![The WNV sequence derived from a Hyalomma marginatum marginatum tick collected from a song thrush in Romania (marked with a black diamond) is most closely related to the human-derived WNV strain VLG_07 from Russia. All other WNV strains related to this Russian/Romanian cluster originate from Central and South Africa, suggesting an introduction of this WNV lineage 2 variant from Africa to Europe. The cluster of another independent introduction of a WNV lineage 2 to Central Europe is also indicated. Black stars indicate sequences for which information was obtained from McMullen et al. [12]. The percentage of replicates in the bootstrap test (1000 replicates) is shown next to the branches. Values less than 70% are hidden.](https://www.researchgate.net/profile/J-Kiss/publication/266576575/figure/fig1/AS:202825842860049@1425368857524/The-WNV-sequence-derived-from-a-Hyalomma-marginatum-marginatum-tick-collected-from-a-song_Q320.jpg)
Content uploaded by J. Botond Kiss
Author content
All content in this area was uploaded by J. Botond Kiss on Nov 26, 2014
Content may be subject to copyright.
Content uploaded by J. Botond Kiss
Author content
All content in this area was uploaded by J. Botond Kiss on Nov 10, 2014
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
The Complete Sequence of a West Nile Virus Lineage 2
Strain Detected in a
Hyalomma marginatum marginatum
Tick Collected from a Song Thrush (
Turdus philomelos
)in
Eastern Romania in 2013 Revealed Closest Genetic
Relationship to Strain Volgograd 2007
Jolanta Kolodziejek
1
, Mihai Marinov
2
, Botond J. Kiss
2
, Vasile Alexe
2
, Norbert Nowotny
1,3
*
1Viral Zoonoses, Emerging and Vector-Borne Infections Group, Institute of Virology, University of Veterinary Medicine Vienna, Vienna, Austria, 2Danube Delta National
Institute for Research and Development, Tulcea, Romania, 3Department of Microbiology and Immunology, College of Medicine and Health Sciences, Sultan Qaboos
University, Muscat, Oman
Abstract
In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was
determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush
(Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes
the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship
of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an
outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused
an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain
became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in
Romania since 2010.
Citation: Kolodziejek J, Marinov M, Kiss BJ, Alexe V, Nowotny N (2014) The Complete Sequence of a West Nile Virus Lineage 2 Strain Detected in a Hyalomma
marginatum marginatum Tick Collected from a Song Thrush (Turdus philomelos) in Eastern Romania in 2013 Revealed Closest Genetic Relationship to Strain
Volgograd 2007. PLoS ONE 9(10): e109905. doi:10.1371/journal.pone.0109905
Editor: Lark L. Coffey, University of California Davis, United States of America
Received July 15, 2014; Accepted August 29, 2014; Published October 3, 2014
Copyright: ß2014 Kolodziejek et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.
Funding: This study was partially supported by the European Union grants FP7-261504 EDENext (www.edenext.eu) to JK, MM, BK, VA, and NN as well as FP7-
261391 EuroWestNile (www.eurowestnile.org) to JK and NN. Funder of both grants: European Commission. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: Norbert.Nowotny@vetmeduni.ac.at
Introduction
Mosquitoes, primarily of the genus Culex, are considered the
main vectors of West Nile virus (WNV), a zoonotic member of the
genus Flavivirus. Wild birds constitute the principal hosts of the
virus amplifying it in a bird-mosquito cycle. Certain ‘bridge’
mosquito species have been determined to transmit the virus to
humans and other mammals, which are regarded dead-end hosts
[1], [2]. The role of ticks as WNV vectors had been poorly
investigated to date [3].
Romania has a long-standing history of WNV infections,
including severe outbreaks of human West Nile neuroinvasive
disease (WNND) in 1996 with 393 confirmed cases [4], and in
2010 with 57 cases. Affected patients were distributed among 19
districts in the southern, western, central and eastern parts of the
country [5]. The ‘2010’ WNV strain became endemic and has
been the cause of outbreaks of varying sizes each following year
(http://www.ecdc.europa.eu/en/healthtopics/west_nile_fever/
Pages/epidemiological_updates.aspx; http://www.ecdc.europa.
eu/en/healthtopics/west_nile_fever/West-Nile-fever-maps/
Pages/historical-data.aspx). Nevertheless, the complete sequence
of the main WNV strain circulating in Romania since 2010 has
not been determined as yet. Therefore goals of this study were to
determine the complete genomic sequence of the WNV strain
currently circulating in Romania, assess its pathogenicity and
neuroinvasive markers, investigate its phylogenetic relatedness to
other WNV strains, and discuss the role of ticks in WNV
introduction and maintenance.
Materials and Methods
A total of 32 ticks were found randomly on a total of 23 birds,
which had been captured using mist nets [6] in the Danube Delta
Biosphere Reserve, Romania. They were investigated for the
presence of WNV within the framework of the European Union
FP7 project EDENext. Specifically, the birds were captured at the
following locations: Enisala (44u53928.280N/28u49950.970E), Gr.
