Monoaminergic regulation of Sonic hedgehog signaling cascade expression in the adult rat hippocampus.

Abstract

Monoamines are implicated in the modulation of adult hippocampal neurogenesis in depression models and following chronic antidepressant treatment. Given the key role of Sonic hedgehog (Shh) in adult neurogenesis, we examined whether monoaminergic perturbations regulate the expression of Shh or its co-receptors Smoothened (Smo) and Patched (Ptc). Combined depletion of both serotonin and norepinephrine with para-chlorophenylalanine (PCPA) resulted in a significant decrease in Smo and Ptc mRNA within the dentate gyrus subfield of the hippocampus. However, selective depletion of serotonin, using the serotonergic neurotoxin 5,7-dihyrdroxytryptamine (5,7-DHT), or norepinephrine, using the noradrenergic neurotoxin DSP-4, did not alter expression of Shh and its co-receptors, Smo and Ptc. Acute treatment with the monoamine releasing agent, para-chloroamphetamine (PCA) significantly upregulated Smo mRNA within the dentate gyrus. However, acute or chronic treatment with pharmacological antidepressants that modulate monoaminergic neurotransmission did not regulate Shh cascade expression. These results indicate that robust changes in monoamine levels can regulate the expression of the Shh signaling cascade in the adult rodent brain.

Full text

Page 1

Monoaminergic regulation of Sonic hedgehog signaling cascade
expression in the adult rat hippocampus
Rajeev Rajendran1, Shanker Jha1, Kimberly A. Fernandes, Sunayana B. Banerjee, Farhan
Mohammad, Brian G. Dias, and Vidita A. Vaidya⁎
Department of Biological Sciences, Tata Institute of Fundamental Research (TIFR), Homi Bhabha Road,
Mumbai 400005, India.
Abstract
Monoamines are implicated in the modulation of adult hippocampal neurogenesis in depression
models and following chronic antidepressant treatment. Given the key role of Sonic hedgehog (Shh)
in adult neurogenesis, we examined whether monoaminergic perturbations regulate the expression
of Shh or its co-receptors Smoothened (Smo) and Patched (Ptc). Combined depletion of both
serotonin and norepinephrine with para-chlorophenylalanine (PCPA) resulted in a significant
decrease in Smo and Ptc mRNA within the dentate gyrus subfield of the hippocampus. However,
selective depletion of serotonin, using the serotonergic neurotoxin 5,7-dihyrdroxytryptamine (5,7-
DHT), or norepinephrine, using the noradrenergic neurotoxin DSP-4, did not alter expression of Shh
and its co-receptors, Smo and Ptc. Acute treatment with the monoamine releasing agent, para-
chloroamphetamine (PCA) significantly upregulated Smo mRNA within the dentate gyrus. However,
acute or chronic treatment with pharmacological antidepressants that modulate monoaminergic
neurotransmission did not regulate Shh cascade expression. These results indicate that robust changes
in monoamine levels can regulate the expression of the Shh signaling cascade in the adult rodent
brain.
Keywords
Serotonin; Norepinephrine; p-Chlorophenylalanine; p-Chloroamphetamine; 5,7-
Dihydroxytryptamine; DSP-4; Fluoxetine; Desipramine; Tranylcypromine
Animal models of depression exhibit decreased adult hippocampal neurogenesis [19,27],
whereas sustained antidepressant administration increases hippocampal neurogenesis [18] and
is thought to contribute to the behavioral effects of antidepressants [23]. The monoaminergic
hypothesis suggests that decreased monoamines underlie the pathogenesis of depression, and
increased monoamines contribute to antidepressant action [6]. Recently monoaminergic
neurotransmission has been implicated in the effects of depression models and antidepressants
on adult hippocampal neurogenesis [23,26]. A decline in hippocampal neurogenesis is
observed following serotonin (5-HT) and/or norepinephrine (NE) depletion, while increased
hippocampal neurogenesis is seen following elevation of monoamine levels [4,9,12,18].
© 2009 Elsevier Ireland Ltd.
⁎Corresponding author. Tel.: +91 22 22804545; fax: +91 22 22804610. E-mail: vvaidya@tifr.res.in.
1These authors contributed equally to the work.
This document was posted here by permission of the publisher. At the time of deposit, it included all changes made during peer review,
copyediting, and publishing. The U.S. National Library of Medicine is responsible for all links within the document and for incorporating
any publisher-supplied amendments or retractions issued subsequently. The published journal article, guaranteed to be such by Elsevier,
is available for free, on ScienceDirect.
Sponsored document from
Neuroscience Letters
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 2

