total RNA extraction with
Trizol (Invitrogen Corporation, Carlsbad, CA, USA), and
the quality of the total RNA was checked with the Agilent
2100 bioanalyser (Agilent Technologies, Santa Clara, CA,
USA). One μg of total RNA was treated with RNase-free
DNase (Promega Corporation, Madison, WI, USA) and
used for cDNA synthesis with TaqMan Reverse Tran-
scriptase reagents (Applied Biosystems, Foster City, CA,
USA.) in a final volume of 50 μl containing 1 × TaqMan
RT buffer, 2.5 μM random hexamers, 500 μM of each
dNTP, 5.5 mM MgCl2, 20 U RNase inhibitor, and 62.5 U
Multiscribe RTase. Samples were incubated for 10 min at
25°C, 30 min at 48°C, and 5 min at 95°C. The cDNA
samples were stored at -20°C for storage.
Tumour Viral locus B (TVB) genotyping
Genomic DNA samples of 10 HWS and 10 LWS birds
(G41) were tested for genotyping of TVB alleles. A
polymerase chain reaction-restriction fragment length
polymorphism (PCR-RFLP) assay was performed follow-
ing published procedures [22]. TVB genotypes were iden-
tified in 19 chickens, but the procedures failed to define a
genotype for one LWS chicken.
Cloning and sequencing of env fragments from cDNA and
genomic DNA
Primers to amplify part of the env gene were designed in
non-variable regions of the proviral env gene after aligning
a number of sequences from GenBank. A primer pair,
chENV232fwd and chENV1046rev, were used to amplify
an 862 bp fragment from genomic DNA as well as cDNA
as templates. Genomic DNA from 47 HWS and LWS indi-
viduals (G41) was used to amplify and sequence the 862
bp env fragment. cDNA samples of one male and one
female representing the G45 parental lines were pooled
and used for sequencing. Furthermore, cDNA from 14 F9
chickens were sequenced. The PCR was performed in a
Schematic ALV genome with PCR amplicons and SNPs
Figure 1
Schematic ALV genome with PCR amplicons and
SNPs. A. Schematic time-line with parental generations and
crosses. Generations in boxes were used for analyses in this
study. Parental line generation (G) G41* and G45* were used
to examine number of ALVE integrations. Expression studies
were performed in the brain and peripheral tissues of G45*
birds. F1* birds of the reciprocal crosses were utilized to test
inheritance of ALVE genes. Eighty-two F9* birds that form
the advanced intercross were utilized for the correlation
studies. QTL analyses have been performed with F2** and
F8** birds in the advanced intercross line [16,53]. B. Black
bar represents a complete ALVE proviral genome. Grey bars
indicate PCR primers and amplicons. C. Six SNPs between
HWS and LWS lines were found in the 862 bp PCR fragment
e* from both genomic DNA and cDNA. a*: pol197F/
pol269R. b*: Val_envF/Val_envR. c*: env277F/env353R. d*:
qPCR_envF/qPCR_envR. e*: an amplicon from a primer pair
chENV232fwd/chENV1046rev. See table 1.
Page 4
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 4 of 13
(page number not for citation purposes)
total volume of 10 μl containing about 50 ng genomic
DNA or cDNA, 1× PCR Buffer (Qiagen, Valencia, CA,
USA), 2× Q solution (Qiagen), 1.5 mM MgCl2 (Qiagen),
200 μM dNTP, 2 pmol of each primer and 0.5 U HotStar-
Taq Polymerase (Qiagen). Thermocycling started with 10
min at 94°C, followed by touchdown PCR cycling with
denaturation 30 sec at 94°C, annealing 30 sec at 65°C
and decreasing 1°C per cycle to 52°C and extension 1
min at 72°C. Thirty five cycles were then performed with
30 sec at 94°C, 30 sec at 52°C and 1 min at 72°C and the
program ended with 5 min at 72°C. PCR products were
separated in a 1% agarose gel and fragments excised and
purified using QIAquick Gel Extraction Kit (Qiagen). PCR
products generated from genomic DNA of parental lines
and the expressed env fragments of F9 chickens sequenced
directly using the PCR primers to obtain a representative
sequence. PCR fragments from cDNA of parental lines
were all cloned into pCR/GW/TOPO vector using TOPO
TA cloning kit (Invitrogen) prior to sequencing with the
T7 and M13R universal primers. Sequences were control-
led, aligned and compared using the Sequencher 3.1.1
program (Gene Codes Corporation, Ann Arbor, MI, USA).
Relative quantitative Reverse Transcriptase-PCR (qRT-
PCR)
Two-step qRT-PCR was performed with the SYBR Green I
Assay in combination with either ABI PRISM 7700
Sequence Detection System (Applied Biosystems), or
MyiQ real-time PCR detection system (Bio-Rad Laborato-
ries, Hercules, CA, USA) with iScript one-step RT-PCR kit
with SYBR Green. One μl of the cDNA, derived from 20 ng
of total RNA, was used as template in a 25 μl reaction mix-
ture. PCR reactions were carried out in duplicates with
activation of the polymerase for 10 min at 95°C and 40
cycles of two PCR steps, 95°C for 15 sec and 60°C for 60
sec. One-step qRT-PCR was used for analysis of env tran-
script levels in peripheral tissues of G45 and F9 chickens.
Twenty ng of total RNA was added in 25 μl of the reaction
mixture and then incubated for 10 min at 50°C for cDNA
synthesis, for 5 min at 95°C for RTase inactivation and 35
cycles of two steps with 10 sec at 95°C and 30 sec at 60°C
to amplify target transcripts. Primers used in all quantita-
tive PCR (see Fig. 1B) were designed with Primer Express
1.5 software (Applied Biosystems) and are listed in table
1. A primer pair for quantitative PCR experiments,
qPCR_envF and qPCR_envR, was designed within 862 bp
of the PCR product described above. Chicken β-actin
(GeneBank accession No. NM_205518) and glyceralde-
hyde-3-phosphate dehydrogenase (GAPDH, GeneBank
accession No. NM_204305) were used as references. Each
sample was assigned a CT (threshold cycle) value corre-
sponding to the PCR cycle at which fluorescent emission,
detected real time, reached a threshold above baseline.