Lupilor (44u41946.820N/28u56915.700E), Salcioara
(44u47955.300N/28u53957.570E), Maliuc Mila (45u10934.610N/
29u3953.910E), Rachitarie (45u11934.740N/29u598.160E), and
Maliuc (45u10935.960N/29u6929.510E). All ethical and research
certifications, approvals and permits were issued by the responsible
PLOS ONE | www.plosone.org 1 October 2014 | Volume 9 | Issue 10 | e109905
authorities, i.e. the Romanian Ornithological Centre, Danube
Delta Biosphere Reserve Authority, Sanitary, Veterinary and
Food Safety County Direction Tulcea, and the Scientific Council
of the Danube Delta National Institute. The field studies did not
involve endangered or protected species. The tick-infested birds
were Passer montanus (n = 20), Acrocephalus arundinaceus (1),
Turdus philomelos (1) and Oriolus oriolus (1). The latter was found
to be most infested by ticks (n = 10), whereas merely a single tick
was retrieved from each of the remaining birds. Ticks from
Acrocephalus arundinaceus and Oriolus oriolus (n = 11) were
collected in May 2012, from four Passer montanus in July 2012,
and from sixteen further Passer montanus as well as one Turdus
philomelos in August 2013. The ticks were removed using tweezers
and stored at 280uC until further investigation.
Ticks were homogenized individually in a TissueLyser II
(Qiagen, USA) using Tungsten Carbide Beads 3 mm (Qiagen,
USA) and 150 ml nuclease free water (Promega, Madison, USA)
for 3 min at 30 Hz. Both genomic DNA and total RNA were
extracted from each suspension employing the QIAamp Viral
RNA Mini Kit (Qiagen, USA) following the manufacturer’s
instructions.
For rapid detection of both WNV lineages 1 and 2 in the
samples, a reliable real-time RT-qPCR method [WNV (lin.1+2)
RT-qPCR] targeting the highly conserved 59non-coding region
(NCR) was established. The sequences were as follows: WNV_8F:
59-CGCCTGTGTGAGCTGACAAA-39, WNV_118R 59-
GCCCTCCTGGTTTCTTAGACATC-39, and WNV_67T: 59-
FAM-TGCGAGCTGTTTCTTAGCACGA-TAMRA-39for the
forward primer, reverse primer, and TaqMan probe, respectively.
The numbering refers to the WNV lineage 1 sequence AF196835.
Primers and probe for the WNV (lin.1+2) RT-qPCR were
designed with the help of the AbiPrism Primer Express 2.0.0
software (Applied Biosystems, USA). The real-time RT-qPCR was
performed in an Applied Biosystems 7300 Real-Time PCR System
using a SuperScript III Platinum One-Step Quantitative RT-PCR
System kit (Invitrogen, USA) following the manufacturer’s
instructions.
The positive sample was subsequently tested by various RT-
PCRs using published universal flavivirus primer pairs, e.g., [7]–
[9], primers specific for WNV lineage 2 [10] (online appendix:
http://www.cdc.gov/ncidod/EID/vol12no04/05-1379_app.
htm], and self-designed primers (Table 1)).
All primer pairs for the conventional RT-PCRs were developed
with the help of Primer Designer program (Scientific &
Educational Software). The RT-PCR assays were carried out
using One Step RT-PCR Kit (Qiagen, USA).
Primer and probe synthesis as well as sequencing in both
directions were carried out by Microsynth (Balgach, Switzerland).
The obtained WNV sequences were verified by BLAST search
and compiled to one continuous sequence. The complete genome
of the newly determined WNV was compared with 23 other WNV
strains, representing complete lineage 2 sequences from different
hosts, countries and years. Multiple alignments were performed
using BioEdit Sequence Alignment Editor (version 7.0.9.0) and
verified by Clustal X program (version 1.8).
Phylogenetic neighbor joining analysis was conducted with the
help of the MEGA5 program. The evolutionary distances were
computed using Maximum Composite Likelihood model [11].
Bootstrap resampling analysis with 1000 replicates was employed.
Information about several sequences deposited atGenBank was
obtained from [12]. Sequence translation was carried out using the
program (http://www.expasy.org/genomics).
To explore the pathogenicity and neuroinvasiveness markers of
the newly determined WNV strain, predicted N-glycosylation sites
of all viral proteins were analyzed using the program NetNGlyc
1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/) according to
[13] (summarized in [14]).
In order to explore the hypothesis of the existence of a single
Eastern European lineage 2 WNV cluster, partial E and partial
NS5 gene sequences from Russia and Romania, available in
GenBank (Table 2) were phylogenetically analyzed as described
above for the complete genome sequences. Unfortunately the
Russian and Romanian partial sequences targeted different WNV
genes, thus additional two phylogenetic trees had to be established.
Due to various lengths, the sequences had to be adjusted to 474 nt
(E gene sequences) and 466 nt (NS5 gene sequences), respectively.
Molecular determination of the tick species was performed using
a PCR assay targeting the mitochondrial 12S rDNA gene with
primers recommended previously [15], [16]. For this purpose a
Fast Cycling PCR Kit (Qiagen, USA) was applied.
Upon removal of the tick from the bird, oral and cloacal swabs
as well as serum were collected from the bird, and later tested
using the above-mentioned real-time WNV (lin.1+2) RT-qPCR.
The serum sample was additionally investigated for the presence of
antibodies against WNV by INGESIM West Nile Compac ELISA
(Ingenasa, Madrid, Spain) following the manufacturer’s instruc-
tions, and by PRNT [17], [18].
