Abscisic acid regulates root hydraulic conductance via aquaporin expression modulation in Nicotiana tabacum.

Abstract

Abscisic acid (ABA) modifies the hydraulic properties of roots by increasing root water flux. The effects of ABA on aquaporin content and root hydraulic conductance are controversial. We addressed these effects via a combination of experiments. Tobacco (Nicotiana tabacum) plants were grown hydroponically, and ABA (1 microM) was exogenously applied to the roots. Then, the water transport properties of tobacco roots and expression of PIP-type aquaporins were examined. ABA increased the sap flow rate (Jv) and also the osmotic root hydraulic conductance (Lp(r-o)) of excised tobacco roots after 24h. The expression of three aquaporin PIP-type genes and PIP1s proteins abundance in tobacco roots were analyzed by real-time PCR and protein gel blot analysis, respectively. Interestingly, the accumulation of NtAQP1, NtPIP1;1 and NtPIP2;1 transcripts and NtPIP1;1 and NtAQP1 proteins abundance was significantly increased. Although the antibody used recognize NtPIP1;1 and NtAQP1, most probably it also recognizes other PIP1 proteins present in tobacco. Thus, the increase in the expression of the three PIP-type genes and other PIP1s proteins abundance caused by ABA were correlated with an increase in Lp(r-o) and Jv. ABA therefore facilitated the cell-to-cell component of water transport across the root cylinder. The subcellular localization of NtPIP1;1- and NtPIP2;1-GFP was investigated by protoplast transformation with chimeric gene, showing NtPIP2;1 localization in plasma membrane and NtPIP1;1 retention in the endoplasmic reticulum (ER). However, ABA did not change subcellular localization of NtPIP1;1 from ER to plasma membrane.

Full text

Page 1

Journal of Plant Physiology ] (]]]]) ]]]—]]]
Abscisic acid regulates root hydraulic
conductance via aquaporin expression
modulation in Nicotiana tabacum
Majid Mahdieha,?, Akbar Mostajeranb
aDepartment of Biology, Arak University, Shahid Beheshti Street, P.O. Box 879, Arak, Iran
bDepartment of Biology, University of Isfahan, Hezar Jerib Street, Postal code: 81746-7344, Isfahan, Iran
Received 22 December 2008; received in revised form 27 May 2009; accepted 9 June 2009
KEYWORDS
Abscisic acid;
Aquaporin;
Nicotiana tabaccum;
Osmotic root
hydraulic
conductance;
Sap flow rate
Summary
Abscisic acid (ABA) modifies the hydraulic properties of roots by increasing root
water flux. The effects of ABA on aquaporin content and root hydraulic conductance
are controversial. We addressed these effects via a combination of experiments.
Tobacco (Nicotiana tabacum) plants were grown hydroponically, and ABA (1mM) was
exogenously applied to the roots. Then, the water transport properties of tobacco
roots and expression of PIP-type aquaporins were examined. ABA increased the sap
flow rate (Jv) and also the osmotic root hydraulic conductance (Lpr-o) of excised
tobacco roots after 24h. The expression of three aquaporin PIP-type genes and PIP1s
proteins abundance in tobacco roots were analyzed by real-time PCR and protein gel
blot analysis, respectively. Interestingly, the accumulation of NtAQP1, NtPIP1;1 and
NtPIP2;1 transcripts and NtPIP1;1 and NtAQP1 proteins abundance was significantly
increased. Although the antibody used recognize NtPIP1;1 and NtAQP1, most
probably it also recognizes other PIP1 proteins present in tobacco. Thus, the increase
in the expression of the three PIP-type genes and other PIP1s proteins abundance
caused by ABA were correlated with an increase in Lpr-oand Jv. ABA therefore
facilitated the cell-to-cell component of water transport across the root cylinder.
The subcellular localization of NtPIP1;1- and NtPIP2;1-GFP was investigated by
protoplast transformation with chimeric gene, showing NtPIP2;1 localization in
plasma membrane and NtPIP1;1 retention in the endoplasmic reticulum (ER).
However, ABA did not change subcellular localization of NtPIP1;1 from ER to plasma
membrane.
& 2009 Elsevier GmbH. All rights reserved.
ARTICLE IN PRESS
www.elsevier.de/jplph
0176-1617/$-see front matter & 2009 Elsevier GmbH. All rights reserved.
doi:10.1016/j.jplph.2009.06.001
Abbreviations: ABA, abscisic acid; ER, endoplasmic reticulum; GFP, green fluorescence protein; Jv, sap flow rate; Lpr-o, osmotic root
hydraulic conductance; PIPs, plasma membrane intrinsic proteins.
?Corresponding author.
E-mail address: m_mahdiyeh53@yahoo.com (M. Mahdieh).
Please cite this article as: Mahdieh M, Mostajeran A. Abscisic acid regulates root hydraulic conductance via aquaporin expression
modulation in Nicotiana.... J Plant Physiol (2009), doi:10.1016/j.jplph.2009.06.001