PCR products were separated in agarose gel to confirm
that the products had the expected size. Collected data
were normalized against the reference gene Ct values.
Subsequently, relative mRNA expression levels of the test
genes were determined in comparison with calibrators;
for example, average expression levels of 0 day-old HWS
males or shared subjects over the PCR plates. To examine
whether the expression levels in HWS and LWS chickens
were significantly different, one-way ANOVA together
with Newman-Keuls post-hoc test in GraphPad Prism
3.03 (GraphPad Software, San Diego, California, USA)
was utilized.
Analysis of proviral integration in genomic DNA
The extent of proviral integration of ALVE was estimated
by measuring the env proviral gene with qPCR in genomic
DNA. The qPCR was performed as the qRT-PCR but with
genomic DNA as template. Exactly 20 ng of the genomic
DNA was analysed with primers qPCR_envF and
qPCR_envR using a protocol with activation of the
polymerase for 10 min at 95°C and 40 cycles of two PCR
steps, for 15 sec at 95°C and for 60 sec at 60°C. Primers
for chicken pro-opiomelanocortin (POMC, GeneBank
accession NM_001031098) and pre-melanin-concentrat-
ing hormone (PMCH,
NW_001471513) were included in each of PCR plates as
representatives for single-copy genes. All env Ct values
were then normalized to the average of the POMC and
PMCH Ct values and the relative env copy numbers were
adjusted to the standard curve to get the env integration
copy-number per haploid genome.
GeneBank accession
Table 1: List of the genes and primer pairs used for qPCR and qRT-PCR experiments
Primer names forward/reversAmplicon in figure 1AForwardReverse
Beta-actinF/Beta-actinR
GAPDHF/GAPDHR
POMCF/POMCR
PMCHF/PMCHR
Val_envF/Val_envR
chENV232fwd/chENV1046rev
qPCR_envF/qPCR_envR
env277F/env353R
pol197F/pol269R
-
-
-
-
b*
e*
d*
c*
a*
AGGTCATCACCATTGGCAATG
GGGAAGCTTACTGGAATGGCT
GCTACGGCGGCTTCATGA
CGAAATGGAGACGGAACTGAA
ACCCGGACATCACCCAAAG
ACGGATTTCTGCCTCTCTACACA
GAAACTACCTTGTGTGCTGTCG
CCCAAAATCTGTAGCCATATGC
TGCTTGTCTCCCCAGGGTAT
CCCAAGAAAGATGGCTGGAA
GGCAGGTCAGGTCAACAACA
CGATGGCGTTTTTGAACAGAG
CATCCAAGAAGCTTTCCTCAATCT
AGTCAGAAATGCCTGCAAAAAGA
TTCCTTGCCATGCGCGATCCC
CGGATGTTGTGGAAAAACGA
TACGGTGGTGACAGCGGATAGG
GGTGACTAAGAAAGATGAGGCGA
Page 5
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 5 of 13
(page number not for citation purposes)
A plasmid (3679 bp) that contained the 862 bp env PCR
product in pCR/GW/TOPO vector was used to make a
standard curve. The plasmid was diluted serially in 2-fold,
ranging from 0.02 ng to 0.16 pg per reaction volume in 8
dilutions, then qPCR was run together with qPCR_env
primers and Ct values recorded. The number of the env-
plasmids in each reaction was calculated. n; plasmid
length (bp), M; average molecular weight of a base pair
(650 g/mol), NA is Avogadro's constant, m; mass of the
DNA.
Copy number of env plasmid = m/((n × M)/NA)
A standard curve was plotted using the plasmid number
and the corresponding Ct values (2-Ct). A linear relation-
ship was examined (y = 1011*x, R2 = 0.9927). The number
of haploid chicken genomes in 20 ng was also calculated
using the chicken genome size n = 1.05 × 109 bp. There are
17650 haploid genome copies per 20 ng genomic DNA.
The env gene integration number per genome for each
individual was calculated using (1011*2-Ct)/17650.
Results
High ALVE expression in the LWS line
The differential expression of ALV-related sequences
between lines LWS and HWS (G45) was found using a
cDNA microarray analysis [7]. Brain tissue from both
hatchlings and 56 day-old individuals of both sexes were
analysed, and among the differentially expressed tran-
scripts, at least 10 endogenous retrovirus-related tran-
scripts were differentially expressed (p < 0.001) with high
levels in the LWS line (Table 2, [23,24]). BLAST-search
results using the array sequences revealed similarities to
endogenous ALVE retrovirus elements. The fold difference
between HWS and LWS lines varied from 2 to > 30-fold
(Table 2).
Table 2: Differentially expressed virus-related sequence from cDNA microarray analysis
Probe IDGeneBank ID Gene annotation
from the best
hit/Domain
Fold difference of array expression (LWS/HWS)Nucleotide BLAST
0 d male0 d female56 d male 56 d female EST
length
Hit length
(hit/total)
Similarity
(%)
RJA064A11.ab1CN220264 ALV ev-21 and
its integration
site
ALV ADOL-
7501, proviral
sequence
ALV strain ev-3/
Avian gp85
ALV strain ev-3,
complete
genome
ALV strain ev-3,
complete
genome
Myeloblastosis-
assoc. virus
genes/Avian
gp85
ALV (strain RAV
7) 3' noncoding
region
ALV strain ev-3,
complete
genome
ALV strain ev-6
envelope
polyprotein
ALV strain ev-1,
complete
genome
30.820.6 23.821.5 377305/2734 97.7
RDA-81NA20.0 12.910.4 11.2210207/761296.2
RJA002E06CN216922
18.4 13.6 14.614.4757757/5842 99.1
WLA044E07.ab1 CN223892
8.3 5.76.86.2588 409/5842 100
WLA070B07.ab1CN230959
6.9 4.97.86.9 368153/5842100
VeFi2.66.C3*CN221614
2.01.9 2.01.9 25672120/7704 92.3
WLA097G09.ab1CN234473
2.52.3 -.2.1 326274/35894.5
WLA043C12.ab1 CN222802
1.6- 1.61.6454 451/584296.3
WLA019C03.ab1CN220591
-4.34.84.8 685151/272096.7
RDA-69NA---2.5185 170/7525 98.2
The gene annotation and BLAST result was collected from http://www.sbc.su.se/~arve/chicken[23,24]. NA, GeneBank ID is not available.