Results
One immature tick (nymph) was positive upon WNV (lin.1+2)
RT-qPCR. This tick was genetically identified as Hyalomma
marginatun marginatum (H. m. marginatum). It was found on a
juvenile song thrush (Turdus philomelos) which had been captured
in a mist-net in Enisala/Romanian Danube Delta on 27.08.2013.
All other investigated ticks tested negative. All WNV-negative ticks
were also identified as H. m. marginatum, except one tick which
was identified as Haemaphyalis sp. (collected in August 2013 from
aPasser montanus).
By application of several published and self-designed primer
pairs a complete, 11,013 nt long WNV sequence was generated
from the infected tick, encoding a 3,434 aa long polyprotein,
which consists of all typical WNV proteins C, prM, M, E, NS1,
NS2a, NS2b, NS3, NS4a, NS4b and NS5 with the corresponding
lengths of 123, 92, 75, 501, 352, 231, 131, 619, 149, 256 and 905
aa, respectively.
The Romanian tick-derived WNV was most closely related to
strain Reb_VLG_07_H (GenBank acc.no. FJ425721) with only 58
nucleotide differences (identity rate 99.45%).
The comparison of the polyprotein sequences of both WNV
strains revealed only six amino acid substitutions (identity rate
99.83%): Thr to Ile (position 108 of the C gene), Ser to Gly
(position 199 of the E gene), Met to Leu (pos. 90 of the NS2a
gene), Ser to Pro (pos. 100 of the NS4a gene), as well as Tyr to His
and Ala to Glu (positions 18 and 370 of the NS5 gene), of which
two amino acid substitutions at positions 108 in C gene and 199 in
E gene were unique for the Romanian tick WNV, compared to all
complete WNV genomes investigated in this study.
The known pathogenicity and neuroinvasiveness markers could
be identified in the Romanian WNV: N-glycosylation motif NYS
at position 154 of the E protein as well as three potential N-
glycosylation sites at positions 130, 175, and 207 in the NS1 gene,
prolin at position 250 of the NS1 gene and histidine at position
249 of the NS3 gene.
Phylogenetic analysis of 24 complete WNV lineage 2 sequences
confirmed the close genetic relationship of the newly determined
Romanian tick WNV with the Russian human-derived WNV
from 2007 (Figure 1). All other viruses in this major cluster are of
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 2 October 2014 | Volume 9 | Issue 10 | e109905
Table 1. In this table primer pairs which have been used in addition to primers described by Bakonyi et al. [10] are listed (available
as online appendix at: http://www.cdc.gov/ncidod/EID/vol12no04/05-1379_app.htm).
Sequence 59–39(F, forward primer; R, reverse primer)
Primer position (refers to the
sequence VLG_07, FJ425721)
Length of the PCR
product (nt)
AGCACGAAGATCTCGATGTC(F)* 49–68 593
GTGCACCARCAGTCRATGTC(R)* 641–622
CCGCGGATTGTCCTTGATAG(F) 129–148 766
CACGACGCGTTGCATYGTGT(R) 894–875
CAATCTGTTGTGGCTCTAGG(F) 1681–1700 845
TCCATCCAGGCTTCCACATC(R) 2525–2506
GCCGGAGCGATTCCTGTTGA(F) 1732–1751 1340
AGCTTCCARGTGTCGTTGAG(R) 3071–3052
TCCTTGCAGTTGGAGGAGTT(F) 2387–2406 826
CCTGGTCTCCTGTTGTGATT(R) 3212–3193
GGCACGCACAACCACTGAGA(F) 3327–3346 642
AGCAGCGGCACCACCACATT(R) 3968–3949
GGCCTGCTACAGAAGTGATG(F) 4190–4209 552
CCTTAGTGGTGTGCCACAGT(R) 4741–4722
GGTCTGGCAGAACTTGACAT(F) 4243–4262 431
CCAAGCAGACCTCGAGTCAT(R) 4673–4654
TGCTGAGATCACAGGCTCTA(F) 4380–4399 1021
GTGTGGAGACATCAGCCTAT(R) 5400–5381
AGATTGAGGACGGCTGTGCT(F) 5224–5243 638
TTGCGGCTGTCGATCACTCT(R) 5861–5842
ATAGGCTGATGTCTCCACAC(F) 5381–5400 591
TTCTTCCTATGCGTCCTCT(R) 5971–5953
CAGAGGCTCGCATCATGCTA(F) 6047–6066 795
ACACAGCGAGCTGGTTGTCA(R) 6841–6822
CCTGAGCGCGAGAAGGTGTA(F) 6112–6131 828
GTGTCCTAGCAGGCTGCTAA(R) 6939–6920
CCTGAGAACAGCTGACTTAC(F) 6189–6208 519
GTGGCAGCTCCTAAGATTAC(R) 6707–6688
TGTTGGATGGCTGAAGTCTC(F) 6715–6734 789
TGCTGCTGCTGTAGTCAGAA(R) 7503–7484
GACTCTGACCGTGACTGTGA(F) 7203–7222 715
ATAGCACCAGCCGCCTCTAC(R) 7917–7898
AGCGGAAGCTATGCGATCTG(F) 7275–7294 847
TTCTACCTCGGCACTTGACG(R) 8121–8102
GGCCATTACTGAAGTTGACC(F) 7740–7759 1061
ACAGCCAGTTCGTGGTCTCA(R) 8800–8781
ACCGTCCGTGTCTTGGAGAT(F) 8131–8150 448
TTCCGTGGTAGTTCCAGGT(R) 8578–8560
AGCTGACCTCGAGAATGAAG(F) 9288–9307 990
CGGACCTGATTRATTGCTAC(R) 10277–10258
TAGCGCGGTCCATCATCGAG(F) 9348–9367 1633
GCGCACTGTGCCGTGTGGCT(R) 10980–10961
GCCACCGGAAGTTGAGTAGA(F)* 10515–10534 466
CTGGTTGTGCAGAGCAGAG(R)* 10962–10944
GCTGCGAGGTGATCCACGTA(F) 10579–10598 398
ACTGTGCCGTGTGGCTGGTT(R) 10976–10957
Primers marked with stars are suitable for detection of both WNV lineages 1 and 2.