However, the pathways that underlie the effects of monoamines on adult hippocampal
neurogenesis are not understood.
Sonic hedgehog (Shh) is a powerful regulator of adult hippocampal neurogenesis and is
essential for the maintenance of the adult stem cell niches [14,17,21]. In the adult brain, Shh
is expressed in the neocortex and the horizontal and vertical limbs of the diagonal band from
where it is thought to be anterogradely transported to the hippocampus [24,25]. Within the
hippocampus, expression of the Shh co-receptors Patched (Ptc) and Smoothened (Smo) is seen
in the dentate gyrus subfield including the neurogenic niche of subgranular zone (SGZ)
[14,24]. Smo protein has also been recently shown to localize predominantly to mossy fiber
nerve terminals in the hippocampus [20]. Recent evidence indicates that the neurogenic effects
of electroconvulsive seizure (ECS) treatment, one of the most robust forms of antidepressant
therapy, requires Shh signaling and ECS also regulates the hippocampal expression of Smo
and Ptc [1]. We hypothesized that monoaminergic neurotransmission may influence the
expression of the Shh cascade. The aim of the present study was to address whether robust
perturbations in the levels of 5-HT and NE or treatment with pharmacological antidepressants
regulate the expression of key components of the Shh signaling cascade.
Male Sprague–Dawley rats (200–250 g; TIFR animal breeding colony) were group-housed
and maintained on a controlled 12 h light/dark cycle with access to food and water ad
libitum. All animal procedures were carried out in accordance with the NIH Guide for the Care
and Use of Laboratory Animals, and were approved by the TIFR Institutional Animal Ethics
Committee.
To induce a combined depletion of norepinephrine (NE) and serotonin (5-HT), animals were
treated with p-chlorophenylalanine (PCPA, 300 mg/kg—2 days, 100 mg/kg—2 days; Sigma,
USA) as previously described [4,9]. To induce a selective depletion of NE, animals were treated
with N-Ethyl-N-(2-chloroethyl)-2-bromobenzylamine hydrochloride (DSP-4, 10 mg/kg,
Sigma) using a previously described protocol [12]. To induce a selective depletion of 5-HT,
animals received an intracerebroventricular (i.c.v.) infusion (AP-0.8 mm, ML-1.4 mm and
DV-4.0 mm from Bregma [22]) of 5,7-dihydroxytryptamine (5,7-DHT, 200 μg/animal, 20 μg/
μl, Sigma) as reported previously [9]. The choice of dose, treatment paradigm and time-point
for sacrifice for the above studies was based on prior literature that indicated a robust depletion
of the specific monoamines [4,9,12]. To induce a robust monoamine release, animals received
p-Chloroamphetamine (PCA, 10 mg/kg, Sigma) or vehicle (0.9% saline) through
intraperitoneal (i.p.) injection and were sacrificed 2 h later. For the acute antidepressant
experiment, animals received an i.p. injection of fluoxetine (FLX; 5 mg/kg), tranylcypromine
(TCP; 7.5 mg/kg), desipramine (DMI; 15 mg/kg) or vehicle (0.9% saline) and were sacrificed
2 h later. For the chronic antidepressant experiment, animals received i.p. injections of FLX
(5 mg/kg), TCP (7.5 mg/kg for 7 days and 10 mg/kg for 14 days), DMI (15 mg/kg) or vehicle
(0.9 % saline) once daily for 21 days and were sacrificed 2 h after the last treatment. The choice
of doses for antidepressant treatments was based on prior literature that indicated an effect on
adult hippocampal progenitor proliferation at these doses [18]. All antidepressant drugs were
obtained from Sigma. After decapitation, brains were frozen prior to cryostat sectioning and
in situ hybridization analysis.
In situ hybridization was carried out as previously described [1] on 14 μm thick coronal
sections. Slides were fixed, acetylated and dehydrated. Rat Shh, Smo and Ptc cRNA probes
were transcribed using 35S-labeled UTP (Amersham) from plasmids provided by Dr. Martial
Ruat (CNRS, France). Slides were incubated with radiolabeled riboprobes (1 × 106 cpm/
150 μl per slide) in hybridization buffer overnight and then subjected to stringent post-
hybridization washes. Slides were exposed to Hyperfilm β-max (Amersham) for 2–3 weeks.
Shh, Ptc or Smo sense riboprobes did not yield significant hybridization (data not shown)
Rajendran et al. Page 2
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 3

