DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol

1] Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA. [2] McGovern Institute for Brain Research, Department of Brain and Cognitive Sciences, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA. [3] Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA. [4].
Nature Biotechnology (Impact Factor: 41.51). 07/2013; 31(9). DOI: 10.1038/nbt.2647
Source: PubMed


The Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. Here, we characterize SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. Our study evaluates >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. We find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. We also show that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. To facilitate mammalian genome engineering applications, we provide a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.

Download full-text


Available from: Thomas James Cradick, Mar 27, 2014
1 Follower
192 Reads
  • Source
    • "CRISPR/Cas9 Targeting of e926/Playrr The following guide RNAs were designed (; Hsu et al., 2013) and cloned into BbsI cut pX330: Playrr, TAGACGCAGCTGTGCTTA GAAGG; e926 proximal, GTGGCGGACTCATGTTAAAAAGG; e926 distal, GTGATTCCCACCACGCTTTGAGG. For Playrr targeting, the 156-bp singlestranded oligodeoxynucleotide (ssODN) used as a repair template carries a 3-bp change to disrupt the 5 0 splice site of Playrr exon 1 and introduce an EcoRI restriction site for genotyping (see Figure 3). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Expression of Pitx2 on the left side of the embryo patterns left-right (LR) organs including the dorsal mesentery (DM), whose asymmetric cell behavior directs gut looping. Despite the importance of organ laterality, chromatin-level regulation of Pitx2 remains undefined. Here, we show that genes immediately neighboring Pitx2 in chicken and mouse, including a long noncoding RNA (Pitx2 locus-asymmetric regulated RNA or Playrr), are expressed on the right side and repressed by Pitx2. CRISPR/Cas9 genome editing of Playrr, 3D fluorescent in situ hybridization (FISH), and variations of chromatin conformation capture (3C) demonstrate that mutual antagonism between Pitx2 and Playrr is coordinated by asymmetric chromatin interactions dependent on Pitx2 and CTCF. We demonstrate that transcriptional and morphological asymmetries driving gut looping are mirrored by chromatin architectural asymmetries at the Pitx2 locus. We propose a model whereby Pitx2 auto-regulation directs chromatin topology to coordinate LR transcription of this locus essential for LR organogenesis.
    Cell Reports 10/2015; 13. DOI:10.1016/j.celrep.2015.08.075 · 8.36 Impact Factor
  • Source
    • "Potential guide RNAs ( gRNAs ) targeting the first exon of cGAS ( MB21D1 ; NM_138441 ; chr6 : 74134856 - 74162043 ) were analyzed using the CRISPR Design tool ( crispr . mit . edu ) ( Hsu et al . , 2013 ) . Two target sequences were chosen : GGGCCGAACTTTCCCGCCTTAGG ( antisense ) and AGACTCGGTGGGATCCATCGGGG ( antisense ) . Both showed minimal off - target reactivity , with scores of 94 and 93 , respectively . Oligonucleotides with the following sequences were generated : cGAS - E1A - top : CACCGGGCCGAACTTTCCCGCCTT ; cGAS - E1A - bottom "
    [Show abstract] [Hide abstract]
    ABSTRACT: Invading viral DNA can be recognized by the host cytosolic DNA sensor, cyclic GMP-AMP (cGAMP) synthase (cGAS), resulting in production of the second messenger cGAMP, which directs the adaptor protein STING to stimulate production of type I interferons (IFNs). Although several DNA viruses are sensed by cGAS, viral strategies targeting cGAS are virtually unknown. We report here that Kaposi's sarcoma-associated herpesvirus (KSHV) ORF52, an abundant gammaherpesvirus-specific tegument protein, subverts cytosolic DNA sensing by directly inhibiting cGAS enzymatic activity through a mechanism involving both cGAS binding and DNA binding. Moreover, ORF52 homologs in other gammaherpesviruses also inhibit cGAS activity and similarly bind cGAS and DNA, suggesting conserved inhibitory mechanisms. Furthermore, KSHV infection evokes cGAS-dependent responses that can limit the infection, and an ORF52 null mutant exhibits increased cGAS signaling. Our findings reveal a mechanism through which gammaherpesviruses antagonize host cGAS DNA sensing. Copyright © 2015 Elsevier Inc. All rights reserved.
    Cell host & microbe 08/2015; DOI:10.1016/j.chom.2015.07.015 · 12.33 Impact Factor
  • Source
    • "By 342 contrast, such modifications should not affect the Cas9-based DNA targeting system as 343 recognition is based on RNA-DNA base pairing. In fact, it was shown that Cas9-mediated DNA 344 cleavage is unaffected by DNA methylation in human cells (Hsu et al., 2013). DNA methylation 345 is a common mechanism used by plants to turn off transposons and imprinted genes (Gehring, 346 2013; Mirouze and Vitte, 2014). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The relative ease, speed and biological scope of CRISPR/Cas9-based reagents for genomic manipulations are revolutionizing virtually all areas of molecular biosciences, including functional genomics, genetics, applied biomedical research and agricultural biotechnology. In plant systems, however, a number of hurdles currently exist that limit this technology from reaching its full potential. For example, significant plant molecular biology expertise and effort is still required to generate functional expression constructs that allow simultaneous editing, and especially transcriptional regulation, of multiple different genomic loci or "multiplexing", which is a significant advantage of CRISPR/Cas9 versus other genome editing systems. In order to streamline and facilitate rapid and wide-scale use of CRISPR/Cas9-based technologies for plant research, we developed and implemented a comprehensive molecular toolbox for multifaceted CRISPR/Cas9 applications in plants. This toolbox provides researchers with a protocol and reagents to quickly and efficiently assemble functional CRISPR/Cas9 T-DNA constructs for monocots and dicots using Golden Gate and Gateway cloning methods. It comes with a full suite of capabilities, including multiplexed gene editing and transcriptional activation or repression of plant endogenous genes. We report the functionality and effectiveness of this toolbox in model plants such as tobacco, Arabidopsis and rice, demonstrating its utility for basic and applied plant research. Copyright © 2015, Plant Physiology.
    Plant physiology 08/2015; DOI:10.1104/pp.15.00636 · 6.84 Impact Factor
Show more