doi:10.1371/journal.pone.0109905.t001
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 3 October 2014 | Volume 9 | Issue 10 | e109905
Table 2. Characteristics of WNV lineage 2 partial sequences additionally included in Figures 2 and 3.
GenBank acc. no. Designation Length (nt) Country Area
Collection
date Host Reference
Partial WNV E gene sequences additionally included in Figure 2
FJ265699 Isolate VLG-07-2657 1563 Russia Volgograd 2007 Human (blood) Platonov et al., GenBank
FJ265700 Isolate VLG-07-26428 1563 Russia Volgograd 2007 Human (blood) Platonov et al., GenBank
FJ265701 Isolate VLG-07-26571 1563 Russia Volgograd 2007 Human (blood) Platonov et al., GenBank
FJ265702 Isolate VLG-07-26298 1563 Russia Volgograd 2007 Human (blood) Platonov et al., GenBank
FJ265703 Isolate VLG-07-26304 1563 Russia Volgograd 2007 Human (blood) Platonov et al., GenBank
FJ425729 Isolate 57_VLG_07_M 1563 Russia Volgograd 2007 Mosquito (Culex pipiens) Platonov et al., GenBank
HQ237494 Isolate ROS-2-2010-H 774 Russia Rostov 2010 Human (blood) Karan et al., GenBank
HQ237498 Isolate VLG-609-2010-H 774 Russia Volgograd 2010 Human (brain) Karan et al., Genbank
JQ014116 Isolate VOLGOGRAD-01/918-2011 474 (length-limiting
sequence)
Russia Volgograd 2011 Human (urine) Antonov et al., GenBank
JX844662 Isolate VOLGOGRAD-03/619-2012 492 Russia Volgograd 2012 Human (brain) Antonov et al., GenBank
Partial WNV NS5 gene sequences additionally included in Figure 3
HE984574 Isolate 89-2011 1189 (with 100nt
gap in the middle)
Romania Danube Delta (Mila 26) 2011 Mosquito (Culex pipiens) Panculescu-Gatej et al.,
GenBank
HG328830 Isolate RO_mo151/2012 642 Romania Not available 07-Sep-2012 Mosquito (Culex pipiens) Dinu et al., Genbank
HG328831 Isolate RO_hu121351/2012 705 Romania Not available 2012 Human (serum) Dinu et al., GenBank
HG514461 Isolate RO_mo48/2012 618 Romania Danube Delta
(Mila 26)
26-Aug-2012 Mosquito (Culex pipiens) Dinu et al., GenBank
HG514462 Isolate RO_mo98/2012 636 Romania Danube Delta
(Mila 26)
25-Aug-2012 Mosquito (Culex pipiens) Dinu et al., Genbank
HG514463 Isolate RO_mo418/2012 614 Romania Danube Delta
(Mila 26)
30-Sep-2012 Mosquito (Culex modestus) Dinu et al., Genbank
HG514464 Isolate RO_mo419-2012 585 (length-limiting
sequence)
Romania Danube Delta
(Mila 26)
30-Sep-2012 Mosquito (Culex modestus) Dinu et al., Genbank
HG514465 Isolate RO_mo426/2012 633 Romania Danube Delta
(Mila 26)
30-Sep-2012 Mosquito (Culex modestus) Dinu et al., GenBank
HG514466 Isolate RO_mo434-2012 638 Romania Danube Delta
(Mila 26)
29-Sep-2012 Mosquito (Anopheles hyrcanus) Dinu et al., GenBank
HG514467 Isolate RO_mo444-2012 633 Romania Danube Delta
(Mila 26)
30-Sep-2012 Mosquito (Culex pipiens) Dinu et al., GenBank
HG514468 Isolate RO_mo460/2012 639 Romania Danube Delta
(Mila 26)
28-Sep-2012 Mosquito (Culex pipiens) Dinu et al., GenBank
LK022077 Isolate RO_mo292-2013 795 Romania Danube Delta
(Mila 26)
04-Aug-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
LK022078 Isolate RO_mo294/2013 664 Romania Danube Delta
(Mila 26)
04-Aug-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 4 October 2014 | Volume 9 | Issue 10 | e109905
Table 2. Cont.
