JAK2-V617F mutation and Philadelphia positive chronic myeloid leukemia.

Full text

Page 1

Downloaded from http://journals.tums.ac.ir/ on Wednesday, June 27, 2012




JAK2-V617F Mutation and Philadelphia Positive
Chronic Myeloid Leukemia

Nadali F,1 Ferdowsi Sh,3 Karimzadeh P,3 Chahardouli B,2 Einollahi N,3 Mousavi SA,2 Bahar B,2 Dargahi H,3 Alimoghaddam
K,2 Ghavamzadeh A,2 Ghaffari SH2

1Pathology Department, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2Hematology-Oncology and BMT Research Center, Shariati Hospital, Tehran University of Medical Sciences
3School of Allied Health Sciences, Tehran University of Medical Sciences

Corresponding Author: Dr Seyed H Ghaffari, Ph.D.
Hematology- Oncology and Stem Cell Research Center, Shariati Hospital, Kargar Shomali Street, Tehran, Iran 11411.
E-mail: shgaffari2000@yahoo.com
Tel: 021 84902665


Abstract:
JAK2 is a tyrosine kinase that plays an important role in the signaling pathways of many hematopoietic growth
factor receptors. A single acquired point mutation – V617F – in JAK2 occurs in the great majority of patients
with polycythemia vera (PV) and approximately half of the patients with idiopathic myelofibrosis (IMF) or
essential thrombocythemia (ET). In contrast, the JAK2-V617F mutation is only rarely found in chronic myeloid
leukemia (CML) but, recently, some authors have reported the coexistence of JAK2V617F and BCR/ABL+ in
CML patients expressing the p210 BCR–ABL oncoprotein. Here, we report a CML patient with the expression
of p210/b2a2 type BCR–ABL transcript and JAK2V617F mutation.

Key words: JAK2V617F mutation, BCR-ABL translocation, ASO-PCR, ARMS-PCR

Received: 28, Aug., 2009
Accepted: 26, Sep., 2009

Introduction
The acquired JAK2V617F mutation occurs in a
spectrum of the Philadelphia chromosome (Ph)-
negative chronic myeloproliferative
(CMPDs), which include polycythemia vera,
essential thrombocythemia, and myelofibrosis.
However, an increasing number of cases of Ph-
positive CML with concomitant JAK2V617F
mutation have recently been reported. There are few
previous reports of
myeloproliferative disorders [PV(1,2), CIMF(3,4)
or ET(5)] into chronic myeloid leukaemia. The
causative relationship between the underlying
disorders or their myelosuppressive treatment and
the emergence of CML is uncertain. The
Philadelphia-chromosome anomaly(6) and the
JAK2-V617F mutation(7) might be secondary to
yet unknown initial stem-cell defects that induce
clonal haematopoiesis. The patient studied by
Kramer’s group(14) and the previously published
findings(3,4,8) suggest that, in rare cases, two
different subclones might evolve from the same
clonal haematopoietic proliferation. We report here
disorders
the transformation of
a case of Ph+ CMPD in combination with the
JAK2V617F mutation.

Case report
In 2005, a 39-year-old man presented with
leukocytosis and splenomegaly. The hematological
parameters were as follows: white blood cells
(WBC), 75×109/L, haemoglobin 12.8 g/dL, and
platelets 230×109/L. At the time of the diagnosis,
the peripheral blood cytogenetic analysis revealed a
chromosome translocation
Expression of B2A2 BCR-ABL mRNA (chimer
protein 210 KD) was detected by a reverse
transcriptase polymerase chain reaction (RT-PCR)
in peripheral-blood leucocytes. A bone marrow
biopsy revealed marked hypercellularity. A
diagnosis of BCR-ABL positive chronic myeloid
leukaemia (CML) was made and treatment with
hydroxyurea (HU) was initiated with the goal of
lowering blood cell count and decrease his
splenomegaly, resulting in the normalization of
peripheral-blood leucocytes (WBC: 5×109/L, Hb:
13.9 g/dL, Plt: 150× 109/L). After one year,
treatment was changed to Imatinib. In 2009, we
[t([9;22)(q34;q11)].
IJHOSCR, Vol. 3, No.3; 2009/ 43
Case Reportteee

Page 2

Downloaded from http://journals.tums.ac.ir/ on Wednesday, June 27, 2012



performed the JAK2 mutation test to detect this
mutation on genomic DNA (ARMS-PCR) and
RNA (ASO-PCR) which had been isolated from the
whole peripheral blood of the patient.

