Rapid detection of point mutations in Plasmodium falciparum genes associated with antimalarial drugs resistance by using High-Resolution Melting analysis.

Abstract

We have developed a High-Resolution DNA Melting method to detect mutations related to Plasmodium falciparum resistance. This method is based on real-time PCR followed by High Resolution Melting ramping from 67 degrees C to 80 degrees C with fluorescence data acquisition set at 0.1 degrees C increments. The accuracy of the technique was assessed using 177 P. falciparum clinical isolates and two reference strains. Results perfectly matched those obtained by DNA sequencing for some important genetic markers of P. falciparum resistance. This technique could be of great value for epidemiological studies, especially in developing countries.

Full text

Page 1

Rapid detection of point mutations in Plasmodium falciparum genes associated with
antimalarial drugs resistance by using High-Resolution Melting analysis
Valérie Andriantsoanirinaa, Vincent Lascombesa, Arsène Ratsimbasoab, Christiane Bouchierc,
Jonathan Hoffmand, Magali Tichitc, Leon-Paul Rabarijaonab, Rémy Durande, Didier Ménarda,⁎
aMalaria Unit Research, Institut Pasteur de Madagascar, Antananarivo, Madagascar
bEpidemiology Unit, Institut Pasteur de Madagascar, Antananarivo, Madagascar
cGenomics Platform, Institut Pasteur, Paris, France
dVirology Unit, Institut Pasteur de Madagascar, Antananarivo, Madagascar
eParasitology–Mycology Laboratory, AP-HP, Avicenne Hospital, Paris, France
a b s t r a c ta r t i c l e i n f o
Article history:
Received 28 February 2009
Received in revised form 15 May 2009
Accepted 15 May 2009
Available online 22 May 2009
Keywords:
Antimalarial drug resistance
Genotyping
HRM
Malaria
Plasmodium falciparum
Real-time PCR
SNP
We have developed a High-Resolution DNA Melting method to detect mutations related to Plasmodium
falciparum resistance. This method is based on real-time PCR followed by High Resolution Melting ramping
from 67 °C to 80 °C with fluorescence data acquisition set at 0.1 °C increments. The accuracy of the technique
was assessed using 177 P. falciparum clinical isolates and two reference strains. Results perfectly matched
those obtained by DNA sequencing for some important genetic markers of P. falciparum resistance. This
technique could be of great value for epidemiological studies, especially in developing countries.
© 2009 Elsevier B.V. All rights reserved.
1. Background
Plasmodium falciparum, the most lethal malaria parasite in hu-
mans, remains a public health disaster causing morbidity and mor-
tality in many developing countries (Snow et al., 2005). The use of
antimalarial drugs is one main tool to fight malaria. A critical problem
limiting malaria treatment is the emergence and spread of parasite
resistant to most antimalarial drugs currently in use (Olliaro, 2005).
Three complementary approaches are used to monitor drug resis-
tance: follow-up of therapeutic failures by clinical trials, phenotypic
determination of parasite sensitivity by short-term in vitro culture
assay, and study of prevalence of molecular markers associated with
drug resistance. The molecular basis of some antimalarial drugs has
been largely elucidated (Le Bras and Durand, 2003). For instance,
the presence of a S108N mutation in dihydrofolate reductase (Pfdhfr)
gene confers a resistance to pyrimethamine and additional muta-
tions (N51I, C59R and I164L) increase level of resistance to pyrimeth-
amine and other antifolates (Plowe et al., 1998). Mutations in the
dihydropterotate synthase (Pfdhps) gene (S436A, A437G, K540E,
A581GandA613T/S)areassociated withresistancetosulphonamides.
A set of mutations in Pfcrt gene (K76T being the most important) is
associated with chloroquine resistance (Wellems and Plowe, 2001).
Mutations in Pfmdr1 gene (N86Y, Y184F, S1034C, N1042D and D1246Y)
may alter the parasite susceptibility to chloroquine, mefloquine,
halofantrine, quinine and artemisinins (Reed et al., 2000).
Many methods for detecting single nucleotide polymorphisms
(SNPs) have been developed. PCR/RFLP methods, though frequently
used, especially in under-equipped laboratories in developing coun-
tries, are labor-intensive and suffer from low throughput (Wilson
et al., 2005). Among other methods, DNA sequencing, pyrosequencing
(Zhou et al., 2006), allele specific oligonucleotide probes (Saiki et al.,
1986), molecular beacons (Durand et al., 2000; Durand et al., 2002)
and primer extension are occasionally used (Nair et al., 2002). All
those methods have their inherent strengths and drawbacks. Real-
time PCR, an alternative approach for mutations detection, is based on
the detection and quantification of a fluorescent reporter (Lee et al.,
1993; Livak et al., 1995; Wilson et al., 2005). The signal increases in
direct proportion to the amount of PCR products in a reaction. This
method enables high throughput and reduces the chance of carryover
contamination. Several chemistries as intercalating dyes (Syber-
Green), hybridization probes (molecular beacons, FRET) and hydro-
lyze probes (TaqMan probes) can be used. A recent development in
real-time PCR technology is High-Resolution DNA Melting (HRM),
which enables the evaluation of nucleic acid sequences by their
Journal of Microbiological Methods 78 (2009) 165–170
⁎ Corresponding author. Unité d'Immunologie Moléculaire des Parasites, Institut
Pasteur, 28 rue du Dr ROUX, 75724 Paris Cedex 15, France. Tel.: +33 1 40 61 35 55.
E-mail address: dmenard@pasteur.fr (D. Ménard).
0167-7012/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.mimet.2009.05.013
Contents lists available at ScienceDirect
Journal of Microbiological Methods
journal homepage: www.elsevier.com/locate/jmicmeth