GenBank acc. no. Designation Length (nt) Country Area
Collection
date Host Reference
LK022079 Isolate RO_mo313-2013 752 Romania Danube Delta
(Mila 26)
05-Aug-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
LK022080 Isolate RO_mo354/2013 673 Romania Danube Delta
(Mila 26)
02-Sep-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
LK022081 1isolate RO_mo531/2013 728 Romania Bucharest 25-Aug-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
HG918026 Isolate RO_hu149704/2013 600 Romania Bucharest 02-Sep-2013 Human (serum) Dinu et al., GenBank
HG918027 Isolate RO_hu149802/2013 562 (length-limiting
sequence)
Romania Fetesti 02-Sep-2013 Human (serum) Dinu et al., GenBank
HG918029 Isolate RO_mo10/2013 705 Romania Danube Delta
(Mila 26)
28-Aug-2013 Mosquito (Coquillettidia richiardii) Dinu et al., GenBank
HG918031 Isolate RO_mo17/2013 681 Romania Danube Delta
(Mila 26)
28-Aug-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
HG918033 Isolate RO_mo34/2013 666 Romania Danube Delta
(Mila 26)
28-Aug-2013 Mosquito (Coquillettidia
richiardii)
Dinu et al., GenBank
HG918036 Isolate RO_mo168/2013 614 Romania Danube Delta
(Mila 26)
02-Sep-2013 Mosquito (Culex pipiens) Dinu et al., GenBank
HG918037 Isolate RO_mo233-2013 582 Romania Danube Delta
(Mila 26)
01-Aug-2013 Mosquito (Culex
pipiens)
Dinu et al., GenBank
doi:10.1371/journal.pone.0109905.t002
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 5 October 2014 | Volume 9 | Issue 10 | e109905
African origin, while the Central/Southern European lineage 2
viruses form an independent clade (Figure 1).
Comparison of the WNV strain obtained in this study with
partial human and mosquito-derived E gene sequences of 10
Russian WNVs obtained between 2007 and 2012 as well as with
partial human- and mosquito-derived NS5 gene sequences of 23
Romanian WNVs obtained between 2011 and 2013 exhibited
both 99–100% nucleotide identities.
The phylogenetic analyses of the partial E gene sequences
(Figure 2) and NS5 gene sequences (Figure 3), respectively,
revealed a single Eastern European lineage 2 WNV cluster of
closely related Russian and Romanian sequences from 2007 to
2013.
Nucleic acid extracts of both cloacal and oral swabs of the bird
which carried the WNV positive tick as well as of its serum were
negative upon the WNV (lin.1+2) RT-qPCR. The serum of this
bird tested weakly-positive by WNV antibody ELISA. The
confirmatory PRNT assay revealed a borderline positive result.
The complete sequence of the newly determined WNV strain,
termed WNV lineage 2 strain Hyalomma/Romania/2013, is
available from GenBank under accession number KJ934710.
The 341bp long 12S rDNA gene sequence of the WNV-positive
Hyalomma tick is available at GenBank under accession number
KJ862057.
Discussion
The first major human WNV epidemic in Europe occurred in
Romania in 1996, with a high rate of neurological symptoms [4].
A WNV lineage 1 was subsequently determined as the cause of this
outbreak, and introduction of this virus by migrating birds from
sub-Saharan Africa was suggested [19]. Interestingly, a closely
related WNV was the etiologic agent of another large outbreak of
WNND in 1999 in the Volgograd region of Russia with more than
800 hospitalized patients [20].
A decade later, a similar sequence of events was noticed, this
time, however, the Volgograd outbreak (2007 [21]) occurred three
years prior to the Romanian outbreak (2010 [5]). A newly
introduced WNV lineage 2 strain was responsible for both
outbreaks. The very close genetic relationship of the Romanian
virus with the Russian Reb_Volgograd_07_H virus has been
demonstrated in the present paper. Sirbu et al. [5] already
reported that a 780 nt long WNV sequence determined from
serum of an affected patient was 99.3% identical to strain
Volgograd_07. In the following years several Romanian partial
WNV sequences within the NS5 gene, obtained from patients and
mosquitoes, were submitted to GenBank (Table 2). Our align
analyses confirmed their close relationships to the above-
mentioned Russian strain and revealed almost 100% nucleotide
identity with the Hyalomma-derived strain determined in this
study. Partial E gene sequences of Russian WNVs isolated
between 2007 and 2012 (Table 2) confirmed the close relationship
Figure 1. Phylogenetic tree of 24 representative WNV lineage 2 complete genomic sequences. The WNV sequence derived from a
Hyalomma marginatum marginatum tick collected from a song thrush in Romania (marked with a black diamond) is most closely related to the
human-derived WNV strain VLG_07 from Russia. All other WNV strains related to this Russian/Romanian cluster originate from Central and South
Africa, suggesting an introduction of this WNV lineage 2 variant from Africa to Europe. The cluster of another independent introduction of a WNV
lineage 2 to Central Europe is also indicated. Black stars indicate sequences for which information was obtained from McMullen et al. [12]. The
percentage of replicates in the bootstrap test (1000 replicates) is shown next to the branches. Values less than 70% are hidden.
doi:10.1371/journal.pone.0109905.g001
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 6 October 2014 | Volume 9 | Issue 10 | e109905
between Russian and Romanian lineage 2 WNV strains, too, and
phylogenetic analyses of both partial E (Figure 2) and NS5
(Figure 3) gene sequences resulted in a distinct Russian/Romanian
WNV lineage 2 genetic cluster, indicating local circulation and
persistence of this WNV cluster in Eastern Europe.