confirming the specificity of the signal observed with the antisense riboprobes. Shh, Ptc and
Smo mRNA levels were quantitated with the Macintosh-based Scion Image software (Scion,
USA) using 14C standards (Amersham, USA) for calibration and to correct for non-linearity.
For Shh mRNA, expression in the horizontal and vertical limbs of the diagonal band (VDB)
and in the neocortex was quantitated. For Ptc and Smo mRNA, the expression in the dentate
gyrus was determined. The optical density was determined by outlining an equivalent area in
each section, and the means were determined from measurements taken on both sides of 4
individual sections/animal.
Quantitative real-time PCR (qPCR) was also performed for acute PCA treatment. Animals
(n = 5/group) were treated with PCA or vehicle and sacrificed as described earlier. Hippocampi
were subdissected in cold saline and frozen in liquid nitrogen. Total RNA was isolated from
hippocampal tissue using Tri Reagent (Sigma), according to the manufacturer's protocol. RNA
was quantified using Nanodrop (Eppendorf, Germany) and RNA quality determined by
resolving on 1% formaldehyde agarose gel. cDNA was synthesized from 200 ng of total RNA
per sample using Quantitect reverse transcription kit (Qiagen, USA), as per the manufacturer's
protocol. cDNA was amplified and visualized using a SYBR Green kit (Applied Biosystems,
USA) in a Realplex mastercycler (Eppendorf). Hypoxanthine phopshoribosyl transferase
(HPRT) was used as the endogenous control. To compare HPRT and target gene, relative
quantification was performed using comparative CT method [2]. Briefly, this comparative
CT method involved averaging duplicate samples of each target and endogenous control in
both control and treatment samples [i.e. ΔCT = absolute CT value − endogenous control CT
value and ΔΔCT = ΔCT treatment − ΔCT control]. The fold change was calculated according
to the formula . The primer sequences used were Ptc F—
CCATTTCTTGCCCTTGGTGTTGGT, R—AATGCAGCCATGAAGAAGGCAGTG; Smo
F—AATTGGCCTGGTGCTTATTGTGGG, R—AGGGTGGTTGCTCTTGATGGAGAA;
HPRT F—GCAGACTTTGCTTTCCTTGG, R—GTCTGGCCTGTATCCAACACT.
Experiments were analyzed for differences using the unpaired Student's t-test (Prism,
Graphpad, USA) with significance determined at p values < 0.05.
Combined, but not selective, depletion of norepinephrine and serotonin levels
downregulates Smo and Ptc mRNA levels in the dentate gyrus.
The expression of Smo, the signaling component of the Shh receptor complex, was found to
be significantly decreased (∼30%) in the hippocampal dentate gyrus subfield following
depletion of both NE and 5-HT by PCPA treatment. In addition, there was a small but
significant decrease (∼20%) in the level of Ptc mRNA in the DG of PCPA treated animals as
compared to the vehicle group (Fig. 1). In striking contrast, selective noradrenergic (DSP-4)
and serotonergic (5,7-DHT) neurotoxin treatments did not alter Smo or Ptc mRNA expression
in the hippocampus (Fig. 2). The mRNA expression of the ligand Shh in the VDB (Figs. 1 and
2) and the neocortex (PCPA treatment: Veh = 100 ± 3.27, PCPA = 98.83 ± 2.09; DSP-4
treatment: Veh = 100 ± 11.47, DSP-4 = 99.75 ± 7.22; 5,7-DHT treatment: Veh = 100 ± 5.82,
5,7-DHT = 113.09 ± 4.29; results are expressed as percent of Vehicle and are the
mean ± S.E.M.) was not influenced by PCPA, DSP-4 or 5,7-DHT treatments. As previously
reported [24], Shh mRNA expression was high in the VDB and was expressed at relatively
lower levels in the neocortex (layer V).
Treatment with the monoamine releasing agent, PCA, increases Smo mRNA in the
dentate gyrus, however pharmacological antidepressants do not regulate the Shh
signaling cascade.
Acute PCA treatment resulted in a robust and significant upregulation of Smo mRNA (∼65%)
within the DG subfield of the hippocampus (Fig. 1). PCA treatment did not influence either
the expression of Shh in the basal forebrain (Fig. 1) or neocortex (PCA Treatment, Shh mRNA
Rajendran et al.Page 3
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 4

