Detection of pathogenic Leptospira spp. through TaqMan Polymerase Chain Reaction targeting the LipL32 Gene

National Center for Zoonotic, Vector-Borne, and Enteric Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333, USA.
Diagnostic microbiology and infectious disease (Impact Factor: 2.46). 05/2009; 64(3):247-55. DOI: 10.1016/j.diagmicrobio.2009.03.014
Source: PubMed


Rapid diagnosis of leptospirosis, through culture and/or serology, can be difficult without proper expertise and is often delayed because of the length of time required to obtain results. In this study, we developed a real-time polymerase chain reaction (PCR) assay using a TaqMan probe targeting lipL32, which is present only in pathogenic Leptospira spp. Using Leptospira interrogans serovar Icterohaemorrhagiae DNA, the lower limit of detection was found to be 20 genomic equivalents/reaction with a 95% cutoff value. The assay detected pathogenic Leptospira strains, but not intermediately pathogenic or nonpathogenic strains. When testing the assay on spiked clinical specimens, whole blood and plasma were better specimens for detecting the same initial number of leptospires compared with serum from clotted and centrifuged blood. Leptospira spiked at the same concentration was better detected in centrifuged urine. This real-time PCR assay with high specificity and sensitivity may prove to be a rapid method for diagnosing acute leptospirosis.


Available from: Jay E Gee, Dec 24, 2014
  • Source
    • "LipL32_45F – 5 0 AAG CAT TAC TTG CGC TGG TG 3 0 and LipL32_286R – 5 0 TTT CAG CCA GAA CTC CGA TT 3 0 ), which generate a 242 bp fragment (Stoddard et al., 2009 "
    [Show abstract] [Hide abstract]
    ABSTRACT: A strain of Leptospira kirschneri (serogroup Grippotyphosa) was cultured from urine of a mare post-abortion in Brazil and characterized by serogrouping, multiple-locus variable-number tandem repeat analysis, PGFE, and sequencing of genes rrs and secY. Strains of L. kirschneri have apparently never been recovered from horses in tropical area, only in Europe and USA. Knowledge of local epidemiology is important to interpret genetic profiles of leptospires circulating in an area.
    Zoonoses and Public Health 09/2015; DOI:10.1111/zph.12224 · 2.37 Impact Factor
  • Source
    • "DNA purified from urine was also tested for the presence of Leptospira spp. (Stoddard et al. 2009). As for the RT‑PCR for morbilliviruses, the QIAGEN® OneStep RT‑PCR kit (Hilden, Germany) was used according to manufacturer's instructions with primers LPW12490, 5'‑CAGAGACTTAATGAAATTTATGG‑3' and LPW12941, 5'‑CCACCCATCGGGTACTT‑3' adopting the following thermal protocol: reverse transcription, 30 minutes at 50°C; initial PCR activation step, 15 minutes at 95°C; 3‑step cycling consisting of denaturation, 30 seconds at 94°C; annealing, 30 seconds at 54°C; extension, 1 minute at 54°C (for 40 cycles); final extension 72°C for 10 minutes. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Feline morbillivirus was detected in urine samples of a 15 year old cat suffering from severe nephropathy. Viral RNA was not detected in blood and faecal samples and also the most common pathogens associated to cat kidney failure were not found. This report describes the first evidence of feline morbillivirus in Europe.
    Veterinaria italiana 08/2015; 51(3). DOI:10.12834/VetIt.833.4136.2 · 0.63 Impact Factor
  • Source
    • "Journal homepage: that often negate the need for isolation and culture of the infected Leptospira for a confirmatory result, and the results of such techniques are habitually available within a matter of hours instead of days or months [2] . Even though, successful PCR performance depends on a highly efficient DNA-recovery without PCR inhibitor remaining [3] ; only little has been done to optimize these leptospiral procedures. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures for microbiological analysis, QIAmp DNA mini kit (QIAGEN, Germany), CLART HPV kit (GENOMICA, Spain) and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific PCR for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.
Show more