The genetically most similar relatives of the Russian/Romanian
lineage 2 WNV cluster are much older African viruses (Figures 1–
3), suggesting an introduction of this virus from Africa, possibly via
migrating birds. Interestingly, one of these old African WNV
strains was isolated from a tick [12].
A slightly earlier independent introduction of a WNV lineage 2
from Africa to Europe occurred in or before 2004 [10]. This virus
strain also managed toprevail and spread from Central Europe
[22] via the Balkan states [23] to Southern European countries
such as Greece [24] and Italy [25].
Ciccozzi et al. [26] suggested that the WNV lineage 2
introduction to Central Europe took place around 1999, followed
by an independent introduction of another lineage 2 strain to
Russia in the year 2000.
Bucharest and Volgograd are approximately 1,500 km apart,
however, several flightpaths of certain species of birds, e.g. the
song thrush, between these regions exist. It was not possible to
determine whether the captured song thrush was a migrating or
local bird. As a migrant, the song thrush breeds in most of Europe,
and its migration to the Mediterranean starts in late August [27].
Its journey crosses Romania.
Migrating birds have been generally accepted as vehicles
carrying viruses from Africa to Europe. Frequently, however,
viremia lasts for merely a week in birds [2], a period which is
considered too short to introduce exotic viruses to Europe.
Figure 2. Phylogenetic tree of 474 nt long nucleic acid sequences (corresponding to nucleotide positions 1002–1475 of reference
strain Reb_VLG_07_H, GenBank acc. no. FJ425721) within the E gene of the 24 WNV sequences included in Figure 1 and additional
10 WNVs isolated in Russia between 2007 and 2013. Please note the distinct Eastern European lineage 2 WNV cluster consisting of Russian and
Romanian sequences.
doi:10.1371/journal.pone.0109905.g002
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 7 October 2014 | Volume 9 | Issue 10 | e109905
Figure 3. Phylogenetic tree of 466 nt long nucleic acid sequences (corresponding to nucleotide positions 9463–9928 of reference
strain Reb_VLG_07_H, GenBank acc. no. FJ425721) within the NS5 gene of the 24 WNV sequences included in Figure 1 and
additional 23 WNVs identified in Romania between 2011 and 2013. Please note the distinct Eastern European lineage 2 WNV cluster
consisting of Romanian and Russian sequences.
doi:10.1371/journal.pone.0109905.g003
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 8 October 2014 | Volume 9 | Issue 10 | e109905
Ticks are known carriers of viruses. In Israel, a total of 1.6% of
Argas arboreus tick pools collected from wild and domestic birds and
their nests proved WNV-positive, however all Hyalomma species
tested negative [28]. WNV RNA and antigen were also detected in
the tick species Ixodes pavlovskyi and I. persulcatus, which were
collected from small mammals, lizards and birds in the region of
Tomsk, Russia, at an average rate between 5.2 and 11.7% [29].
Depending on the tick species, WNV may persist for a very long time
in ticks, e.g. at least 132 days, as demonstrated by [3].
Experimental infection with WNV performed on four ixodid
tick species in the USA [30] and on H. marginatum ticks in
Portugal [31] revealed that these tick species were able to acquire
the virus from infected animals and to transmit it between various
developmental stages. In case of H. marginatum nymphs and
adults, subsequent virus transmission to uninfected hosts was
observed [31]. H. marginatum is a ‘hard tick species’ occurring in
southern and eastern Europe, South Asia and Africa. It is a
common ectoparasite of – especially passerine – birds. Immature
Hyalomma ticks may remain attached to their vertebrate hosts for
up to four weeks, which enables their passive transport across
continents (http://www.ecdc.europa.eu/en/healthtopics/vectors/
ticks/Pages/hyalomma-marginatum-.aspx). As a two-host species
moulting from larva to nymph on its first host and infesting the
second host as an adult, H. marginatum ticks are able to infest a
broad spectrum of vertebrate hosts including birds [32]–[34] and
humans [35], [36], thereby disseminating WNV infection.
Although H. marginatum usually prefers relatively dry and warm
regions with low humidity, its import to Germany [37], the
Netherlands [38], the United Kingdom [32], and Russia [39] has
already been reported.
In the present study, the song thrush had cleared WNV, as
evidenced by absence of viral RNA in samples of the bird and a
low WNV antibody titer. In the attached tick, however, WNV
persisted.
In the current study one out of 32 investigated ticks proved to be
infected with WNV. However further research is necessary in
order to draw general conclusions regarding the role of ticks in the
introduction of WNV to new areas and as virus reservoir and
bridge-vector.
Conclusions
Infected ticks on migrating birds may carry (new) pathogens to
other areas much more efficiently than their avian hosts. The
determination of the complete sequence of the currently in
Romania circulating WNV strain revealed the most similar genetic
relationship to the neuroinvasive Russian WNV strain Reb_Vol-
gograd_07_H. Based on these sequences, future evolution of the
Eastern European lineage 2 WNV cluster may be monitored.
Acknowledgments
The authors would like to thank Michael Kolodziejek, Dr. Karin Pachler,
Dr. Tamas Bakonyi, Mag. Katharina Dimmel, Dr. Karin Sekulin,
Nicholas Derby and Prof. Zdenek Hubalek for their technical assistance
and general support, respectively, as well as Dr. James O. Rushton for a
final language check.