Page 2

dissociationprofiles upon increasing temperatures (Zhou et al., 2005).
An amplification of the template is carried out in the presence of
intercalating dye and amplification products are submitted to a melt
step. The melting profile and SNPs genotyping are determined auto-
matically from an integrated software analysis (Herrmann et al., 2006;
Liew et al., 2004; Reed and Wittwer, 2004). Several teams have
already published the successful use of HRM for high throughput
mutation detection (Tajiri-Utagawa et al., 2009), methylation levels
quantification and screening (Kristensen and Dobrovic, 2008), and
other applications (Chateigner-Boutin and Small, 2007). This technol-
ogy was applied to various areas including infectious agents such as
bacteria (Stephens et al., 2008), viruses (Tajiri-Utagawa et al., 2009)
and parasites (Pangasa et al., 2009). In the present study, we have
developed a HRM protocol using EvaGreen™ dye to detect SNPs
associated with P. falciparum resistance.
2. Materials and methods
2.1. Reference strains and clinical samples
The reference strains DNA (3D7 and W2) were provided by the MR4
(American Type Culture Collection, Manassas, VA). P. falciparum clinical
isolates were collected from malaria patients seeking malaria treatment
at health government centres in Madagascarandthe Comoros Islands in
2006/2007, from sites involved in the national network for the
surveillance of malaria resistance (RER — Réseau d'Etude de la
Résistance) (Ménard et al., 2008). These samples were collected during
a study (registration number: ISRCTN36517335) whose protocol was
reviewed and approved 108 by the Ethics Committee of the Ministry of
Health of Madagascar (No. 007/SANPF/2007). Venous blood samples,
collectedinEDTAtubes,weretransportedtotheMalariaResearchUnitof
thePasteurInstituteofMadagascarinAntananarivoat+4°Cwithin48h
ofcollection.Bloodsmearswerestainedwith10%Giemsafor10minand
were examined to check for mono-infection with P. falciparum. Parasite
densities were determined from thick blood smears.
2.2. DNA extraction and SNPs analysis by using HRM
DNA extraction was performed on 100 µl of blood as previously
described (Rakotonirina et al., 2008). The analysis of the SNPs,
associated with P. falciparum antimalarial drug resistance, was focused
in Pfdhfr gene (codons 51, 59, 108 and 164), in Pfdhps gene (codons
436, 437 and 540), in Pfcrt gene (codons 72–76) and in Pfmdr1 gene
(codon 86). For each real-time PCR, four pairs of primers were
designed, using primer3 software (http://frodo.wi.mit.edu), in order
to have a size of amplicons ranging from 100 to 200 base pairs, the
mutation(s) being located towards the middle. The optimization of
each real-time PCR reaction was performed with all the possible
combinations of forward and reverse primers. We have selected
primers pairs giving the most distinctive curves between wild and
mutant alleles. The sequences of these selected primers are given in
Table 1. DNA concentration was determined by the Quant-iT Pico-
Green dsDNA™ Reagent and kits (Invitrogen®, Cergy Pontoise, France)
according to the manufacturer's instructions. The nucleic acid
measurement and real-time amplification followed by HRM were
performed using the Rotor-Gene™ 6000 (Corbett Life Science®,
Sydney, Australia). All the PCR reactions were generated in 25 µl