Page 2

Introduction
The synthesis of abscisic acid (ABA) is enhanced
in response to soil water deficit, causing the
rapid closure of stomates and thereby decreasing
the intensity of the transpiration stream. In
addition, ABA, which is involved in long-distance
signaling between root and shoot (Davies and
Zhang, 1991) may directly affect the hydraulic
conductivity ofboth root
(Quintero et al., 1999; Morillon and Chrispeels,
2001; Aroca et al., 2003). Investigations of the role
of ABA have been concerned principally with the
leaves and, in particular, with stomatal responses
(Hetherington andMcAinsh,
there is less information documented related to
its role in roots especially in regulation of hydraulic
conductivity and water flux in roots. In a few
studies, exogenous ABA had no effect or a negative
effect on hydraulic conductivity (Wan and Zwiazek,
2001; Aroca et al., 2003), while in others a positive
effect has been observed at both the cell level
(Hose et al., 2000; Wan et al., 2004; Lee et al.,
2005) and the whole root level (Quintero et al.,
1999; Sauter et al., 2002; Schraut et al., 2005).
However, these responses were transient (Hose
et al., 2000) and were positive or negative
depending on the ABA concentration (Beaudette
et al., 2007).
A number of studies carried out with decapitated
root systems show that ABA applied to the roots
increases the exudation volume from the cut stump
of the stem by increasing the hydraulic conductivity
of the root system as much as two-fold. Thus, ABA
functions to allow faster uptake of water by the
roots and better transport of water within the plant
(Glinka, 1980; Ludewig et al., 1988; Quintero
et al., 1999). This effect of ABA appears to be
rapid (within 30min) and long lasting (Ludewig
et al., 1988).
Water that moves through living tissues can
follow an apoplastic or cell-to-cell path (Steudle,
2000). When the rate of water flow is high (open
stomates, high Dc), water flows mostly along the
apoplastic pathway and less around the protoplasts
because the apoplastic pathway has the lower
hydraulic resistance. Conversely, when the rate
of water flow is small, a larger proportion of water
follows the cell-to-cell path and needs to pass
through cellular membranes (and possibly through
plasmodesmata). Water flow along this pathway has
a much higher hydraulic resistance and can be
modulated by aquaporins proteins that facilitate
transmembrane water transport (Tyerman et al.,
1999; Johansson et al., 2000; Maurel and Chris-
peels, 2001).
andshoot tissues
1998).However
In plants, aquaporins form a family of 35–37
sequence-relatedproteins
2001; Johanson et al., 2001; Sade et al., 2009)
that mediate the transport of water and neutral
solutes, such as glycerol, across membranes.
Aquaporins have been found in the tonoplast
(vacuolar membrane) and the plasma membrane,
and many among them can increase the osmotic
water permeability (Pos) of the Xenopus laevis
oocyte plasma membrane by 10–20-fold. Sequence
comparisons show that aquaporins fall into four
different clades, and the plasma membrane in-
trinsic protein (PIP) clade has about a dozen
members (Chaumont et al., 2001; Johanson et al.,
2001; Sade et al., 2009).
Application of the cell-pressure probe allows a
direct approach to studying the effect of ABA
on transmembrane water transport. With this
technique, Hose et al. (2000) investigated the
effect of ABA on the hydraulic conductivity of
maize roots and cortex cells. They found that ABA
facilitates the cell-to-cell component of water
transport across the root cylinder. The effects on
cellular hydraulic conductivity were large (7–27-
fold) but highly transient and postulated to be
mediated by aquaporins. Wan et al. (2004) mea-
sured the root hydraulic conductivity of maize
root cortical cells using the cell-pressure probe
and concluded that ABA may stabilize aquaporins
in plasmamembranes
collapse during the passage of water through
the pores. Others have suggested that ABA-
dependent gene expression of aquaporins could
play an important role in regulating aquaporin
density/frequency and root Lp (Kaldenhoff et al.,
1996, 1998). However, studies with transgenic
plants that exhibit either low or high amounts
of aquaporins did not support this idea (Hose,
2000).
To understand how ABA regulates the root
hydraulic conductivity of tobacco plants, we
analyzed aquaporin expression and also their
redistribution by ABA. There are rare studies in
which the effects of ABA on root hydraulic
conductivity and aquaporins expression have been
measured at the same time (Aroca et al., 2006,
2008; Beaudette et al., 2007). To assess the
contribution of aquaporins in response to exogen-
ous ABA and to identify isoform-specific roles,
the transcriptional regulation of the three PIP-
type genes and NtPIP1s proteins abundance in
tobacco roots was approached using quantitative
real-time PCR and protein gel blot analysis,
respectively. In addition, the role of ABA in
redistribution of aquaporins in cells also was
investigated.
(Chaumontetal.,
and mayavert their
ARTICLE IN PRESS
M. Mahdieh, A. Mostajeran2
Please cite this article as: Mahdieh M, Mostajeran A. Abscisic acid regulates root hydraulic conductance via aquaporin expression
modulation in Nicotiana.... J Plant Physiol (2009), doi:10.1016/j.jplph.2009.06.001