VeFi2.66.C3* had the best hit in Myeloblastosis-associated virus genes, however, BLAST result with protein sequences from SwissProt and TrEMBL
showed the best hit on env protein of ALV.
Page 6
Retrovirology 2009, 6:68 http://www.retrovirology.com/content/6/1/68
Page 6 of 13
(page number not for citation purposes)
Twenty-three virus-related sequences were arbitrarily
selected from the array transcript list: nine ALV-related
sequences, five other avian retrovirus-related sequences,
(including Rous sarcoma virus transcription enhancer fac-
tor II, env gene of Rous sarcoma virus and gag/pol poly-
protein of avian myeloblastosis virus), and nine
retrovirus-related sequences from other species. Only the
ALVE-related sequences were differentially expressed
(data not shown).
Primers for qRT-PCR were designed against the env gene
region in the most differentially expressed sequence
CN220264 (primer b*, Table 1, Fig. 1B). Five or 6 individ-
uals from each age and sex were analyzed to confirm the
differential levels. The ALVE expression in HWS chickens
was notably homogenous at a very low level at both ages
and for both sexes, while LWS chickens expressed high
ALVE levels with individual variation (Fig. 2A).
We tested whether the high ALVE levels were specific to
LWS brain tissue. Peripheral tissues from HWS and LWS
56 days-old chickens (G45) were analysed and high ALVE
mRNA levels were found in all brain, liver, pectoral mus-
cle and adipose tissues analyzed (Fig. 2B).
Genetic transmission
Although transmission of an endogenous retrovirus from
one generation to another is generally regarded as genetic,
intact transcribed ALVE provirus has been transmitted by
congenital infection [25-27]. To assess if the high ALVE
expression was transmitted by congenital infection or
inherited, we analyzed ALVE levels in F1 individuals from
reciprocal HWS × LWS crosses (G46). In case of congenital
infection from hen to egg, high expression in F1 progenies
should come from crosses between LWS dams and HWS
sires. In case of genetic transmission of the high ALVE lev-
els, the F1 individuals would have higher levels independ-
ent of whether the dams or sires were from LWS line.
Furthermore, a wide range of ALVE expression levels from
the low level in HWS to the high levels found in LWS indi-
viduals should be observed in the F1 generation. Quanti-
tative RT-PCR was performed with primers against three
different regions of the proviral ALVE transcript (Fig. 1B).
We found that some F1 individuals from LWS dams had
low levels, while their siblings from the same LWS dams
had high ALVE levels. LWS sires produced progeny with
high and low ALVE levels (Fig. 3). F1 chickens from each
reciprocal crosses had a full range of expression levels (Fig.
3). The results strongly suggest that the high ALVE expres-
sion in LWS chickens are genetically determined and not
transmitted by congenital infection.
The parental lines are susceptible to ALV infection
Chickens may be susceptible or resistant to certain ALV
retroviruses depending on the specific virus adherence
allele they have in the Tumour Viral locus B (TVB) [28].
Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens
Figure 2
Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens. Relative mRNA
expression levels of env gene were measured using qRT-PCR with a primer pair b* shown in table 1 and figure 1B. A. Validation
of differential expression of ALVE genes in cDNA microarray experiment. One-way ANOVA together with Newman-Keuls
test as a post-hoc analysis was utilized. B. ALVE expression in peripheral tissues of HWS and LWS lines. Peripheral tissues were
dissected from chickens on day 56 and the brain from chicks at hatch. N = 3 for each of HWS and LWS lines in all peripheral
tissues and cDNA samples from five birds were pooled for the brain pools. H, HWS; L, LWS; M, males; F, females.
Page 7
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 7 of 13
(page number not for citation purposes)
The TVB locus encodes a tumour necrosis factor receptor
that interacts with the Env glycoprotein and is required for
the viral entry into cells [29,30]. The TVB*S1 allele allows
entry of ALV subgroups B, D and ALVE, while TVB*S3 per-
mits viral entry of subgroup B and D but not E. The TVB*R
allele produces truncated receptors that do not allow entry
of any ALV [31,32]. Resistance to retrovirus entry could
influence ALVE expression and be associated with selec-
tion for body weight. We tentatively hypothesized that the
HWS line could be resistant and the LWS susceptible to
ALVE. Ten HWS and 10 LWS (G41) individuals were
typed for the TVB allele [22]. All successfully tested 19
parental individuals were positive for the TVB* S1 allele
that is susceptible for ALVE infection. One sample could
Expression levels of ALVE genes in F1 birds of a reciprocal HWS × LWS crosses
Figure 3
Expression levels of ALVE genes in F1 birds of a reciprocal HWS × LWS crosses. Two different pairs of primers
were designed against env (A and B, primer pairs c* and d* in table 1 and figure 5C) and one against pol (C, primer a*) in the
ALVE genome. H(?)xL(?) represents F1 birds from HWS sires and LWS dams, and F1 birds in L(?)xH(?) are from LWS
sires and HWS dams. N = 10 in H(?)xL(?) and N = 11 in L(?) × H(?).
Determination of the number of proviral integrations in different chicken populations
Figure 4
Determination of the number of proviral integrations in different chicken populations. A. Standard curve based on
diluted plasmid with a PCR product. B. Relative copy numbers of env gene were examined by qPCR with primer d* and the
numbers of integration per haploid genome were determined using the standard curve shown in A. Horizontal bars represent
mean values of integration number for each population. One-way ANOVA together with Newman-Keuls test as a post-hoc
analysis was utilized. Mean ± SEM: F9 = 15.42 ± 0.31, H41 = 11.01 ± 0.83, L41 = 14.34 ± 1.01, H45 = 8.87 ± 0.42, L45 = 13.73
± 0.51, WL = 5.56 ± 0.46 and RJ = 3.59 ± 0.56. N = 82 in F9 birds and n = 10 in the other populations. F9, generation 9 of the
advanced intercross line; H41 and L41, generation 41 of the HWS and LWS lines, respectively; H45 and L45, generation 45 of
the parental lines; WL, White Leghorn and RJF, Red Jungle Fowl.