Author Contributions
Conceived and designed the experiments: JK NN. Performed the
experiments: JK. Analyzed the data: JK. Contributed reagents/materi-
als/analysis tools: MM BK VA. Wrote the paper: JK. Read and revised the
manuscript: MM BK VA NN.
References
1. Huba´lek Z, Halouzka J (1999) West Nile fever – a reemerging mosquito-borne
viral disease in Europe. Emerg Infect Dis 5: 643–650. doi: 10.3201/
eid0505.990505.
2. Reiter P (2010) West Nile virus in Europe: understanding the present to gauge
the future. Euro Surveill 15: 19508. pii = 19508.
3. Lawrie CH, Uzca´tegui NY, Gould EA, Nuttall PA (2004) Ixodid and argasid tick
species and West Nile virus. Emerg Infect Dis 10: 653–657.
4. Tsai TF, Popovici F, Cernescu C, Campbell GL, Nedelcu NI (1998) West Nile
encephalitis epidemic in southeastern Romania. Lancet 352: 767–771.
5. Sirbu A, Ceianu CS, Panculescu-Gatej RI, Vazquez A, Tenorio A, et al. (2011)
Outbreak of West Nile virus infection in humans, Romania, July to October
2010. Euro Surveill 16(2): pii = 19762.
6. Keyes BE, Grue CE (1982) Capturing birds with mist nets: a review. North
American Bird Bander 7(1): 2–14.
7. Kuno G (1998) Universal diagnostic RT-PCR protocol for arboviruses. J Virol
Methods 72(1): 27–41.
8. Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, et al. (2001)
Comparison of flavivirus universal primer pairs and development of a rapid,
highly sensitive heminested reverse transcription-PCR assay for detection of
flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin
Microbiol 39: 1922–1927. doi: 10.1128/JCM.39.5.1922-1927.2001.
9. Weissenbo¨ck H, Kolodziejek J, Url A, Lussy H, Rebel-Bauder B, et al. (2002)
Emergence of Usutu virus, an African Mosquito-Borne Flavivirus of the
Japanese Encephalitis Virus Group, Central Europe. Emerg Infect Dis 8(7): 652–
656. doi: 10.3201/eid0807.020094.
10. Bakonyi T, Ivanics E, Erde´lyi K, Ursu K, Ferenczi E, et al. (2006) Lineage 1 and
2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis 12:
618–623.
11. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA5:
Molecular Evolutionary Genetics Analysis using maximum likelihood, evolu-
tionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–
2739.
12. McMullen AR, Albayrak H, May FJ, Davis CT, Beasley DW, et al. (2013)
Molecular evolution of lineage 2 West Nile virus. J Gen Virol 94: 318–325. doi:
10.1099/vir.0.046888-0.
13. Brault AC, Huang CY, Langevin SA, Kinney RM, Bowen RA, et al. (2007) A
single positively selected West Nile viral mutation confers increased virogenesis
in American crows. Nat Genet 39: 1162–1166.
14. Kolodziejek J, Pachler K, Bin H, Mendelson E, Shulman L, et al. (2013)
Barkedji virus, a novel mosquito-borne flavivirus identified in Culex perexiguus
mosquitoes, Israel, 2011. J Gen Virol 94: 2449–2457. doi: 10.1099/
vir.0.056200-0.
15. Beati L, Keirans JE (2001) Analysis of the systematic relationships among ticks of
the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochon-
drial 12S ribosomal DNA gene sequences and morphological characters.
J Parasitol 87(1): 32–48. doi: http://dx.doi.org/10.1645/0022-
3395(2001)087[0032:AOTSRA]2.0.CO;2.
16. Toma L, Mancini F, Di Luca M, Cecere JG, Bianc hi R, et al. (2014) Detection
of microbial agents in ticks collected from migratory birds in central Italy. Vector
Borne Zoonotic Dis 14: 199–205. doi: 10.1089/vbz.2013.1458.
17. Sikutova´ S, Hornok S, Huba´ lek Z, Doleza´lkova´ I, Juricova´ Z, et al. (2009)
Serological survey of domestic animals for tick-borne encephalitis and Bhanja
viruses in northeastern Hungary. Vet Microbiol 135: 267–271. doi: 10.1016/
j.vetmic.2008.09.082.
18. Rushton JO, Lecollinet S, Huba´ lek Z, Svobodova´ P, Lussy H, et al. (2013) Tick-
borne encephalitis virus in horses, Austria, 2011. Emerg Infect Dis 19(4): 635–
637. doi: 10.3201/eid1904.121450.
19. Savage HM, Ceianu C, Nicolescu G, Karabatsos N, Lanciotti R, et al. (1999)
Entomologic and avian investigations of an epidemic of West Nile fever in
Romania in 1996, with serologic and molecular characterization of a virus
isolate from mosquitoes. Am J Trop Med Hyg 61: 600–611.
20. Platonov AE, Shipulin GA, Shipulina OY, Tyutyunnik EN, Frolochkina TI, et
al. (2001) Outbreak of West Nile virus infection, Volgograd Region, Russia,
1999. Emerg Infect Dis 7: 128–132.
21. Platonov AE, Fedorova MV, Karan LS, Shopenskaya TA, Platonova OV, et al.
(2008) Epidemiology of West Nile infection in Volgograd, Russia, in relation to
climate change and mosquito (Diptera: Culicidae) bionomics. Parasitol Res 103
Suppl 1: S45–53. doi: 10.1007/s00436-008-1050-0.