final volume, which contained 12.5 µl of SensiMix HRM™ (Quantace®,
London, United Kingdom) with 0.5 µl of the intercalating dye
EvaGreen™, 0.25 nM of each primer and 0.3 ng of DNA. The PCR
cycling conditions were 95 °C for 10 min followed by 45 cycles with
denaturation step at 95 °C for 20 s, annealing at 50 °C (Pfmdr-186) or
55 °C (Pfdhfr 164, Pfdhps 436/437) or 57 °C for 20 s (Pfcrt 76, Pfdhps
540, Pfdhfr 108 and Pfdhfr 51/59), and elongation at 72 °C for 40 s.
Real-time PCR amplification was immediately followed by HRM
ramping from 67 °C to 80 °C with fluorescence data acquisition set
at 0.1 °C increments (Table 1). HRM analysis was performed by the
software supplied with the machine, assigning automatically the two
possible alleles (wild- or mutant-type) for each sample. In each run,
samples were analyzed in duplicate with wild-type allele, mutant-
type allele and no template controls.
2.3. DNA sequencing
PCR products of the four genes studied in this assay were visual-
ised by agarose gel electrophoresis and purified by filtration using
Macherey-Nagel plate™ (NucleoFast 96 PCR, Macherey-Nagel®,
Düren, Germany). Sequencingreactions were performedas previously
described (Barnadas et al., 2008a).
2.4. Performance and accuracy of the HRM analysis
In order to determine HRM threshold detection, we have tested
serial dilutions of DNA (10−1to 10−5ng/µl). The HRM Pfcrt 76
protocol was performed for this assay for two different reference
clones, W2 (mutant-type allele) and 3D7 (wild-type allele). All DNA
dilutions were run in triplicate. The same procedure was also
performed with the HRM Pfdhfr 108 protocol.
We have also assessed the ability of the method to detect minority
genotype in mixed-alleles samples including wild- and mutant-type
Pfcrt alleles. DNA concentration of both W2 and 3D7 reference strains
was adjusted to 0.1 ng/µl and artificial mixtures were done in order to
have the following W2/3D7 ratio: 5:95, 10:90, 15:85, 20:80, 25:75,
30:70, 50:50 and also mixed in reverse order. Each mix was run in
triplicate.
Table 1
Nucleotide sequences and melting temperature (Tm) of primers, amplicons sizes of the PCR products and HRM ramping used to detect point mutations in Plasmodium falciparum
genes associated with antimalarial drugs resistance.
Primer namesPrimer sequences (5′–3′) Targeted genes and codonsHybridization Temperature Amplicon size (bp) HRM ramping
PfCRT76_HRM_F2
PfCRT76_HRM_Ra
PfMDR86_HRM_F1
PfMDR86_HRM_Ra
PfDHFR51/59_HRM_F2
PfDHFR51/59_HRM_Ra
PfDHFR108_HRM_F1
PfDHFR108_HRM_Ra
PfDHFR164_HRM_F1
PfDHFR164_HRM_Ra
PfDHPS436/437_HRM_F1
PfDHPS436/437_HRM_Rb
PfDHPS540_HRM_F1
PfDHPS540_HRM_Ra
GCTCACGTTTAGGTGGAGGT
TGTGAGTTTCGGATGTTACAAAA
TGTGCTGTATTATCAGGAGGAA
GTAATTACATCCATACAATAACTTGAT
ACACATTTAGAGGTCTAGGAAATAAAGG
GGCATATCATTTACATTATCCACA
TGTGGATAATGTAAATGATATGCCTAA
AAACATCTTCATCAAAATCTTCTTTTT
TGAAGATCTAATAGTTTTACTTGGGAAA
CATCGCTAACAGAAATAATTTGA
AAGAATGTTTGAAATGATAAATGAAGG
ATACTTATAATTGGTTTCGCATCACAT
TGTAGTTCTAATGCATAAAAGAGGAAA
ATCATGTTTCTTCGCAAATCCT
Pfcrt
72–76
Pfmdr1
86
Pfdhfr
51/59
Pfdhfr
108
Pfdhfr
164
Pfdhps
436/437
Pfdhps
540
57 °C 19870 °C–77 °C
50 °C173 70 °C–80 °C
57 °C 17570 °C–77 °C
57 °C 16768 °C–78 °C
55 °C 20065 °C–75 °C
55 °C195 70 °C–80 °C
57 °C18170 °C–77 °C
166
V. Andriantsoanirina et al. / Journal of Microbiological Methods 78 (2009) 165–170