Page 3

Material and methods
Plant materials
Nicotiana tabacum (L.) cv. Samsun was grown in a
growth chamber (Sanyo, Japan) under controlled
environmental conditions with a 14h light/10h
dark cycle (light intensity of 150mEm?2s?1), a
25/201C light/dark temperature regime and 60%
relative humidity. Tobacco seeds were germinated
in end-cut 1.5mL centrifuge tubes filled with 0.65%
agar, and then they were dipped into the half-
strength Hoagland’s nutrient solution (Hoagland
and Arnon, 1950). About two weeks after germina-
tion, healthy seedlings were transferred to an
aerated hydroponics’ culture system and further
grown with a change of full-strength nutrient
solution of every 48h. ABA (1mM) was applied
to the roots 2h after the lights were turned on.
Then the root samples were collected 24h after-
ward (Aroca et al., 2003) and all parameters
were measured. Experiments were performed in a
completely randomized design with six replica-
tions.
Sap flow rate (Jv) and osmotic root hydraulic
conductance (Lpr-o)
Sap flow rate (Jv) and osmotic root hydraulic
conductance (Lpr-o) was measured in detached root
systems exuding under atmospheric pressure ac-
cording to Aroca et al. (2005). Briefly, shoots were
removed, leaving the base of the stem connected
to a dry 50mL glass micropipette using silicone
grease. The exudates in the first 15min were
discarded and then the exudates of the following
1h were collected with a syringe, and sample
was weighted. Roots were removed and dried
in 701C. Sap flow rate (Jv) was expressed in
mgg?1rootDWh?1. The osmolarity of the sap and
the nutrient solution was determined using a vapor
pressure osmometer (VAPRO 5520, Wescor Inc.,
Utah, USA). Osmotic root conductance (Lpr-o) was
calculated as Lpr-o¼ sJv/Dc., where Jv is the
exuded sap flow rate, Dc is the osmotic potential
difference between the exuded sap and nutrient
solution and s is root reflection coefficient (E1)
(Steudle, 2000). Measurements were started after
2h when the lights were turned on.
Gene expression analysis by real-time PCR
Root and leaf tissues were collected from
different treatments and were immediately frozen
in liquid nitrogen. Total RNA was isolated using the
RNeasy Plant Mini Kit (Qiagen Sciences, Maryland,
USA) following the manufacturer recommended
procedure. After an initial photometric determina-
tion of total RNA concentration, ethidium bromide
fluorescence of ribosomal bands on the electro-
phoresis-gel was used for the control of total
RNA integrity and the adjustment of equal RNA
amounts.
Gene expression was studied by the quantitative
real-time RT-PCR technique. The PCR primer
sets were generated by using the Primer Express
Software v. 3.0 (Applied Biosystems, Foster City,
CA, USA) (see Mahdieh et al., 2008).
First strand cDNA synthesis was performed using
the High Capacity cDNA Archive Kit (Applied
Biosystems, Foster city, CA, USA). Quantitative
PCR was performed on the 7300 real-time PCR
machine (Applied Biosystems, Foster city, CA, USA)
with PCR conditions of 501C for 2min, 951C for
10min, 40 cycles of 951C for 15s and 601C for
1min. For absolute quantification of transcript
copy numbers, the partial sequence of the genes
in their 30UTR was cloned into the TOPO TA cloning
vector (Invitrogen, Carlsbad, CA). Complementary
RNA was generated using the MEGA ScriptsT7 Kit
(Ambion, Austin, TX, USA). A serial dilution of the
cRNA of known copy number (105–109, calculated
from the size and molecular weight of cRNA)
was reverse transcribed. The first strand cDNA
from cRNA was used as standard to determine
the absolute transcript copy number of the gene in
a given microgram total RNA of the sample.
Transcript copy numbers were quantified from more
than three replicates and two independent experi-
ments were conducted (Mahdieh et al., 2008).
Protein isolation and gel blot analysis
Proteins of the roots were extracted in homo-
genization buffer (330mM sucrose, 100mM KCl,
1mM EDTA, 50mM TRIS, 0.05% MES, 5mM DTT,
Completesproteinase inhibitor cocktail (Roche
Mannheim), pH 7.5). The homogenate was centri-
fuged at 1000g for 15min to collect cells and
debris, and the supernatant was centrifuged at
10,000g for 15min to collect the large cellular
organelles. Finally, the microsomal fraction was
pelleted by centrifugation at 20,000g for 75min.
The microsomal pellet was dissolved in membrane
buffer (330mM sucrose, 200mM DTT, 25mM TRIS,
pH 8.5) (Bots et al., 2005).
For the protein gel blot analysis, 15mg of proteins
were separated by 12% SDS–PAGE. The proteins
were electro blotted onto a nitrocellulose mem-
brane in 39mM glycine, 48mM TRIS base, 0.037%
ARTICLE IN PRESS
Please cite this article as: Mahdieh M, Mostajeran A. Abscisic acid regulates root hydraulic conductance via aquaporin expression
modulation in Nicotiana.... J Plant Physiol (2009), doi:10.1016/j.jplph.2009.06.001