ARMS PCR for the detection of JAK2-V617F
mutations
Genomic DNA was extracted by phenol/chloroform
after proteinase K digestion, following standard
techniques. The JAK2 V617F mutation was
detected by ARMS-PCR, according to the protocol
of Jones, et al(9) with some modification. The
ARMS-PCR technique uses 4 primers as follows; a
forward outer primer, a reverse outer primer, a
forward inner wild type specific primer and a
reverse inner mutant specific primer. The forward
primer from one set and the reverse from the other
generate a control 463-bp band in all cases. The
reverse inner mutant specific primer and the
forward outer primer generate a 279-bp mutant
fragment. In the presence of the wild-type JAK2,
the reverse outer primer and the forward inner wild-
type specific primer produce a fragment of 229-bp
(Figure 1).



Figure 1. ARMS assay to detect the JAK2V617F mutation in
genomic DNA. Lanes 6 is 100–base pair (bp) markers; lane1
show positive control with 3 bands; lane 3 is sample patient ;
lanes 2 is known negative control and 5 is negative PCR
control.

The PCR primers (MWG Biotech, Germany)were:
Forward Outer (FO): 5’- TCC TCA GAA CGT
TGA TGG CAG-3’
Reverse Outer (RO): 5’- ATT GCT TTCCTT TTT
CAC AAG AT-3’
Forward wild-type specific
GCATTTGGT TTTAAATTATGGAGTATATG -
3’
Reverse mutant-specific (RMt): 5’- GTT TTA CTT
ACT CTC GTC TCC ACA AAA-3’
PCR reaction was performed within a total volume
of 25 µL containing approximately 25 ng DNA,
12.5 µL of TaqMan Universal PCR Master Mix 2X
(Roche, Germany), 0.5 µl of each FO, RO and Fwt,
and 1µl of Rmt primer. The PCR program on the
(FWt): 5’-
thermal cycler (Eppendorf) was as follows: an
initial denaturation step at 94°C for 6 min, followed
by 40 cycles of 40 sec. at 94°C, 45 sec. at 56°C, 45
sec. at 72°C, and a final extension step of 10 min at
72°C.

ASO- PCR for the detection of the JAK2-V617F
mutation
Total RNAs were isolated by using the TRIZOL
reagent. First, strand cDNAs were prepared by
reverse transcription of total RNAs with random
primers. The ASO- PCR program was as follows:
an initial denaturation step at 95°C for 5 min,
followed by 40 cycles of 40 sec. at 94°C, 40 sec. at
56°C, 45 sec. at 72°C, and a final extension step of
10 min at 72°C.
The PCR primers (MWG Biotech, Germany) were:
Forward- 5΄-GAA GAT TTG ATA TTT AAT GAA
AGC CTT-3΄
Reverse-5΄-GTA ATA CTA ATG CCA GGA TCA
CTA AGT T-3΄
Mutant-5΄-AGC ATT TGG TTT TAA ATT ATG
GAG TAT ATT-3΄
The mutant specific forward amplified a 295-bp
product from the mutated allele, whereas the
internal control forward primer should have given a
488-bp product from both the mutant and wild-type
alleles (Figure 2). A total of 10 µl from the PCR
product were electrophoresed on 3% standard
agarose gels (Sigma, Germany) at 80 V for 15 min.
The fragments were visualized by ethidium bromide
under UV transilluminator.



Figure- 2. ASO- PCR to detect the JAK2V617F mutation in
genomic RNA. Lanes 1 is 100–base pair (bp) markers; lane 2
,3 and 4 show positive control with 2 bands; lane 6 is sample
patient ; lanes 5 is known negative controls and 10 is negative
PCR control.

Discussion
After Jelinek, et al(10) reported the absence of the
JAK2 mutation in chronic phase Ph positive CML
(in approximately 100 patients), it was thought that
the JAK2 mutation and the BCR-ABL translocation
were mutually exclusive. However, an increasing
number of cases of Ph-positive CML with
44 /IJHOSCR, Vol. 3, No.4; 2009
Nadali F

Page 3

Downloaded from http://journals.tums.ac.ir/ on Wednesday, June 27, 2012

concomitant JAK2V617F mutation have been
recently reported.(11-13) The JAK2-V617F-mutant
CMPD appears to develop predominantly, after
selective treatment of the Ph positive CML with the
tyrosine kinase inhibitor Imatinib.(3 ,14-15) Other
reports, showing that, while BCR-ABL transcripts
decrease during treatment with Imatinib, the JAK2-
V617F allele frequency remains constant or even
increases. This certainly fits the assumption of a
successive acquisition of both genomic aberrations
by one subclone of progenitor cells.(3,11,14-15) On
the other hand, as best evidenced by Jallades, et
al,(11) at least the emergence of a Philadelphia
chromosome against the background of a JAK2-
V617F-mutant CMPD seems to be unrelated to
prior myelosuppressive treatment. It had been
speculated earlier that cytotoxic therapy of CMPD
might contribute to the development of additional
genomic events in CMPD (among them, a BCR-
ABL translocation). In light of the paper by
Jallades, et al(11) as well as by Curtin et al, who
report on a patient with a JAK2-V617F-mutant ET
who developed CML after treatment with aspirin
only,(16,5) this scenario now has become unlikely.