Page 3

Samples of known genotypes (wild- and mutant-type allele)
(n=177), determined unambiguously by DNA sequencing, were in-
cluded to evaluate HRM accuracy in clinical isolates. For this assay,
DNA concentration was adjusted to 0.1 ng/µl. Each sample was run in
duplicate. The amplification was followed by a melt step ranging from
65 °C–75 °C to 70 °C–80 °C, in 0.1 °C increments pausing for 2 s per
step, depending of the amplicon Tm (Table 1). Genotypes were scored
by examining normalized and difference graphs using the Rotor-Gene
Software™. Sensitivity, specificity, both positive predictive and
negative predictive values, both positive and negative likelihood
ratios values for each codon were calculated considering DNA se-
quencing results as gold standard.
3. Results and discussion
The method detected 10−5ng/µl of 3D7 and W2 parasite DNAs
with the HRM Pfcrt 76 protocol (Fig. 1). This detection threshold was
confirmed by the HRM Pfdhfr 108 protocol (data not shown).
According to the estimation by Mangold et al. (2005), it corresponded
roughly to the genome of one single parasite. The method showed
identical sensitivity for both wild and mutant genotypes. Minority
genotypes whose presence was equal to or greater than 10% were
detected by HRM (Fig. 2). The same result was found for 90:10 and
10:90 W2/3D7 ratios. Parameters of evaluation of the technique for
each codon are summarized in Table 2. HRM was able to discriminate
Fig. 1. Difference graph for detection threshold using the HRM Pfcrt 76 protocol for W2 (mutant-type genotype) reference strains (3D7 10−1is used as baseline).
Fig. 2. Difference graph of different proportions of artificially mixed strains. The HRM Pfcrt 76 protocol was used, with 3D7 (wild-type genotype) as a baseline, to assess the detection
of minority clone.
167
V. Andriantsoanirina et al. / Journal of Microbiological Methods 78 (2009) 165–170

