Specific detection of Pythium aphanidermatum from hydroponic nutrient solution by booster PCR with DNA primers developed from mitochondrial DNA

Phytoparasitica (Impact Factor: 0.9). 10/2002; 30(5):473-485. DOI: 10.1007/BF02979752


Pythium aphanidermatum causes damping-off and root rot of vegetable crops in hydroponic systems. A DNA probe was isolated and modified from a library
ofHindIII-digested mitochondrial DNA ofP. aphanidermatum that strongly hybridized to DNA ofP. aphanidermatum and weakly hybridized to DNA ofPythium deliense. Cross-hybridizing sequences were absent from DNA of plants and other related fungi. The probe detected as little as 5 ng
ofP. aphanidermatum DNA and 250 ng ofP. deliense DNA in slot-blot assays.P. aphanidermatum was detected by a hybridization assay of total DNA extracted directly from infected roots. A pair of oligonucleotide primers
P1 and RP2, which allowed amplification of a specific 0.65 kb DNA fragment ofP. aphanidermatum using polymerase chain reaction (PCR), was designed from a specific DNA probe. Specific amplification of this fragment fromP. aphanidermatum was highly sensitive, detecting template DNA as low as 0.1 pg total DNA by booster PCR. Specific booster PCR amplification
using P1 and RP2 was successful in detectingP. aphanidermatum in naturally infected nutrient solution and roots of vegetables in a field hydroponic system.

1 Follower
27 Reads
  • Source
    • "Tenfold dilution series (1 ng to 10 fg) of DNA mixture of P. aphanidermatum isolate AiPo1, P. myriotylum isolate GUCC0072 and P. helicoides isolate GUCC5147 was used in multiplex PCR. The sensitivity of simplex PCR for P. aphanidermatum and P. helicoides DNA is 100 fg (Wang et al. 2002; Yin-Ling et al. 2007) and 10 fg for DNA from P. myriotylum (Wang et al. 2003a). The detection limits of the multiplex PCR for these species were the same (Fig. 2). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The objective of this study was to develop a multiplex PCR detection method for the high-temperature-growing pathogens Pythium aphanidermatum, P. helicoides and P. myriotylum. Species-specific primer pairs were designed that targeted the rDNA ITS regions. The multiplex PCR was constructed with a universal primer pair for eukaryotes directed at the 18S rDNA as a positive control, in addition to the three species-specific primer pairs. When the multiplex PCR was applied to naturally infested soils, the expected species were reliably identified, suggesting that the method is suitable for the detection of the three Pythium pathogens in environmental samples.
    Journal of General Plant Pathology 09/2013; 79(5). DOI:10.1007/s10327-013-0466-2 · 0.97 Impact Factor
  • Source
    • "DNA data is considered to be more phylogenetic and a potential source for detection of pathogen in mixed population. Conserved genome regions such as the internal transcribed spacer (ITS) sequences of rDNA and mtDNA have been chosen for taxonomic purposes at the species level in most of the fungi (McKay et al. 1999; Frederick et al. 2000; Wang et al. 2002; Tooley et al. 2006; Zhao et al. 2007; Miyazaki et al. 2009; Mbofung and Pryor 2010). Other conserved genes, such as b-tubulin (Fraaije et al. 1999; Hirsch et al. 2000), and elongation factors (Li and Hartman 2003) have also been used as specific markers. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.
    Canadian Journal of Microbiology 11/2011; 57(11):934-42. DOI:10.1139/w11-089 · 1.22 Impact Factor
  • Source
    • "Buu et al. (1992) conducted a selection of species-specific probes to distinguish the mitochondrial DNA RFLP patterns of 17 species of Pythium, and a cloned mtDNA probe was developed successfully for the detection of Py. aphanidermatum (Buu et al., 1993). By using booster PCR with DNA primers developed from mitochondrial DNA, Wang et al. (2002) also detected Py. aphanidermatum from naturally infected nutrient solutions and roots of vegetables in a field hydroponic system. Similarly, "

    Frontiers of Biology in China 01/2009;
Show more