Page 4

SDS, 20% methanol, pH 8.3. For detection, the
membranes were first blocked in blocking buffer
(5% non-fat dried milk in PBT) for 2h, after which
they were incubated for 2h with the PIP1 immune
serum (1:1000 in blocking buffer) (Biela et al.,
1999). After incubation with the primary antibody,
the membranes were rinsed and incubated with the
secondary antibody, alkaline phosphatase conju-
gated goat anti-rabbit antibody (Zymed labora-
tories, Invitrogen) 1:10,000 in blocking buffer
for 1h. All incubations were performed at room
temperature. The membranes were developed
using NBT/BCIPsolution
graphed and normalized against the intensity of
the corresponding whole Coomassie brilliant blue
band.
(Boehringer),photo-
Tobacco leaf mesophyll protoplast isolation
Five centimeter long tobacco leaves from 3- to
4-week-old plants grown in vitro were harvested
under sterile conditions and their lower face was
abrased with sandpaper no. 1200. The leaves were
then laid in Petri dishes containing 10mL of the
sterilized digestion EF medium (0.125% macero-
zyme R-10(Yakult Pharmaceutical;
Japan), 0.2% cellulose R-10 (Yakult Pharmaceutical;
Onozuka, Japan), 5mM CaCl2, 0.5M sucrose, 0.1%
BSA, 2.5mM MES–HCl, pH 5.2) for 19h in the dark at
251C. After digestion, undigested pieces of leaves
were removed and 4mL of floating MLO6 medium
were added (15mM CaCl2, 600mM sucrose, 7.5mM
MES–KOH pH 6.0). The protoplast suspension was
then filtered through a 100mm nylon filter and
centrifuged at 110g for 7min in a swinging rotor.
The protoplasts localized in the floating band were
harvested and diluted with 4 volumes of autoclaved
washing W5 medium (154mM NaCl, 125mM CaCl2,
5mM KCl, 5mM glucose and 1.5mM MES–KOH, pH
5.6). The cells were then pelleted (110g for 7min
in a swinging rotor) and washed in 40mL and then
in 20mL of ‘‘mannitol/Mg’’ solution (15mMMgCl2,
400mM mannitol, 5mM MES–KOH pH 5.6). Proto-
plasts were finally resuspended in Mannitol/Mg
solution at a concentration of 106cellsmL?1(Hosy
et al., 2005).
Onozuka,
Subcellular localization of NtPIPs-GFP in
mesophyll protoplast and effect of ABA on
their redistribution
To generate NtPIP1;1 and NtPIP2;1 fused with
GFP at the C-terminal, NtPIP1;1 and NtPIP2;1
cDNAs were amplified by PCR using Taq DNA
polymerase. The specific primers used were:
NtPIP1;1 F (50CGCTCGAGATGGCAGAAAACAAAGAAG
30), NtPIP1;1 R (50CGACTAGTGCTCTTGAATGGAAT-
GGC 30), NtPIP2;1 F (50CGCTCGAGATGTCAAAGGAC-