levels: Veh = 100 ± 8.26, PCA = 113.35 ± 11.25, results are expressed as percent of Vehicle
and are the mean ± S.E.M.) or the co-receptor Ptc in the hippocampal subfields (Fig. 1). The
in situ regulation of Smo and Ptc mRNA were further validated by qPCR for acute PCA
treatment. Acute PCA resulted in a 70% increase in Smo mRNA in the hippocampus as
compared to vehicle treated controls (ΔCT acute PCA = 0.915 ± 0.1762; ΔCT
Vehicle = 1.68 ± 0.2463; ΔΔCT = −0.765; results are expressed as ΔCT and are the
mean ± S.E.M.; p < 0.05, Student's t-test). Hippocampal Ptc mRNA levels were found to be
unaltered following acute PCA treatment (ΔCT acute PCA = 3.041 ± 0.3414; ΔCT
Vehicle = 3.577 ± 0.2124; ΔΔCT = −0.536; results are expressed as ΔCT and are the
mean ± S.E.M.; p > 0.05, Student's t-test). Further, Shh mRNA levels in the VDB and the
neocortex, and Smo and Ptc mRNA levels in the DG were not altered by either acute or chronic
treatment with the pharmacological antidepressants DMI, FLX or TCP (Table 1).
The present study indicates that robust changes in levels of both 5-HT and NE modulate the
expression of the Shh co-receptors, Smo and Ptc, in the hippocampal dentate gyrus subfield.
While depletion of both 5-HT and NE (PCPA) decreased Smo and Ptc hippocampal mRNA
levels, selective depletion of either 5-HT (5,7-DHT) or NE (DSP-4) did not alter their
expression. Further, acute treatment with the monoamine releasing agent PCA significantly
increased Smo mRNA levels. In contrast, acute or chronic antidepressant treatment with the
serotonin selective reuptake inhibitor, fluoxetine, the norepinephrine selective reuptake
inhibitor, desipramine, and the monoamine oxidase inhibitor, tranylcypromine did not regulate
the expression of the Shh cascade. Our study provides novel evidence of an influence of NE
and 5-HT on the expression of the Shh signaling cascade, a major developmental pathway that
continues to be expressed in the adult brain.
The effects of Shh have been best studied during development, where it regulates the
proliferation, survival and fate determination of embryonic neuronal and glial precursors [7].
Recently Shh signaling has been shown to play a critical role in maintaining stem cell niches
in the adult brain [17], where it regulates adult progenitor proliferation [14,21]. These studies
suggest that the Shh pathway may continue to have an important role in adulthood in regulating
structural plasticity. Given prior evidence that monoamines regulate the proliferation and
survival of hippocampal progenitors [4,9,10,12,16], our results raise the possibility that the
effects of monoaminergic neurotransmission on the expression of the Shh signaling cascade
could contribute to the influence of monoamines on adult neurogenesis.
In this regard, it is particularly interesting to note that selective depletion of NE (DSP-4) or 5-
HT (5,7-DHT) does not alter expression of the Shh cascade whereas combined depletion of
both monoamines (PCPA) results in a significant decline in hippocampal Smo and Ptc mRNA
levels. While DSP-4 and 5,7-DHT selectively induce a decrease in the proliferation of
hippocampal progenitors [4,12], PCPA has a more dramatic effect on hippocampal
neurogenesis resulting in robust decreases in both proliferation and survival of adult
hippocampal progenitors [9]. It is possible to speculate a role for reduced Shh signaling in
mediating the robust decline in neurogenesis following PCPA administration. Strikingly,
treatment with PCA, which would increase the levels of both NE and 5-HT [11], resulted in a
significant increase in the expression of Smo mRNA. We did not observe any regulation of
Shh mRNA expression by either PCPA or PCA suggesting the possibility that monoamine
neurotransmission may modulate expression of receptors for Shh directly rather than via an
effect on the ligand. Future studies are required for a clear understanding of the role of the Shh
cascade in mediating the effects of monoaminergic perturbations on adult hippocampal
neurogenesis.
It is intriguing that ECS and PCA differ in their effects on hippocampal Smo mRNA expression,
as ECS would also be expected to enhance monoamine levels within the hippocampus [8].
Rajendran et al. Page 4
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 5