Page 4

between wild- and mutant-type alleles in some important SNPs
regarding theepidemiologyof malaria drugresistance (Fig. 3).Identical
genotypes were found by HRM and DNA sequencing for Pfcrt 76 and
Pfdhps 540 codons, and Pfdhfr 164 codon (Table 2). For Pfdhfr 108
codon, only one out 115 isolates showed discordant result. This isolate
was studied further by PCR-RFLP which revealed a mixed-allele isolate.
Table 2
Global accuracy of the High-Resolution Melting analysis (HRMA) compared to DNA sequencing for the detection of point mutations in Plasmodium falciparum genes associated with
antimalarial drugs resistance in clinical isolates from Madagascar and the Comoros Islands.
Gene/codonNumber
of tested
isolates
Allele-
type
HRM resultsSensitivitya
(CI95%)
Specificityb
(CI95%)
Positive
likelihood
ratioc
(CI95%)
Negative
likelihood
ratiod
(CI95%)
Prevalence
of the
mutant-
type in
Madagascar
(%)e
PPV
(%)f
NPV
(%)g
MutantWild
Sequencing results
crt K76T 59 Mutant
Wild
Mutant
Wild
Mutant
Wild
Mutant
Wild
Mutant
Wild
Mutant
Wild
Mutant
Wild
20
0
30
3
28
3
64
0100% (83–100%)100% (91–100%)
∞ (5–∞)0 (0–0.4)0.5100100
39
10
15
mdr N86Y 58 91% (76–98%)60% (39–79%) 2.3 (1.4–3.7)0.2 (0.1–0.5) 44.1 6489
dhfr N51I-C59R590 90% (74–98%) 100% (86–100%)
∞ (3–∞) 0.1 (0–0.2)31.2100 96
28
dhfr S108N1150 98% (92–100%) 100% (93–100%)
∞ (6–∞) 0.1 (0–0.1)32.6100 98
1
5
0
50
dhfr I164L290100% (48–100%) 100% (86–100%)
∞ (3–∞)0 (0–1.4) 3.5100 100
24
7
28
dhps S436A/C/F-A437G 5820
3
1
0
87% (66–97%)80% (63–91%) 4.4 (2.2–8.6)0.2 (0.1–0.5)43.67789
dhps K540E 290100% (17–100%) 100% (88–100%)
∞ (3.6–∞) 0 (0–3.5)0
NDND
28
ND: not done.
aProbability that HRM analysis detects a mutant-type allele when a mutant-type allele is present in the isolates (true positive rate).
bProbability that HRM analysis does not detect a mutant-type allele when a mutant-type allele is not present in the isolate (true negative rate).
cRatio between the probability of HRM analysis detects a mutant-type allele when a mutant-type allele is present in the isolates and the probability of HRM analysis detects a
mutant-type allele when a mutant-type allele is not present in the isolates [True positive rate/False positive rate=Sensitivity/(1−Specificity)].
dRatio between the probability of HRM analysis does not detect a mutant-type allele when a mutant-type allele is present in the isolates and the probability of HRM analysis does
not detect a mutant-type allele when a mutant-type allele is not present in the isolates [False negative rate/True negative rate=(1−Sensitivity)/Specificity.
ePrevalence of the mutant-type allele according to our data from samples collected in Madagascar in 2006–2007 (unpublished data).
fProbability that the mutant-type allele is present in the isolate when HRM analysis detects a mutant-type allele.
gProbability that the mutant-type allele is not present in the isolate when HRM analysis doe not detect a mutant-type allele (Zhou et al., 2002).
Fig. 3. Difference graph of HRM Pfcrt 76 protocol in clinical isolates. Each colored curve corresponded to a single isolate. Alleles (wild- or mutant-type) were assigned according to
their profile compared to wild-type control sample (identical results were observed when the mutant-type was used as a baseline). (For interpretation of the references to color in
this figure legend, the reader is referred to the web version of this article.)
168
V. Andriantsoanirina et al. / Journal of Microbiological Methods 78 (2009) 165–170