GTGATTG 30) and NtPIP2;1 R (50CGACTAGTGTTG-
GTTGGGTTACTGCG 30), by which, a XhoI and a SpeI
site are attached at the 50and 30end of the cDNA,
respectively. The plasmid used for aquaporin
targeting contained expression cassette GFP-JFH-
1 allowing the transient expression of a aquaporin
fused in its C-terminal part to the GFP protein. The
XhoI and SpeI restriction sites were used to clone
upstream the GFP, the NtPIP1;1 and NtPIP2;1 cDNA
deprived of their stop codons by PCR. Leaf
protoplasts were isolated and transformed with
NtPIP2;1 or NtPIP1;1-GFP and YFP-HEDL (ER marker)
constructs, according to Hosy et al. (2005).
Briefly, in an Eppendorf tube, 150mL of the
concentrated protoplasts and 150mL of PEG solu-
tion (25% w/v PEG 6000, 0.45M mannitol, 0.1M
Ca(NO3)2, pH 9.0) were added to 5mg of plasmidic
DNA from the construction to be tested and
incubated at room temperature for 30min. The
sample was then diluted with 8mL of K3M medium
supplemented with 0.45M glucose (Negrutiu et al.,
1992) and pelleted in a swinging rotor (7min at
110g). The protoplasts were finally suspended
in 3mL of K3M and incubated for 12–38h at 191C
in the dark before analysis.
Transformed protoplasts were treated with ABA
solution (1mM) or without ABA for 24h. During
24h, GFP fluorescence of control and ABA-treated
protoplasts were monitored using a BioZero laser
scanning microscope (objective lens ?40, BZ-
8000, KEYENCE Corporation, Japan) with 470nm
excitation and 535nm emission filters. For captur-
ing of YFP fluorescence of coexpressing protoplasts,
the 514nm excitation and 539/590nm emission
filters were used. Also, for catching the FM4-64
fluorescence, in NtPIP2;1-GFP expressing proto-
plasts, an excitation wavelength of 515nm and
a detection one above 640nm were used. Plasma
membrane FM4-64 labeling was performed by
incubating the protoplasts on ice 10min in the
culture medium supplemented with 50mM FM4-64.
Results and discussion
Osmotic root hydraulic conductance
To understand the effects of ABA on root
hydraulic conductivity, we applied ABA at 1mM on
tobacco roots and after 24h, the osmotic root
hydraulic conductance (Lpr-o) and sap flow rate (Jv)
were measured.
ARTICLE IN PRESS
M. Mahdieh, A. Mostajeran4
Please cite this article as: Mahdieh M, Mostajeran A. Abscisic acid regulates root hydraulic conductance via aquaporin expression
modulation in Nicotiana.... J Plant Physiol (2009), doi:10.1016/j.jplph.2009.06.001