Given that ECS induces the release of several other neurotransmitters besides monoamines
[5,15], it points to the possibility that other neurotransmitters pathways and neuronal activity
may induce a different effect on Smo mRNA expression than that observed with selective
monoamine release induced by acute PCA treatment.
At present the mechanism by which NE and 5-HT may influence expression of the Shh
signaling cascade is unclear. However, the cAMP-Protein kinase A (PKA) pathway, is an
attractive candidate. Activation of the cAMP cascade by the β adrenoceptor agonist
isoproterenol enhances Ptc expression in the pineal gland [3]. It is possible to speculate that
the decreased Smo and Ptc expression following robust monoamine depletion may involve
decreased cAMP cascade activation. Taken together, these studies raise the possibility that
monoaminergic signaling can modulate the gene expression of the Shh pathway in adulthood.
Given that Shh plays a critical role during development, further studies to explore the effects
of monoaminergic perturbation during gestation on fetal Shh signaling and consequences on
brain development are warranted.
Unlike previous results [1] that indicate a significant effect of ECS treatment on hippocampal
Smo and Ptc expression and a role for Shh signaling in the neurogenic effects of ECS, the
present study indicates that acute or chronic pharmacological antidepressant treatments do not
regulate Shh cascade expression. Interestingly, PCA, which robustly enhances monoamine
levels, did upregulate Smo mRNA expression, however pharmacological antidepressants,
which also elevate synaptic monoamine levels did not appear to do so. This discrepancy in the
regulation of Smo mRNA may be a consequence of the extent of elevation in monoamine levels
observed with a monoamine releasing agent [13,28] in contrast to the change seen with agents
that block reuptake or degradation. This points to the possibility that modulation of the
hippocampal expression of the Shh cascade may require very robust changes in both 5-HT and
NE. This is supported by evidence that ECS, PCA and PCPA treatments can regulate Ptc and
Smo expression, whereas selective depletions of 5-HT or NE and treatment with
pharmacological antidepressants does not regulate the Shh cascade expression.
In conclusion, our results provide novel evidence that monoaminergic neurotransmission
modulates the Shh signaling cascade expression in the adult mammalian brain, and highlight
the need for future studies to understand the mechanism of this regulation and the role of Shh
signaling in the effects of monoamines on adult structural plasticity.
Acknowledgements
This work was supported by a Wellcome Trust Senior Fellowship (040082003114133) to V.V. We are grateful to
Prof. Martial Ruat (CNRS, France) for Shh, Smo and Ptc cDNA containing plasmids. We are also thankful to Dr.
Ullas Kolthur and Upasana Roy (TIFR) for help with quantitative real time PCR.
References
[1]. Banerjee S.B. Rajendran R. Dias B.G. Ladiwala U. Tole S. Vaidya V.A. Recruitment of the Sonic
hedgehog signalling cascade in electroconvulsive seizure-mediated regulation of adult rat
hippocampal neurogenesis. Eur. J. Neurosci. 2005;22:1570–1580. [PubMed: 16197497]
[2]. Bookout A.L. Mangelsdorf D.J. Quantitative real-time PCR protocol for analysis of nuclear receptor
signaling pathways. Nucl. Recept. Signal. 2003;1:e012. [PubMed: 16604184]
[3]. Borjigin J. Deng J. Wang M.W. Li X. Blackshaw S. Snyder S.H. Circadian rhythm of patched1
transcription in the pineal regulated by adrenergic stimulation and cAMP. J. Biol. Chem.
1999;49:35012–35015. [PubMed: 10574978]
[4]. Brezun J.M. Daszuta A.A. Depletion in serotonin decreases neurogenesis in the dentate gyrus and
the subventricular zone of adult rats. Neuroscience 1999;89:999–1002. [PubMed: 10362289]
Rajendran et al. Page 5
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 6