Page 5

For the Pfdhfr 51/59 codons, 56 out 59 isolates showed identical results
between HRM and DNA sequencing. Among the three discordant iso-
lates, two had a mutation in Pfdhfr 72 codon. For codons, Pfmdr 86 and
Pfdhps 436/437 results were less consistent between HRM and DNA
sequencing.
We report here the first application of HRM technology for detect-
ing mutations in P. falciparum parasite. The present study showed
absolute sensitivity and specificity of the technique in clinical isolates
for the Pfcrt 76, Pfdhps 540, and Pfdhfr 164 codons, as results perfectly
matchedthoseobtainedonthesameisolatesbyDNAsequencing.Forthe
Pfdhfr 108 SNP, the only discrepancy was observed in a mixed S108/
S108N isolate, as evidenced by PCR-RFLP. In this case, DNA sequencing
may have been not so “gold standard” than expected. The technique
showed excellent detection threshold with the ability to detect as few
as one copy of parasite DNA in three µl of test specimen. Minority
genotypes whose presence was equal to or greater than 10% were
detectedbythestudyofartificialmixtures.Thisthresholdofdetectionof
the minority genotype was similar to that reported by other methods
such as PCR-RFLP or molecular beacons (Durand et al., 2000). The main
advantages of HRM technology are well known. First, it is a high-
throughput methodology which is less time-consuming than other
classical methods used in the surveillance of malaria drug resistance as
PCR-RFLP.Asallreal-timemethodologies,itiscarriedoutinhermetically
sealed tubes, which avoids the risk of contaminating untested samples
by the handlingof amplicons (Wilson et al., 2005). Results are obtained
within2handareeasytointerpretthankstothegraphicpresentationof
the melting curves provided by the dedicated software. The cost of the
real-time PCR thermocycler (Rotor Gene) remains high but it may have
variousapplicationsintheareasofmicrobiologyorothers.Thehighcost
oftheinvestmentispartlycompensatedbytherunningcostoftheassay,
which is particularly low (Bass et al., 2007).
A limitation of the technique was observed for the simultaneous
detection of close SNPs such as Pfdhphs 436/437 and Pfdhfr 51/59.
Thus, the technique did not give excellent results regarding codons
Pfdhps 436/437. It has already been reported by Kristensen and
Dobrovic (2008) that efficient genotyping by HRM requires the pres-
ence of only one SNP per amplicon. Similarly, the Pfdhfr 51/59 codons
determination could have suffered from the same phenomena, though
to a lesser extent, as two out three discordant isolates presented
mutation in codon Pfdhfr 72. As this particular SNP in codon Pfdhfr 72
was until now not reported elsewhere than in Madagascar Island
(Andriantsoanirina et al., submitted), it does not preclude the use of
the technique for epidemiological applications in other areas of the
world. For the Pfmdr186 codon, the choice of primers may have been
critical, as no combination of primers among the four chosen pairs
gave optimal results. Another limitation of the technique is that it
was not designed in itself to detect isolates containing mixed
alleles. However, this limitation does not impair the determination
of the mutations prevalence which is the main objective of molecu-
lar epidemiology studies in the area of antimalarial drug resistance
surveillance.
In conclusion, the HRM technique that we developed may be of
great value for epidemiological studies in developing countries such
as Madagascar. In addition, the technique could be easily transposable
toother Plasmodium species such as Plasmodiumvivax, which presents
analogous SNPs associated with drug resistance (Barnadas et al.,
2008a,b).
Acknowledgements
We thank the patients and health careworkers who participated in
the national network for the surveillance of malaria resistance in
Madagascar (RER) from which these samples were derived and the
staff of the Ministry of Health of Madagascar for their collaboration.
We gratefully acknowledge Jean Michel Heraud and Jean Marc Reynes
(Virology Unit, Institut Pasteur de Madagascar, Antananarivo, Mada-
gascar) for allowing us to use the real-time PCR thermocycler and
for their technical assistance. We thank MR4 (American Type Culture
Collection, Manassas, VA) for providing us the both reference strains
DNA (3D7 and W2).
This study was supported by grants from Natixis/Impact Malaria
through the Observatoire de la Résistance aux Antipaludiques Project
(ORA) and the Genomics Platform, Pasteur Génopôle, Institut Pasteur,
Paris, France. Collection of samples was supported by fundings from
the French Government through the FSP/RAI 2001-168 project
(French Ministry of Foreign Affairs) (Comorian samples) and by the
Global Fund project for Madagascar round 3 (Community Action to
Roll Back Malaria, Grant number: MDG-304-G05-M) (Malagasy