Conclusion
Such rare patients with co-existing BCR-ABL
translocations and JAK2V617F mutations must be
identified in view of the possibility of targeted
therapies. Further studies are required to determine
the exact frequency and prognostic role of the
JAK2V617F mutation in Ph+ CMPD patients.

Acknowledgment
We would like to thank Hematology-Oncology and
Stem Cell Transplantation Research Center, Shariati
Hospital for assistance in providing sample and
patient information.

References
1. Bocchia M, Vannucchi AM, Gozzetti A, et al. Insights into
JAK2-V617F Mutation in CML. Lancet Oncol, 2007; 8: 864–
6.
2. Mirza I, Frantz C, Clarke G, et al. Transformation of
Polycythemia Vera to Chronic Myelogenous Leukemia. Arch
Pathol Lab Med, 2007; 131: 1719–24.
3. Hussein K, Bock O, Seegers A, et al. Myelofibrosis
Evolving During Imatinib Treatment of a Chronic
Myeloproliferative Disease with Coexisting BCR-ABL
Translocation and JAK2V617F mutation. Blood 2007; 109:
4106–7.
4. Bornhauser M, Mohr B, Oelschlaegel U, et al. Concurrent
JAK2 (V617F) Mutation and BCR-ABL Translocation within
Committed Myeloid Progenitors in Myelofibrosis. Leukemia
2007; 21: 1824–6.
5. Curtin NJ, Campbell PJ, Green AR. The Philadelphia
Translocation and Pre-existing Myeloproliferative Disorders.
Br J Haematol, 2005; 128: 734–6.
6. Fialkow PJ, Martin PJ, Najfeld V, et al. Evidence for a
Multistep Pathogenesis of Chronic Myelogenous Leukemia.
Blood, 1981; 58: 158– 63.
7. Kralovics R, Teo SS, Li S, et al. Acquisition of the V617F
Mutation of JAK2 is a Late Genetic Event in a Subset of
Patients with Myeloproliferative Disorders. Blood, 2006; 108:
1377– 80.
8. Haq AU. Transformation of Polycythemia Vera to Ph-
positive Chronic Myelogenous Leukemia. Am J Hematol,
1990; 35: 110– 13.
9. Jones AV, Kreil S, Zoi K, et al: Widespread Occurrence of
the JAK2 V617F Mutation in Chronic Myeloproliferative
Disorders. Blood, 2005; 106: 2162– 2168.
10. Jelinek J, Oki Y, Gharibyan V, et al. JAK2 Mutation
1849G>T is Rare in Acute Leukemias but Can be Found in
CMML, Philadelphia Chromosome-negative CML, and
Megakaryocytic Leukemia. Blood 2005;106: 3370–3.
11. Jallades L, Hayette S, Tigaud I, et al. Emergence of
Therapy-unrelated CML on a Background of BCR-ABL-
negative JAK2 V617F-positive
Idiopathicmyelofibrosis. Leuk Res, 2008; 32: 1608–10.
12. Bornhäuser M, Mohr B, Oelschlaegel U, et al. Concurrent
JAK2 (V617F) Mutation and BCR-ABL Translocation within
Committed Myeloid Progenitors in Myelofibrosis. Leukemia,
2007; 21: 1824–6.
13. Mello Conchon M, Costa JL, Novaes M , et al.
Simultaneous detection of JAK2 V617F Mutation and Bcr-
Abl Translocation in a Patient with Chronic Myelogenous
Leukemia. Int J Hematol, 2008; 88: 243– 245.
14. Kr¨amer A, Reiter A, Kruth J, et al. JAK2-V617F
Mutation in a Patient with Philadelphia-chromosomepositive
Chronic Myeloid Leukaemia. Lancet Oncol, 2007; 8: 658–60.
15. Inami M, Inokuchi K, Okabe M, et al. Polycythemia
Associated with the JAK2V617F Mutation Emerged During
Treatment of Chronic Myelogenous Leukemia. Leukemia,
2007; 21: 1103–4.
16. Scott LM, Campbell PJ, Baxter EJ, et al. The V617F
JAK2 Mutation is Uncommon in Cancers and in Myeloid
Malignancies other than the Classic Myeloproliferative
Disorders. Blood, 2005; 106: 2920–1.














Chronic
IJHOSCR, Vol. 3, No.3; 2009/ 45