[5]. Chamberlin E. Tsai G.E. A glutamatergic model of ECT-induced memory dysfunction. Harvard Rev.
Psychiatry 1998;5:307–317.
[6]. Charney D.S. Monoamine dysfunction and the pathophysiology and treatment of depression. J. Clin.
Psychiatry 1998;59:11–14. [PubMed: 9818625]
[7]. Ingham P.W. McMahon A.P. Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 2001;15:3059–3087. [PubMed: 11731473]
[8]. Isaac L. Schoenbeck R. Bacher J. Skolnick P. Paul S.M. Electroconvulsive shock increases
endogenous monoamine oxidase inhibitor activity in brain and cerebrospinal fluid. Neurosci. Lett.
1986;66:257–262. [PubMed: 3725191]
[9]. Jha S. Rajendran R. Davda J. Vaidya V.A. Selective serotonin depletion does not regulate
hippocampal neurogenesis in the adult rat brain: differential effects of p-chlorophenylalanine and
5,7-dihydroxytryptamine. Brain Res. 2006;1075:48–59. [PubMed: 16460708]
[10]. Jha S. Rajendran R. Fernandes K.A. Vaidya V.A. 5-HT(2A/2C) receptor blockade regulates
progenitor cell proliferation in the adult rat hippocampus. Neurosci. Lett. 2008;441:210–214.
[PubMed: 18603367]
[11]. Johnson M.P. Conarty P.F. Nichols D.E. (3H) monoamine releasing and uptake inhibition properties
of 3 4-methylenedioxymethamphetamine and p-chloroamphetamine analogues. Eur. J. Pharmacol.
1991;200:9–16. [PubMed: 1685125]
[12]. Kulkarni V.A. Jha S. Vaidya V.A. Depletion of norepinephrine decreases the proliferation, but does
not influence the survival and differentiation, of granule cell progenitors in the adult rat
hippocampus. Eur. J. Neurosci. 2002;16:2008–2012. [PubMed: 12453065]
[13]. Kutscher C.L. Yamamoto B.K. A frequency analysis of behavior components of the serotonin
syndrome produced by p-chloroamphetamine. Pharmacol. Biochem. Behav. 1979;11:611–616.
[PubMed: 575425]
[14]. Lai K. Kaspar B.K. Gage F.H. Schaffer D.V. Sonic hedgehog regulates adult neural progenitor
proliferation in vitro and in vivo. Nat. Neurosci. 2003;6:21–27. [PubMed: 12469128]
[15]. Lerer B. Stanley M. McIntyre I. Altman H. Electroconvulsive shock and brain muscarinic receptors:
relationship to anterograde amnesia. Life Sci. 1984;35:2659–2664. [PubMed: 6513731]
[16]. Lucas G. Rymar V.V. Du J. Mnie-Filali O. Bisgaard C. Manta S. Lambas-Senas L. Wiborg O.
Haddjeri N. Pineyro G. Sadikot A.F. Debonnel G. Serotonin (4) (5-HT(4)) receptor agonists are
putative antidepressants with a rapid onset of action. Neuron 2007;55:712–725. [PubMed:
17785179]
[17]. Machold R. Hayashi S. Rutlin M. Mazumdar M.D. Nery S. Corbin J.G. Gritli-Linde A. Dellovade
T. Porter J.A. Rubin L.L. Dudek H. McMahon A.P. Fishell G. Sonic hedgehog is required for
progenitor cell maintenance in telencephalic stem cell niches. Neuron 2003;39:937–950. [PubMed:
12971894]
[18]. Malberg J.E. Eisch A.J. Nestler E.J. Duman R.S. Chronic antidepressant treatment increases
neurogenesis in adult rat hippocampus. J. Neurosci. 2000;20:9104–9110. [PubMed: 11124987]
[19]. Malberg J.E. Duman R.S. Cell proliferation in adult hippocampus is decreased by inescapable stress:
reversal by fluoxetine treatment. Neuropsychopharmacology 2003;28:1562–1571. [PubMed:
12838272]
[20]. Masdeu C. Bernard V. Faure H. Traiffort E. Ruat M. Distribution of Smoothened at hippocampal
mossy fiber synapses. Neuroreport 2007;18:395–399. [PubMed: 17435610]
[21]. Palma V. Lim D.A. Dahmane N. Sanchez P. Brionne T.C. Herzberg C.D. Gltton Y. Carleton A.
Alvarez-Buylla A. Ruiz-i-Altaba A. Sonic hedgehog controls stem cell behavior in the postnatal
and adult brain. Development 2005;132:335–344. [PubMed: 15604099]
[22]. Paxinos, G.; Watson, C. Vol. Fourth Edn.. Academic press; San Diego: 1998. The rat brain in
stereotaxic coordinates. 21 pp
[23]. Santarelli L. Saxe M. Gross C. Surget A. Battaglia F. Dulawa S. Weisstaub N. Lee J. Duman R.
Arancio O. Belzung C. Hen R. Requirement of hippocampal neurogenesis for the behavioral effects
of antidepressants. Science 2003;301:805–809. [PubMed: 12907793]
[24]. Traiffort E. Charytoniuk D. Watroba L. Faure H. Sales N. Ruat M. Discrete localizations of
hedgehog signalling components in the developing and adult rat nervous system. Eur. J. Neurosci.
1999;11:3199–3214. [PubMed: 10510184]
Rajendran et al. Page 6
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 7