Page 8
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 8 of 13
(page number not for citation purposes)
not be genotyped. The tentative hypothesis was rejected
and it was concluded that the lines were equally suscepti-
ble.
Number of proviral ALVE integrations
A central hypothesis in this work was that difference in
ALVE expression levels between lines could directly con-
tribute to the genetic differences in growth between the
HWS and LWS lines. The first question was then if the
number of proviral integrations differed between the
lines. Therefore, we analysed the extent of proviral inte-
gration by using qPCR and by analyzing the ALVE env
gene content in genomic DNA. In addition to the parental
lines (G41 and G45), we also analysed individuals from
the F9intercross and individuals from WL (line13) and
RJF. First, a standard curve with a plasmid containing an
env gene PCR product was made and used as an external
standard for qPCR analysis (Fig. 4A). The initial result
revealed that three initially selected RJF individuals had 2
to 3.5 env gene copies per haploid genome. This result was
compared to a BLAST search of the RJF genome database
(Assembly May-06) using the env primer sequences. Three
perfect hits were found for the primer sequences; and we
concluded that the qPCR analysis provided adequate
results. Eighty-two F9, 40 from each HWS and LWS line
(20 G41 and 20 G45), 10 RJFs and 10 WLHs were then
analysed. The WLs and RJFs had 2 to 7 integrations, with
7 to 15 in HWS, and 9 to 20 in LWS. The difference
between HWS and LWS lines was significant at both gen-
erations tested (G41 and G45). The integration numbers
in individuals from each line from the two generations
were not significantly different even though it was evident
that G41 had a larger variance than G45 in particularly
among the LWS individuals (Fig. 4B). The number of inte-
grations in the F9 ranged from 8 to 22 (Fig. 4B). It is worth
noting that this variance was similar in the F9 cross as in
their parental generation (G41). A schematic outline of
the parental and intercross generations is shown in Fig.
1A.
Number of integrations in relation to ALVE expression and
growth patterns
The observation that the LWS chickens had more integra-
tions and higher expression than the HWS chickens, led us
to the question if the number of proviral integrations
additively contributed to the different expression levels.
Such association was addressed using the results from the
F9 chickens. A correlation of 0.28 (p < 0.04) was obtained
between number and expression when all F9 chickens
were analyzed (Fig. 5A), suggesting that not all, but a few
different ALVE integrations contributed to the higher
expression levels in LWS.
A weak negative correlation between number of integra-
tions and body weight for all of the F9 individuals was
found but the trend was not statistically significant Fig.
5B. This result showed that individuals with many ALVE
proviral integrations, overall did not have lower body
weights (Fig. 5B) but this does not exclude the possibility
that the presence of some specific integrations has a direct
effect on body weight.
Next we plotted the body weight of the F9 individuals
against the ALVE expression levels and calculated the cor-
relation. The expression was measured with qRT-PCR
using primers in the env gene (primer d*) with total RNA
extracted from liver. The negative correlation (-0.49)
between ALVE expression and body weight was highly sig-
nificant for females (p < 0.01, Fig. 5D) but not for males
(Fig. 5C).
Env sequence polymorphisms in genomic and expressed
sequences
We PCR-amplified and sequenced an 862 bp env fragment
from genomic and cDNA from the two parental lines. The
env gene is known to have the highest degree of polymor-
phisms in the proviral genome. The sequences obtained
from genomic DNA from 21 HWS and 22 LWS individu-
als were polymorphic at six single base pair positions:
318, 363, 480, 749, 775 and 801 bp (Fig. 1C). The
sequence result illustrated that there were fixed HWS and
LWS line-specific SNPs; the HWS-variants and a LWS-var-
iant. The HWS line had only the HWS-variants while the
LWS line had all variants. The cDNA sequences revealed
that the high expression levels found in LWS line consti-
tuted the LWS variant and the low expression levels in
HWS individuals constituted the HWS-variant.
The env fragment was also amplified and sequenced from
cDNA from 24 F9 chickens (13 males and 11 females)
with high or low expression, eleven with high env expres-
sion and 13 with low env expression. The individuals are
indicated in Fig. 5C and 5D. All 11 individuals with high
ALVE expression and 6 individuals with lower expression
had the LWS-variant of the DNA sequence. The 7 chickens
with the HWS-variant were among the ones with lowest
env expression. Six were males and only one female.
Discussion
In this study we pursued the observation that high expres-
sion of an endogenous retrovirus of the ALVE type was
associated with low growth in one of two chicken lines
established by long term divergent selection for high or
low body weight [5,7]. We conclude that the high levels in
the LWS line show Mendelian inheritance. LWS birds have
more ALVE integrations than HWS birds, which in turn
have a larger number of integrations compared with WL
and RJF chickens. Using F9 birds from an advanced inter-
cross between the two selected lines we tested if there was
a correlation between body weight, ALVE integrations and
Page 9
Retrovirology 2009, 6:68 http://www.retrovirology.com/content/6/1/68
Page 9 of 13
(page number not for citation purposes)
expression levels. The results indicated that a minority of
the integrations contributed to the higher levels and that
high expression was significantly correlated to lower body
weights of females but not males. The conserved correla-
tion between high ALVE expression and low body weight
in females after 9 generations of intercrosses indicates that
ALVE loci conferring high expression are genetically
linked to or constitute loci directly contributing to low
body weight of LWS chickens in a sex-limited fashion.