samples).
Valérie Andriantsoanirina is a graduate PhD student funded by the
Institut Pasteur de Madagascar (Bourse «Girard»).
References
Bass,C.,Nikou,D.,Donnelly,M.J.,Williamson,M.S.,Ranson,H.,Ball,A.,Vontas,J.,Field,L.M.,
2007. Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a
comparisonoftwonewhigh-throughputassayswithexistingmethods.Malar.J.6,111.
Barnadas, C., Ratsimbasoa, A., Tichit, M., Bouchier, C., Jahevitra, M., Picot, S., Ménard, D.,
2008a. Plasmodium vivax resistance to chloroquine in Madagascar: clinical efficacy
and polymorphisms in pvmdr1 and pvcrt-o genes. Antimicrob. Agents Chemother.
52, 4233–4240.
Barnadas, C., Tichit, M., Bouchier, C., Ratsimbasoa, A., Randrianasolo, L., Raherinjafy, R.,
Jahevitra,M.,Picot,S.,Ménard,D.,2008b.Plasmodiumvivaxdhfranddhpsmutationsin
isolatesfromMadagascarand therapeutic response to sulphadoxine–pyrimethamine.
Malar. J. 7, 35.
Chateigner-Boutin, A.L., Small, I., 2007. A rapid high-throughput method for the detection
and quantification of RNA editing based on high-resolution melting of amplicons.
Nucleic Acids Res. 35, e114.
Durand, R., Eslahpazire, J., Jafari, S., Delabre, J.F., Marmorat-Khuong, A., Di Piazza, J.P., Le
Bras, J., 2000. Use of molecular beacons to detect an antifolate resistance-associated
mutation in Plasmodium falciparum. Antimicrob. Agents Chemother. 44, 3461–3464.
Durand, R., Huart, V., Jafari, S., Le Bras, J., 2002. Rapid detection of a molecular marker
for chloroquine-resistant falciparum malaria. Antimicrob. Agents Chemother. 46,
2684–2686.
Herrmann, M.G., Durtschi, J.D., Bromley, L.K., Wittwer, C.T., Voelkerding, K.V., 2006.
Amplicon DNA melting analysis for mutation scanning and genotyping: cross-
platform comparison of instruments and dyes. Clin. Chem. 52, 494–503.
Kristensen, L.S., Dobrovic, A., 2008. Direct genotyping of single nucleotide polymorph-
isms in methyl metabolism genes using probe-free high-resolution melting
analysis. Cancer Epidemiol. Biomark. Prev. 17, 1240–1247.
Le Bras, J., Durand, R., 2003. The mechanisms of resistance to antimalarial drugs in
Plasmodium falciparum. Fund. Clin. Pharmacol. 17, 147–153.
Lee, L.G., Connell, C.R., Bloch, W., 1993. Allelic discrimination by nick-translation PCR
with fluorogenic probes. Nucleic Acids Res. 21, 3761–3766.
Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., Wittwer, C., 2004. Genotyping
of single-nucleotide polymorphisms by high-resolution melting of small amplicons.
Clin. Chem. 50,1156–1164.
Livak, K.J., Flood, S.J., Marmaro, J., Giusti, W., Deetz, K., 1995. Oligonucleotides with
fluorescent dyes at opposite ends provide a quenched probe system useful for
detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 4, 357–362.
Mangold,K.A., Manson, R.U., Koay, E.S., Stephens, L., Regner, M., Thomson, R.B., Peterson,
L.R., Kaul, K.L., 2005. Real-time PCR for detection and identification of Plasmodium
spp. J. Clin. Microbiol. 43, 2435–2440.
Ménard, D., Ratsimbasoa, A., Randrianarivelojosia, M., Rabarijaona, L.P., Raharimalala, L.,
Domarle,O.,Randrianasolo,L.,Randriamanantena,A.,Jahevitra,M.,Andriantsoanirina,
V., Rason, M.A., Raherinjafy, R., Rakotomalala, E., Tuseo, L., Raveloson, A., 2008.
Assessment of the efficacy of antimalarial drugs recommended by the National
Malaria Control Programme in Madagascar: up-dated baseline data from randomized
and multi-site clinical trials. Malar. J. 7, 55.
Nair, S., Brockman, A., Paiphunb, L., Nosten, F., Anderson, T.J.C., 2002. Rapid genotyping
of loci involved in antifolate drug resistance in Plasmodium falciparum by primer
extension. Int. J. Parasitol. 32, 852–858.
Olliaro, P., 2005. Drug resistance hampers our capacity to roll back malaria. Clin. Infect.
Dis. 41, S247–S257.
Pangasa, A., Jex, A.R., Campbell, B.E., Bott, N.J., Whipp, M., Hogg, G., Stevens, M.A., Gasser,
R.B., 2009. High resolution melting-curve (HRM) analysis for the diagnosis of
cryptosporidiosis in humans. Mol. Cell. Probes 23, 10–15.
Plowe, C.V., Kublin, J.G., Doumbo, O.K.,1998. Plasmodium falciparum dihydrofolate reduc-
tase and dihydropteroate synthase mutations: epidemiology and role in clinical
resistance to antifolates. Drug Resist. Updat.1, 389–396.
Rakotonirina, H., Barnadas, C., Raherijafy, R., Andrianantenaina, H., Ratsimbasoa, A.,
Randrianasolo, L., Jahevitra, M., Andriantsoanirina, V., Ménard, D., 2008. Accuracy
and reliability of malaria diagnostic techniques for guiding febrile outpatient
treatment in malaria-endemic countries. Am. J. Trop. Med. Hyg. 78, 217–221.
Reed, G.H., Wittwer, C.T.,2004.Sensitivityand specificity of single-nucleotide polymorph-
ism scanning by high-resolution melting analysis. Clin. Chem. 50,1748–1754.
169
V. Andriantsoanirina et al. / Journal of Microbiological Methods 78 (2009) 165–170