[25]. Traiffort E. Moya K.L. Faure H. Hassig R. Ruat M. High expression and axonal transport of
aminoterminal Sonic hedgehog in the adult hamster brain. Eur. J. Neurosci. 2001;14:839–850.
[PubMed: 11576188]
[26]. Vaidya V.A. Vadodaria K.C. Jha S. Neurotransmitter regulation of adult neurogenesis: putative
therapeutic targets. CNS Neurol. Disord. Drug Targets 2007;6:358–374. [PubMed: 18045164]
[27]. Vollmayr B. Mahlstedt M.M. Henn F.A. Neurogenesis and depression: what animal models tell us
about the link. Eur. Arch. Psychiatry Clin. Neurosci. 2007;257:300–303. [PubMed: 17401725]
[28]. Youdim M.B. Ashkenazi R. Serotonergic involvement in pharmacological action of the anxiolytic-
sedatives thalidomide and supidimide. Eur. J. Pharmacol. 1985;119:39–46. [PubMed: 2867921]
Rajendran et al. Page 7
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 8

Fig. 1.
Influence of PCPA & PCA treatment on the expression of the Shh cascade in the adult rat brain.
Rats were administered either PCPA, PCA or vehicle (VEH) treatment in separate experiments,
and levels of Shh, Smo and Ptc mRNA were determined by in situ hybridization and
quantitative densitometry. PCPA treatment decreased the expression of Smo and Ptc mRNA
in the dentate gyrus (DG), but did not influence Shh mRNA expression in the Horizontal limb/
Vertical limb of the Diagonal Band (VDB)—Upper Panel. PCA treatment significantly
increased the levels of Smo mRNA in the DG, but did not alter the levels of Ptc mRNA in the
DG or Shh in the VDB/HDB region—Lower Panel. Representative autoradiographs of Shh,
Smo and Ptc mRNA from vehicle and PCPA treated animals (Upper Panel) and vehicle and
PCA treated animals (Lower Panel) are shown. Results are expressed as percent of vehicle and
are the mean ±S.E.M. (n = 5 /group); *p < 0.05 as compared with vehicle (Student's t-test).
Rajendran et al.Page 8
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 9

Fig. 2.
Influence of DSP-4 and 5,7-DHT treatment on the expression of the Shh cascade in the rat
brain. Rats received treatment with vehicle (VEH), DSP-4 or 5,7-DHT in separate experiments,
and levels of Shh, Smo and Ptc mRNA were determined with in situ hybridization and
quantitative densitometry. DSP-4 or 5,7-DHT treatment did not influence Shh mRNA