The chicken genome contains four families of ERV ele-
ments classified as chicken repeat 1 (CR1) elements,
ALVEs, avian retrotransposones from the chicken genome
(ART-CHs) and endogenous avian retrovirus elements
(EAV-0) [8]. Although the microarray contained probes
with different retroviral sequences, only ALVE-related
sequences were identified as differentially expressed. The
env gene in the ALVE proviral genome is a source for
genetic diversity through recombination with exogenous
Correlation between number-of-integrations, ALVE mRNA expression levels and body weight in F9 birds from the advanced intercross line
Figure 5
Correlation between number-of-integrations, ALVE mRNA expression levels and body weight in F9 birds from
the advanced intercross line. Each dot in the plots represents an individual of F9 generation. A. Plot based on mRNA
expression levels against ALVE integration number in 80 F9 birds. P < 0.05 for correlation coefficient r = 0.28 including all
points as shown in panel A. P < 0.001 for correlation coefficient r = 0.41 when one deviating data point (black diamond) was
omitted from the analysis. B. Plot based on body weight against the number of ALVE integration in 80 F9 birds. P < 0.5 for cor-
relation coefficient. C and D. Correlation between the body weight and the ALVE expression in F9 birds from the advanced
intercross line. Open-circled data points indicate individuals of which env cDNA fragments (amplicon e* in figure 1C) were
sequenced in order to find out sequence variant. C. Plot based on 42 F9 male chickens. P < 0.22 for the correlation coefficient.
D. Plot based on 38 F9 female chickens. P < 0.01 for the correlation coefficient. H, HWS-variant; L, LWS-variant.
Page 10
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 10 of 13
(page number not for citation purposes)
viruses [33,34]. The sequence diversity of this gene consti-
tutes the basis for defining the six subgroups of ALV (A, B,
C, D, E, J) and is related to variation in infection suscepti-
bility, receptor interference as well as antibody neutraliza-
tion [8]. The env gene was used as target for the primer
design for qPCR, qRT-PCR and for sequencing. The prim-
ers we used amplified the endogenous ev-loci of several
ALVE subtypes, but did not match other types of retrovirus
such as RSV or avian myeloblastosis virus. Primers against
the ALVE pol gene confirmed the differential expression
seen with the env primers (Fig. 3C).
Endogenous retrovirus elements are in most cases trans-
mitted genetically [35]. Transmission of ALV can occur via
several natural routes [11]. Exogenous ALVs are transmit-
ted horizontally by infection between individuals or verti-
cally from hen to progeny in ovo by congenital
transmission [11,36]. Horizontal transmission is rela-
tively inefficient while congenital transmission is very effi-
cient and leads to a high ratio of infected embryos [8]. The
ALVE elements exist in the chicken genome as partial or
complete ALVE proviral genomes. Endogenous elements
have in general a limited or restricted ability to transmit
virus congenitally, in contrast to exogenous ALV that
undergo highly efficient congenital transmission [37,38].
However, it was demonstrated that some ev-loci that
encode complete provirus genomes, particularly ev-12
and ev-21, can be transmitted at higher frequencies from
subgroup E susceptible dams to susceptible progeny [25-
27].
Susceptibility of chickens to ALV retroviral infection is reg-
ulated by subtype-specific cell membrane receptors that
interact with the Env glycoprotein. Exogenous ALV sub-
types B and D, and virus particles of endogenous ALVE
infect through this interaction. Different types of receptors
for ALV subtypes B, D and E are encoded by three alleles
of the TVB locus. The TVB*S1 allele encodes tumour
necrosis factor receptors that are required for the viral
entry of all three subgroups while TVB*S3 permits viral
entry of subgroup B and D but not E. The TVB*R allele
produces truncated receptors that do not support entry of
any ALV [28,31,32]. All of the successfully tested 19 indi-
viduals (G41) possessed the TVB*S1 allele that gives sus-
ceptibility for ALVE. This result is in agreement with that
83% of chickens from 36 broiler lines were homozygous
for TVB*S1 [39]. Hence, both HWS and LWS chickens are
susceptible for ALVE infection and polymorphism in the
TVB locus is neither a result of the long term selection nor
is it likely to be involved in the high ALVE expressing phe-
notype.
The possibility that the LWS chickens propagated high
ALVE expression via congenital infection from hen to egg
was examined. We analyzed ALVE expression in an F1 gen-
eration after a reciprocal cross between the lines (G46). F1
siblings from the same LWS dam often had both high and
low ALVE levels and LWS males transmitted high expres-
sion to their progeny (Fig. 3). Moreover, hens with high
ALVE expression did not always transmit high expression
to their progeny as would have been expected by congen-
ital infection. Rather, their expression spanned the full
range of expression levels seen in the parentals. Therefore,
the high/low ALVE expression levels were likely to have
been inherited and these data support a Mendelian mode
of genetic transmission of ALVE expression. Furthermore,
an exogenous ALV infection among parental LWS is less
plausible because ALV-related disease symptoms have not
been observed during the course of selection [5]. It cannot
be excluded that such infection has occurred and by
recombination may have formed elements that triggered
increased ALVE expression because there are examples of
male-mediated congenital transmission of ALVE [40]. The
active transcription of ALVE in the tested tissues may also
have introduced recombinant somatic ALVE pro-viral
integrations [34].
The number of env gene integrations in RJF and WLs
ranged from 2 to 7 per haploid genome. Both the HWS
and LWS lines had more integrations than RJF and WLs.
HWS individuals had significantly fewer integrations than
LWS while the F9 birds had 8 to 22 env integrations per
haploid genome, a number similar to that for the LWS
line (Fig. 4B). The reported average for layer chickens is 1
to 3 elements, while that for meat-type chickens is 6 to 10
[15]. Altogether 22 different ALVE loci have been identi-
fied in WLs and current estimates suggest that there may
be over 50 different loci [41]. Although the number of
ALVE integrations in the genome pool of the White Ply-
mouth Rock founder population for the selection experi-
ment is not known, they probably had a similar number
of ev-loci as the HWS and LWS lines (7 to 22 integrations).
This number is little higher than the average meat bird,
however, the qPCR in this study may be more sensitive
than previously used methods.
HWS birds have low ALVE expression and fewer ALVE
integrations than LWS birds suggesting that differential
selection for growth has influenced both ALVE expression
and integration number (Figs. 2 and 5). This hypothesis
was supported by results from the F9 population where we
observed a weak but significant correlation between inte-
gration number and expression (Fig. 5A). The results sug-
gested that only a few of the integrations contributed to
the high levels of expression. This assumption was further
supported by the occurrence of sequence polymorphism
for the env gene (Fig. 1C), and one sequence variant was
exclusively found in LWS birds. Only this LWS-variant was
found in cDNA from LWS birds and F9 individuals with
high ALVE expression (Figs. 5C, D and 1C). In contrast, in
Page 11
Retrovirology 2009, 6:68http://www.retrovirology.com/content/6/1/68
Page 11 of 13
(page number not for citation purposes)
genomic DNA from LWS chicken both the LWS- and
HWS-variants were present and the HWS variant was
more frequent. Thus, while LWS-variant integrations are
fewer than the HWS-variant they contributed more to the
high levels of expression in LWS individuals and certain F9
birds. An obvious interpretation is that selection for high
body weight has been effective to purge or silence high
expressing ALVE loci. Another possible explanation is that
a previous ongoing infection would have produced novel
integrations that led to the increased levels in the LWS
line. For this to occur would require novel integration in
the germ line in order to transmit to the next generations.