Page 5

ABA treatment caused a significant increase in
Jv (Po0.05, Duncan test) from 1135.37111 to
2330.457270mgg?1rootDWh?1(Figure 1A). Lpr-o
was also increased from 59237776 to 226497
3014mgg?1rootDWh?1MPa?1due to ABA applica-
tion (Figure 1B). The osmotic potential gradient
between the nutrient solution and the point of
exudation (Dc) also were measured. ABA reduced
this gradient significantly (Po0.05, Duncan test)
(Figure 1C).
According to the composite model of water
transport, developed by Steudle et al. (1999) over
the last 10 years water transport through the plant
can follow either an apoplastic path or a cell-to-
cell path. How much water travels along each
pathway depends on the magnitude of soil moisture
content and consequently the total water flow and
especially the nature of the driving forces. When
the stomatal pores are open and soil moisture is
adequate there are strong potential gradients
because of evaporative demand and hence, water
flows largely around the protoplasts because this is
the path of least hydraulic resistance. In the
absence of transpiration, water moves cell-to-cell
by osmotic forces through semi-permeable mem-
branes; membranes provide a variable resistance to
water flow depending on the abundance and
activity of aquaporins or water channel proteins.
Osmotic root hydraulic conductance (Lpr-o) can
be considered as an index of water flow via cell-to-
cell pathways. Thus, results shown in Figure 1A and
B strongly suggest that water permeability of root
cells were profoundly increased in response to ABA.
ABA treatment raised Lpr-o. The effect of ABA is to
dramatically increase the cell-to-cell flow rate.
Results examiningthe
ABA and root Lp are contrasting. Davies et al.
(1982) observed an ABA stimulated water uptake
by excised wheat roots under low water flux
conditions, but no increase was observed when
there were initially high flux rates. Also, there was
a decrease in the hydraulic conductivity (Lpr-o)
when the whole root system was measured. ABA
had no effect on the root Lp of aspen (Populus
associationbetween
ARTICLE IN PRESS
*
0
0.05
0.1
0.15
0.2
0.25
Δψ (Mpa)
Control ABA
*
0
500
1000
1500
2000
2500
3000
Control
Jv (mg g-1h-1)
*
0
5000
10000
15000
20000
25000
30000
Control
Lpr-o (mg g-1h-1Mpa-1)
ABAABA
Figure 1. Increases in sap flow rate, Jv (A) and osmotic root hydraulic conductance, Lpr-o(B) and decrease in Dc (C) of
tobacco plants that exposed to 1mM ABA for 24h. Roots of 30-days-old tobacco plants were cut and the sap flow rate
and hydraulic conductance were measured (For detail, see the materials and methods). Data represent the means
values 7SE (n ¼ 6) (Duncan test, Po0.05).
Please cite this article as: Mahdieh M, Mostajeran A. Abscisic acid regulates root hydraulic conductance via aquaporin expression
modulation in Nicotiana.... J Plant Physiol (2009), doi:10.1016/j.jplph.2009.06.001