expression in the Horizontal limb/Vertical limb of the Diagonal Band (VDB) or the expression
of the Shh receptors, Smo and Ptc in the hippocampal dentate gyrus (DG) subfield.
Representative autoradiographs of Shh, Smo and Ptc mRNA from vehicle and DSP-4 (Upper
Panel), and vehicle and 5,7-DHT (Lower Panel) treated animals are shown. Results are
expressed as percent of vehicle and are the mean ±S.E.M. (n = 5/group).
Rajendran et al. Page 9
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.
Sponsored Document
Sponsored Document
Sponsored Document

Page 10

Sponsored Document
Sponsored Document
Sponsored Document
Rajendran et al. Page 10
Table 1
Acute or chronic treatment with different classes of antidepressants does not influence the mRNA expression of the
Shh cascade.
Shh mRNA (Neocortex) Shh mRNA (VDB/HDB)Ptc mRNA (DG) Smo mRNA (DG)
Acute antidepressant treatment
VEH 100 ± 13.45 100 ± 15.44 100 ± 4.94100 ± 11.42
Ac DMI108.03 ± 1.3198.66 ± 7.04110.9 ± 7.43 93.88 ± 12.89
VEH100 ± 4.08 100 ± 13.34 100 ± 5.81100 ± 4.67
Ac FLX100.88 ± 1.7 96.66 ± 3.09 92.92 ± 2.1790.74 ± 25.84
VEH100 ± 3.1100 ± 13.34 100 ± 4.94100 ± 12.6
Ac TCP91.1 ± 0.87 89.06 ± 5.9293.16 ± 5.14 86.58 ± 2.17
Chronic antidepressant treatment
VEH 100 ± 10.27100 ± 12.61 100 ± 8.5100 ± 10.1
Chr DMI72.15 ± 8.55 81.68 ± 9.67 112.46 ± 5.8291.56 ± 10.6
VEH100 ± 6.18 100 ± 13.55 100 ± 7.36 100 ± 3.94
Chr FLX91.36 ± 8.82 80.32 ± 2.597.44 ± 4.59115.35 ± 16.4
VEH 100 ± 6.18100 ± 13.55 100 ± 7.38 100 ± 11.25
Chr TCP 92.3 ± 9.1677.99 ± 9.78 113.40 ± 0.5878.38 ± 10.66
Animals were administered Desipramine (DMI), Fluoxetine (FLX) or Tranylcypromine (TCP) either as a single dose (acute) or once daily for 21 days
(chronic), and the mRNA levels of Shh, Smo and Ptc were studied using in situ hybridization and analyzed by quantitative densitometry. Shh mRNA
levels in the HDB/VDB region and in the neocortex were unaltered after either acute or chronic treatment by DMI, FLX or TCP. Smo and Ptc mRNA
levels in the hippocampal DG were also unaffected by acute or chronic treatment with these agents. Results are expressed as percent of vehicle and are
the mean ±S.E.M. (n = 4–5/group).
Published as: Neurosci Lett. 2009 April 10; 453(3): 190–194.