Our data from the F9 generation suggest that the actively
expressed ALVE loci are causing reduced growth and that
this effect is more pronounced in the females than in
males. This pattern may be explained by a sex-specific
response or because the effects by high ALVE expression
are more penetrant for smaller birds and pullets are over-
all smaller than males. ALVE integration is of interest for
the poultry industry because the frequency of integration
alters the responses to selection for economical traits
[9,10,12-15]. The mechanism may be that integrations
directly or indirectly disrupt other genes [8,42]. However,
in humans there are only rare examples where a recessive
monogenic disorder is caused by HERV integration dis-
rupting gene function. Alternatively, a high virus expres-
sion load such as in the LWS line may affect the growth
indirectly. The activation of inflammatory cytokines such
as the interferon-gamma, TNF-alpha, interleukin-1 and -6,
their receptors and signalling pathway components are
signatures of retrovirus infection [43,44]. Such genes were
not over-represented in the cDNA array analysis results
[7]. Factors that regulate retrovirus trans-cellular transport
and budding are also regulated at high virus loads such as
actin-related modulators including Rho-like factors and
trans-golgi factors [44]. Similar activation patterns have
been seen after avian RSV infection of chick fibroblasts
[45]. The budding of enveloped RNA viruses, including
HIV and other retroviruses, usurp a cellular pathway that
is normally used to form vesicles and transport them into
multi-vesicular bodies [46]. Some of the differentially
expressed genes observed in our previous study [7] while
associated with alterations in neuronal plasticity are also
regulated during acute and chronic retrovirus infections
[45,47]. These include vesicle trafficking systems such as
the ARL/ARF factors and FKBP5 as well as the Nephroblas-
toma overexpressed gene (Nov). Nov was reported to
decrease in fibroblasts after Rous sarcoma virus transfor-
mation [45] and we observed lower Nov expression in
LWS chicken than in HWS chickens. Nov was initially
identified as a cellular gene in chick nephroblastomas
induced by the retrovirus myeloblastosis-associated virus
[48]. The identification of Nov as being differentially
expressed between lines indicates that the expressed
endogenous ALVE sequences may influence cellular gene
expression and may therefore contribute to the selection
response for growth.
Both HWS and LWS pullets showed delayed age of onset
of egg production, and a considerable proportion of LWS
females never mature [49,50]. Delayed sexual maturity for
LWS females were attributed to anorexia because it was
possible to induce egg laying by force-feeding. Moreover,
sexually matured LWS females were heavier at 56 days of
age than those that did not show sexual maturation later
in life [51]. Other studies have also indicated a relation-
ship between viral integration and traits related to repro-
duction. Gavora et al [10] reported that certain virus-
producing ev-loci, ev-10 or 19 and 12, and silent gene ev-
1 can affect egg productivity for layers. Also, the total
number of ev-loci per genome was significantly related to
body weight at first egg and mature body weight [52]. The
body weight of LWS juvenile females is related to that of
sexually matured LWS females and sexual maturation
might be related to the number of ALVE integration and
the ALVE expression. Therefore, it is not surprising that
high expression of ALVE is correlated to the low juvenile
body weight in female chickens.
Quantitative trait locus (QTL) analysis has been per-
formed after crossing the HWS and LWS lines and more
than 13 growth-related QTLs were identified all with
minor individual effects [16,53] and a high degree of
epistasis [54]. Although the exact location of ALVE inte-
grations remain to be defined, our results are consistent
with the QTL data in that we present data that multiple
proviral loci together contribute to one aspect of the phe-
notype, namely to the low weight of pullets.
Conclusion
Artificial selection for high or low juvenile body weight
was associated with high frequency and elevated expres-
sion levels of ALVE loci in the LWS line. Although the
genomic location remains ambiguous, it is most likely
that ALVE loci were genetically inherited from both HWS
and LWS chickens. Analysis of the advanced intercross
line demonstrated significant correlation between low
body weight and high ALVE expression. The results
showed that while LWS chickens have accumulated more
ALVE integrations than HWS ones, only a few of the inte-
grations contribute to the high expression levels observed
in the LWS line. High ALVE expression among F9 birds was
significantly correlated with low body weight for the
females but not for males. The conserved correlation
between high expression and low body weight in females
after 9 generations of intercrosses, indicated that ALVE
loci conferring high expression are genetically linked to or
constitute in part the loci for a low body weight of the pul-
lets.
Page 12
Retrovirology 2009, 6:68 http://www.retrovirology.com/content/6/1/68
Page 12 of 13
(page number not for citation purposes)
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
SKa did all experimental work and contributed to the writ-
ing of the manuscript. SKe contributed to PCR amplifica-
tions, TVB typing as well as the sequence analysis. LB and
UL did the integration analysis. PBS produced the chicken
lines and conceived the project together with LA and FH.
FH and LA supervised the work and FH wrote the manu-
script. All authors read and approved its final version.
Acknowledgements
The authors would like to express gratefulness to all colleagues contributed
to this work; Joakim Lundeberg to provide with cDNA microarray facility
and to participate in conceiving of the study, Fateema Parveen and Daniel
Hagey for carrying out part of practical experiments, Carolyn Fitzsimmons,
Carl-Johan Rubin, Lina Strömstedt for invaluable discussion about chicken
genetics and the data analysis. This work was supported by the Swedish
research council, Wallenberg Consortium North "Fun chick", Swedish
Foundation for Strategic Research, FORMAS and Arexis AB.