22. Bakonyi T, Ferenczi E, Erde´ lyi K, Kutasi O, Cso¨rgo˝ T, et al. (2013) Explosive
spread of a neuroinvasive lineage 2 West Nile virus in Central Europe, 2008/
2009. Vet Microbiol 165: 61–70. doi: 10.1016/j.vetmic.2013.03.005.
23. Popovic
´N, Milosˇevic
´B, Urosˇevic
´A, Poluga J, Lavadinovic
´L, et al. (2013)
Outbreak of West Nile virus infection among humans in Serbia, August to
October 2012. Euro Surveill 18(43). pii: 20613.
24. Papa A, Bakonyi T, Xanthopoulou K, Va´ zquez A, Tenorio A, et al. (2011)
Genetic characterization of West Nile virus lineage 2, Greece, 2010. Emerg
Infect Dis 17: 920–922. doi: 10.3201/eid1705.101759.
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 9 October 2014 | Volume 9 | Issue 10 | e109905
25. Bagnarelli P, Marinelli K, Trotta D, Monachetti A, Tavio M, et al. (2011)
Human case of autochthonous West Nile virus lineage 2 infection in Italy,
September 2011. Euro Surveill 16(43). pii: 20002.
26. Ciccozzi M, Peletto S, Cella E, Giovanetti M, Lai A, et al. (2013)
Epidemiological history and phylogeography of West Nile virus lineage 2.
Infect Genet Evol 17: 46–50. doi: 10.1016/j.meegid.2013.03.034.
27. Clement P, Hathway R, Wilczur J. (2000) Thrushes (Helm Identification
Guides). Christopher Helm Publishers Ltd. 392–395.
28. Mumcuoglu KY, Banet-Noach C, Malkinson M, Shalom U, Galun R (2005)
Argasid ticks as possible vectors of West Nile virus in Israel. Vector Borne
Zoonotic Dis 5: 65–71. doi:10.1089/vbz.2005.5.65.
29. Moskvitina NS, Romanenko VN, Ternovoı˘ VA, Ivanova NV, Protopopova EV,
et al. (2008) Detection of the West Nile virus and its genetic typing in ixodid ticks
(Parasitiformes: Ixodidae) in Tomsk City and its suburbs. Parazitologiia 42: 210–
225. [Article in Russian].
30. Anderson JF, Main AJ, Andreadis TG, Wikel SK, Vossbrinck CR (2003)
Transstadial transfer of West Nile virus by three species of ixodid ticks (Acari:
Ixodidae). J Med Entomol 40: 528–533.
31. Formosinho P, Santos-Silva MM. (2006) Experimental infection of Hyalomma
marginatum ticks with West Nile virus. Acta Virol 50: 175–180.
32. Jameson LJ, Morgan PJ, Medlock JM, Watola G, Vaux AG (2012) Importation
of Hyalomma marginatum, vector of Crimean-Congo haemorrhagic fever virus,
into the United Kingdom by migratory birds. Ticks Tick Borne Dis 3(2): 95–99.
doi: 10.1016/j.ttbdis.2011.12.002.
33. Toma L, Mancini F, Di Luca M, Cecere JG, Bianc hi R, et al. (2014) Detection
of microbial agents in ticks collected from migratory birds in central Italy. Vector
Borne Zoonotic Dis 14(3): 199–205. doi: 10.1089/vbz.2013.1458.
34. Hagman K, Barboutis C, Ehrenborg C, Fransson T, Jaenson TG, et al. (2014)
On the potential roles of ticks and migrating birds in the ecology of West Nile
virus. Infect Ecol Epidemiol 15(4). doi: 10.3402/iee.v4.20943.
35. Papa A, Chaligiannis I, Xanthopoulou K, Papaioakim M, Papanastasiou S, et al.
(2011) Ticks Parasitizing Humans in Greece. Vector-Borne and Zoonotic Dis
11(5): 539–542. doi:10.1089/vbz.2010.0036.
36. Bursali A, Tekin S, Keskin A, Ekici M, Dundar E (2011) Species diversity of
ixodid ticks feeding on humans in Amasya, Turkey: seasonal abundance and
presence of Crimean-Congo hemorrhagic fever virus. J Med Entomol 48(1): 85–
93.
37. Kampen H, Poltz W, Hartelt K, Wolfel R, Faulde M (2007) Detection of a
questing Hyalomma marginatum marginatum adult female (Acari, Ixodidae) in
southern Germany. Exp Appl Acarol. 2007; 43(3): 227–231.
38. Nijhof AM, Bodaan C, Postigo M, Nieuwenhuijs H, Opsteegh M, et al. (2007)
Vector-Borne and Zoonotic Dis 7(4): 585–596. doi:10.1089/vbz.2007.0130.
39. Movila A, Alekseev AN, Dubinina HV, Toderas I (2013 Detection of tick-borne
pathogens in ticks from migratory birds in the Baltic region of Russia. Med Vet
Entomol 27(1): 113–117.
West Nile Virus Lineage 2, Romania, 2013: Phylogenetic Analysis
PLOS ONE | www.plosone.org 10 October 2014 | Volume 9 | Issue 10 | e109905
