Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases

The J. Craig Venter Institute, Synthetic Biology Group, Rockville, Maryland, USA.
Nature Methods (Impact Factor: 32.07). 05/2009; 6(5):343-5. DOI: 10.1038/nmeth.1318
Source: PubMed

ABSTRACT We describe an isothermal, single-reaction method for assembling multiple overlapping DNA molecules by the concerted action of a 5' exonuclease, a DNA polymerase and a DNA ligase. First we recessed DNA fragments, yielding single-stranded DNA overhangs that specifically annealed, and then covalently joined them. This assembly method can be used to seamlessly construct synthetic and natural genes, genetic pathways and entire genomes, and could be a useful molecular engineering tool.

477 Reads
  • Source
    • "An oligonucleotide of the form 59 AATTGCAAATCTAAATGTTT (20-nt sgRNA-specific sequence) GTTTAAGAGCTATGCTGGAA 39 was hybridized with its reverse and complementary oligonucleotide. The hybrid is cloned into NotI-digested pIK198 by Gibson assembly (Gibson et al. 2009). The nonhomologous end joining templates for unc-22 and lin-41 were created by inserting hybridized oligonucleotides containing the gene-specific sgRNA, 4 bp upstream and 6 bp downstream from its endogenous genomic locus and 20 bp homology arms, into the EcoRI site of pIK127 (Peft-3::gfp::h2b::tbb-2 39UTR) (#65631; Addgene) or BglII site of pIK137 (Peft-3::gfp::h2b: "
    Dataset: Katic
  • Source
    • "The mutant alleles including hp1 w , hp2 j , hp2 dg , SlGLK2K11R, SlGLK2K253R and SlGLK2K11RK253R were generated as for the Quikchange method described (Papworth et al., 1996), and the mutant allele of hp2 was generated as the polymerase cycling assembly method (Gibson et al., 2009). The complementary mutagenic primers and primers for assembly PCR are listed in Table S1. "
    [Show abstract] [Hide abstract]
    ABSTRACT: CULLIN4-RING ubiquitin ligases (CRL4s) as well as their targets are fundamental regulators functioning in many key developmental and stress responses in eukaryotes. In tomato (Solanum lycopersicum), molecular cloning has revealed that the underlying genes of natural spontaneous mutations high pigment 1 (hp1), high pigment 2 (hp2) and uniform ripening (u) encode UV-DAMAGED DNA BINDING PROTEIN 1 (DDB1), DE-ETIOLATED 1 (DET1) and GOLDEN 2-LIKE (GLK2), respectively. However, the molecular basis of the opposite actions of tomato GLK2 vs CUL4-DDB1-DET1 complex on regulating plastid level and fruit quality remains unknown. Here, we provide molecular evidence showing that the tomato GLK2 protein is a substrate of the CUL4-DDB1-DET1 ubiquitin ligase complex for the proteasome degradation. SlGLK2 is degraded by the ubiquitin-proteasome system, which is mainly determined by two lysine residues (K11 and K253). SlGLK2 associates with the CUL4-DDB1-DET1 E3 complex in plant cells. Genetically impairing CUL4, DDB1 or DET1 results in a retardation of SlGLK2 degradation by the 26S proteasome. These findings are relevant to the potential of nutrient accumulation in tomato fruit by mediating the plastid level and contribute to a deeper understanding of an important regulatory loop, linking protein turnover to gene regulation.
    New Phytologist 09/2015; DOI:10.1111/nph.13635 · 7.67 Impact Factor
  • Source
    • "In fact, these high Plant Mol Biol performance polymerases also allow for cloning of cassettes into any of the sites present in the MCS, even if endogenous sites for these enzymes are present; that is, the restriction-free 'sticky end PCR' technique (Zeng 1998) can be used to generate the necessary sticky-end overhangs for cloning of any piece of DNA into any desired restriction site. These vectors are also compatible with other restriction-free enzymatic assembly methods (Gibson et al. 2009); using this approach would further provide the ability to specifically control the directionality of insertion of each cassette. To address both the internal restriction site problem and the directionality issue, further improvements are being made to this vector set. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Production of novel value-added compounds in transgenic crops has become an increasingly viable approach in recent years. However, in many cases, product yield still falls short of the levels necessary for optimal profitability. Determination of the limiting factors is thus of supreme importance for the long-term viability of this approach. A significant challenge to most metabolic engineering projects is the need for strong coordinated co-expression of multiple transgenes. Strong constitutive promoters have been well-characterized during the >30 years since plant transformation techniques were developed. However, organ- or tissue-specific promoters are poorly characterized in many cases. Oilseeds are one such example. Reports spanning at least 20 years have described the use of certain seed-specific promoters to drive expression of individual transgenes. Multi-gene engineering strategies are often hampered by sub-optimal expression levels or improper tissue-specificity of particular promoters, or rely on the use of multiple copies of the same promoter, which can result in DNA instability or transgene silencing. We describe here a flexible system of plasmids that allows for expression of 1-7 genes per binary plasmid, and up to 18 genes altogether after multiple rounds of transformation or sexual crosses. This vector system includes six seed-specific promoters and two constitutive promoters. Effective constitutive and seed-specific RNA interference gene-suppression cloning vectors were also constructed for silencing of endogenous genes. Taken together, this molecular toolkit allows combinatorial cloning for multiple transgene expression in seeds, vegetative organs, or both simultaneously, while also providing the means to coordinately overexpress some genes while silencing others.
    Plant Molecular Biology 08/2015; DOI:10.1007/s11103-015-0355-5 · 4.26 Impact Factor
Show more