Page 6

Reed, M.B., Saliba, K.J., Caruana, S.R., Kirk, K., Cowman, A.F., 2000. Pgh1 modulates sen-
sitivityand resistanceto multiple antimalarialsinPlasmodiumfalciparum. Nature 403,
906–909.
Saiki,R.K.,Bugawan,T.L.,Horn,G.T.,Mullis,K.B.,Erlich,H.A.,1986.Analysisofenzymatically
amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide
probes. Nature 324,163–166.
Snow, R.W., Guerra, C.A., Noor, A.M., Myint, H.Y., Hay, S.I., 2005. The global distribution
of clinical episodes of Plasmodium falciparum malaria. Nature 434, 214–217.
Stephens, A.J., Inman-Bamber, J., Giffard, P.M., Huygens, F., 2008. High-resolution analysis
of the spa repeats region of Staphylococcus aureus. Clin. Chem. 54, 432–436.
Tajiri-Utagawa, E., Hara, M., Takahashi, K., Watanabe, M., Wakita, T., 2009. Development
of a rapid high-throughput method in high-resolution melting (HRM) analysis for
routine detection and genotyping of noroviruses. J. Clin. Microbiol. 47, 435–440.
Wellems, T.E., Plowe, C.V., 2001. Chloroquine-resistant malaria. J. Infect. Dis.184, 770–776.
Wilson, P.E., Alker, A.P., Meshnick, S.R., 2005. Real-time PCR methods for monitoring
antimalarial drug resistance. Trends Parasitol. 21, 278–283.
Zhou, X.H., Obuchowski, N.A., McClish, D.K., 2002. Statistical Methods in Diagnostic
Medicine. Wiley, New York.
Zhou, L., Wang, L., Palais, R., Pryor, R., Wittwer, C.T., 2005. High-resolution DNA melting
analysis for simultaneous mutation scanning and genotyping in solution. Clin. Chem.
51,1770–1777.
Zhou, Z., Poe, A.C., Limor, J., Grady, K.K., Goldman, I., McCollum, A.M., Escalante, A.A.,
Barnwell, J.W., Udhayakumar, V., 2006. Pyrosequencing, a high-throughput method
for detecting single polymorphism in the dihydrofolate reductase and dihydrop-
teroatesynthetasegenesofPlasmodiumfalciparum.J.Clin.Microbiol.44,3900–3910.
170
V. Andriantsoanirina et al. / Journal of Microbiological Methods 78 (2009) 165–170