References
1.Calabotta DF, Cherry JA, Siegel PB, Jones DE: Lipogenesis and
lipolysis in fed and fasted chicks from high and low body
weight lines. Poult Sci 1985, 64:700-704.
2.Denbow DM, Van Krey HP, Siegel PB: Selection for growth alters
the feeding response to injections of biogenic amines. Phar-
macol Biochem Behav 1986, 24:39-42.
3. Kuo AY, Cline MA, Werner E, Siegel PB, Denbow DM: Leptin
effects on food and water intake in lines of chickens selected
for high or low body weight. Physiol Behav 2005, 84:459-464.
4. Kuo AY, Lee JC, Magnin G, Siegel PB, Denbow DM: Differential
autonomic nervous system response in obese and anorexic
chickens (Gallus gallus). Comp Biochem Physiol B Biochem Mol Biol
2006, 144:359-364.
5.Dunnington EA, Siegel PB: Long-term divergent selection for
eight-week body weight in white Plymouth rock chickens.
Poult Sci 1996, 75:1168-1179.
6. Burkhart CA, Cherry JA, Van Krey HP, Siegel PB: Genetic selection
for growth rate alters hypothalamic satiety mechanisms in
chickens. Behav Genet 1983, 13:295-300.
7. Ka S, Lindberg J, Stromstedt L, Fitzsimmons C, Lindqvist N, Lunde-
berg J, Siegel PB, Andersson L, Hallbook F: Extremely Different
Behaviours in High and Low Body Weight Lines of Chicken
are Associated with Differential Expression of Genes
Involved in Neuronal Plasticity. J Neuroendocrinol 2009,
21:208-216.
8.Crittenden LB: Retroviral elements in the genome of the
chickens: implications for the poultry genetics and breeding.
Critical reviews in poultry biology 1991, 3:73-109.
9.Kuhnlein U, Sabour M, Gavora JS, Fairfull RW, Bernon DE: Influence
of selection for egg production and Marek's disease resist-
ance on the incidence of endogenous viral genes in White
Leghorns. Poult Sci 1989, 68:1161-1167.
10. Gavora JS, Kuhnlein U, Crittenden LB, Spencer JL, Sabour MP:
Endogenous viral genes: association with reduced egg pro-
duction rate and egg size in White Leghorns. Poult Sci 1991,
70:618-623.
11. Weiss RA: The discovery of endogenous retroviruses. Retrovi-
rology 2006, 3:67.
12.Gavora JS, Kuhnlein U, Spencer JL: Absence of endogenous viral
genes in an inbred line of Leghorn chicks selected for high
egg production and Marek's disease resistance. J Anim Breeding
Genet 1989, 106:217-224.
13.Kuhnlein U, Gavora JS, Bernon DE, Sabour MP: Incidence of endog-
enous viral genesin two strainsof White Leghorn chickens
selected for egg production and susceptibility or resistance
ti Marek's disease. Theor Appl Genet 1989, 77:.
14. Lamont SJ, Chen Y, Aarts HJ, van der Hulst-van Arkel MC, Beuving G,
Leenstra FR: Endogenous viral genes in thirteen highly inbred
chicken lines and in lines selected for immune response
traits. Poult Sci 1992, 71:530-538.
Sabour MP, Chambers JR, Grunder AA, Kuhnlein U, Gavora JS:
Endogenous viral gene distribution in populations of meat-
type chickens. Poult Sci 1992, 71:1259-1270.
Jacobsson L, Park HB, Wahlberg P, Fredriksson R, Perez-Enciso M,
Siegel PB, Andersson L: Many QTLs with minor additive effects
are associated with a large difference in growth between two
selection lines in chickens. Genet Res 2005, 86:115-125.
Liljedahl L, Kolstad N, Soerensen P, Maijala K: Scandinavian selec-
tion and crossbreeding experiment with laying hens, I. Back-
ground and general outline. Acta Agric Scand 1979, 29:273-285.
Kerje S, Carlborg O, Jacobsson L, Schutz K, Hartmann C, Jensen P,
Andersson L: The twofold difference in adult size between the
red junglefowl and White Leghorn chickens is largely
explained by a limited number of QTLs. Anim Genet 2003,
34:264-274.
Rubin CJ, Lindberg J, Fitzsimmons C, Savolainen P, Jensen P, Lunde-
berg J, Andersson L, Kindmark A: Differential gene expression in
femoral bone from red junglefowl and domestic chicken, dif-
fering for bone phenotypic traits. BMC Genomics 2007, 8:208.
Schutz K, Kerje S, Carlborg O, Jacobsson L, Andersson L, Jensen P:
QTL analysis of a red junglefowl × White Leghorn intercross
reveals trade-off in resource allocation between behavior
and production traits. Behav Genet 2002, 32:423-433.
Miller SA, Dykes DD, Polesky HF: A simple salting out procedure
for extracting DNA from human nucleated cells. Nucleic Acids
Res 1988, 16:1215.
Zhang HM, Bacon LD, Cheng HH, Hunt HD: Development and
validation of a PCR-RFLP assay to evaluate TVB haplotypes
coding receptors for subgroup B and subgroup E avian leuko-
sis viruses in White Leghorns. Avian Pathol 2005, 34:324-331.
Fitzsimmons CJ, Savolainen P, Amini B, Hjalm G, Lundeberg J, Anders-
son L: Detection of sequence polymorphisms in red jungle-
fowl and White Leghorn ESTs. Anim Genet 2004, 35:391-396.
Savolainen P, Fitzsimmons C, Arvestad L, Andersson L, Lundeberg J:
ESTs from brain and testis of White Leghorn and red jungle-
fowl: annotation, bioinformatic classification of unknown
transcripts and analysis of expression levels. Cytogenet Genome
Res 2005, 111:79-87.
Crittenden LB, Smith EJ, Fadly AM: Influence of endogenous viral
(ev) gene expression and strain of exogenous avian leukosis
virus (ALV) on mortality and ALV infection and shedding in
chickens. Avian Dis 1984, 28:1037-1056.
Smith EJ, Crittenden LB: Genetic cellular resistance to subgroup
E avian leukosis virus in slow-feathering dams reduces con-
genital transmission of an endogenous retrovirus encoded at
locus ev21. Poult Sci 1988, 67:1668-1673.
Smith EJ, Salter DW, Silva RF, Crittenden LB: Selective shedding
and congenital transmission of endogenous avian leukosis
viruses. J Virol 1986, 60:1050-1054.
Weiss RA: Cellular receptors and viral glycoproteins involved
in retrovirus entry. In The retroviridae Edited by: Levy JA. New
York: Plenum Press; 1993:1-108.
Adkins HB, Brojatsch J, Young JA: Identification and characteri-
zation of a shared TNFR-related receptor for subgroup B, D,
and E avian leukosis viruses reveal cysteine residues required
specifically for subgroup E viral entry. J Virol 2000,
74:3572-3578.
Brojatsch J, Naughton J, Adkins HB, Young JA: TVB receptors for
cytopathic and noncytopathic subgroups of avian leukosis
viruses are functional death receptors. J Virol 2000,
74:11490-11494.
Barnard RJ, Young JA: Alpharetrovirus envelope-receptor
interactions. Curr Top Microbiol Immunol 2003, 281:107-136.
Crittenden LB, Motta JV: The role of the tvb locus in genetic
resistance to RSV(RAV-O). Virology 1975, 67:327-334.
Boyce-Jacino MT, O'Donoghue K, Faras AJ: Multiple complex fam-
ilies of endogenous retroviruses are highly conserved in the
genus Gallus. J Virol 1992, 66:4919-4929.
Weiss RA, Mason WS, Vogt PK: Genetic recombinants and het-
erozygotes derived from endogenous and exogenous avian
RNA tumour viruses. Virology 1973, 52:535-552.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Page 13
Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
BioMedcentral
Retrovirology 2009, 6:68 http://www.retrovirology.com/content/6/1/68
Page 13 of 13
(page number not for citation purposes)
35.Sacco MA, Flannery DM, Howes K, Venugopal K: Avian endog-
enous retrovirus EAV-HP shares regions of identity with
avian leukosis virus subgroup J and the avian retrotranspo-
son ART-CH. J Virol 2000, 74:1296-1306.
Venugopal K: Avian leukosis virus subgroup J: a rapidly evolv-
ing group of oncogenic retroviruses. Res Vet Sci 1999,
67:113-119.
Brown DW, Robinson HL: Influence of avian leukosis viral
sequences on transmission to the egg and embryo. Virology
1989, 169:222-226.
Robinson HL, Eisenman RN: New findings on the congenital
transmission of avian leukosis viruses. Science 1984,
225:417-419.
Zhang HM, Bacon LD, Heidari M, Muir WM, Groenen MA, Zhang Y,
Wong GK, Fulton JE, O'Sullivan NP, Albers GA, et al.: Genetic var-
iation at the tumour virus B locus in commercial and labora-
tory chicken populations assessed by a medium-throughput
or a high-throughput assay. Avian Pathol 2007, 36:283-291.
Smith EJ, Fadly AM: Male-mediated venereal transmission of
endogenous avian leukosis virus. Poult Sci 1994, 73:488-494.
Benkel BF: Locus-specific diagnostic tests for endogenous
avian leukosis-type viral loci in chickens. Poult Sci 1998,
77:1027-1035.
Chang CM, Coville JL, Coquerelle G, Gourichon D, Oulmouden A,
Tixier-Boichard M: Complete association between a retroviral
insertion in the tyrosinase gene and the recessive white
mutation in chickens. BMC Genomics 2006, 7:19.
Bosinger SE, Hosiawa KA, Cameron MJ, Persad D, Ran L, Xu L, Bou-
lassel MR, Parenteau M, Fournier J, Rud EW, Kelvin DJ: Gene
expression profiling of host response in models of acute HIV
infection. J Immunol 2004, 173:6858-6863.
Giri MS, Nebozhyn M, Showe L, Montaner LJ: Microarray data on
gene modulation by HIV-1 in immune cells: 2000–2006. J Leu-
koc Biol 2006, 80:1031-1043.
Masker K, Golden A, Gaffney CJ, Mazack V, Schwindinger WF, Zhang
W, Wang LH, Carey DJ, Sudol M: Transcriptional profile of Rous
Sarcoma Virus transformed chicken embryo fibroblasts
reveals new signaling targets of viral-src. Virology 2007,
364:10-20.
von Schwedler UK, Stuchell M, Muller B, Ward DM, Chung HY,
Morita E, Wang HE, Davis T, He GP, Cimbora DM, et al.: The pro-
tein network of HIV budding. Cell 2003, 114:701-713.
Morita E, Sundquist WI: Retrovirus budding. Annu Rev Cell Dev Biol
2004, 20:395-425.
Joliot V, Martinerie C, Dambrine G, Plassiart G, Brisac M, Crochet J,
Perbal B: Proviral rearrangements and overexpression of a
new cellular gene (nov) in myeloblastosis-associated virus
type 1-induced nephroblastomas. Mol Cell Biol 1992, 12:10-21.
Zelenka DJ, Jones DE, Dunnington EA, Siegel PB: Selection for body
weight at eight weeks of age. 18. Comparisons between
mature and immature pullets at the same live weight and
age. Poult Sci 1987, 66:41-46.
Zelenka DJ, Siegel PB, Dunnington EA, Cherry JA: Inheritance of
traits associated with sexual maturity when populations of
chickens reach 50% lay. Poult Sci 1986, 65:233-240.
Siegel PB, Dunnington EA: Selection for growth in chickens. CRC
critical reviews in poultry biology 1987, 1:1-24.
Iraqi F, Darvas A, Zeitlin G, Beckmann J, Soller M: Nonlinear effects
of chicken endogenous viruses on body weight may be
responsible for maintaining these elements in a stable
genetic polymorphism. Poult Sci 1994, 73:1625-1632.
Park HB, Jacobsson L, Wahlberg P, Siegel PB, Andersson L: QTL
analysis of body composition and metabolic traits in an inter-
cross between chicken lines divergently selected for growth.
Physiol Genomics 2006, 25:216-223.
Carlborg O, Jacobsson L, Ahgren P, Siegel P, Andersson L: Epistasis
and the release of genetic variation during long-term selec-
tion. Nat Genet 2006, 38:418-420.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.