Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases

The J. Craig Venter Institute, Synthetic Biology Group, Rockville, Maryland, USA.
Nature Methods (Impact Factor: 32.07). 05/2009; 6(5):343-5. DOI: 10.1038/nmeth.1318
Source: PubMed


We describe an isothermal, single-reaction method for assembling multiple overlapping DNA molecules by the concerted action of a 5' exonuclease, a DNA polymerase and a DNA ligase. First we recessed DNA fragments, yielding single-stranded DNA overhangs that specifically annealed, and then covalently joined them. This assembly method can be used to seamlessly construct synthetic and natural genes, genetic pathways and entire genomes, and could be a useful molecular engineering tool.

Download full-text


Available from: Daniel G Gibson, May 12, 2014
527 Reads
    • "The latter was generated by cloning a ~200 bp synthetic DNA fragment (from IDT), homologous to expressed sequences from the Rosa26 locus, into pcDNA3.1(-) (Life Technologies) by isothermal single reaction assembly, using commercially available reagents (New England Biolabs, Ipswich, MA) [Gibson et al., 2009]. Expression of the Dmp1-SOST transgene was detected with a forward primer spanning the exon1-exon2 junction of the Dmp1/SOST hybrid transcript and a reverse primer homologous to a 5' fragment of the SOST coding sequence (Table 2). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch) ) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. This article is protected by copyright. All rights reserved.
    Journal of Cellular Biochemistry 10/2015; DOI:10.1002/jcb.25405 · 3.26 Impact Factor
    • "Amplified products were digested using the restriction enzymes BamHI and EcoRI, and the resulting fragments were ligated into pK19-mobsacB, which was digested using the same enzymes. For the construction of pK19- mobsacB-prpD, prpD was amplified from genomic DNA using primers prpD_BamHI_fw and prpD_EcoRI_rev, and the resulting fragment was cloned into the BamHI and EcoRI digested vector pK19-mobsacB by Gibson assembly (Gibson et al., 2009). E.coli DH5α was transformed using the RbCl method (Hanahan, 1983). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Adaptive laboratory evolution has proven a valuable strategy for metabolic engineering. Here, we established an experimental evolution approach for improving microbial metabolite production by imposing an artificial selective pressure on the fluorescent output of a biosensor using fluorescence-activated cell sorting. Cells showing the highest fluorescent output were iteratively isolated and (re-)cultivated. The L-valine producer Corynebacterium glutamicum ΔaceE was equipped with an L-valine-responsive sensor based on the transcriptional regulator Lrp of C. glutamicum. Evolved strains featured a significantly higher growth rate, increased L-valine titers (~25%) and a 3-4-fold reduction of by-product formation. Genome sequencing resulted in the identification of a loss-of-function mutation (UreD-E188⁎) in the gene ureD (urease accessory protein), which was shown to increase L-valine production by up to 100%. Furthermore, decreased L-alanine formation was attributed to a mutation in the global regulator GlxR. These results emphasize biosensor-driven evolution as a straightforward approach to improve growth and productivity of microbial production strains.
    Metabolic Engineering 10/2015; 32. DOI:10.1016/j.ymben.2015.09.017 · 6.77 Impact Factor
  • Source
    • "An oligonucleotide of the form 59 AATTGCAAATCTAAATGTTT (20-nt sgRNA-specific sequence) GTTTAAGAGCTATGCTGGAA 39 was hybridized with its reverse and complementary oligonucleotide. The hybrid is cloned into NotI-digested pIK198 by Gibson assembly (Gibson et al. 2009). The nonhomologous end joining templates for unc-22 and lin-41 were created by inserting hybridized oligonucleotides containing the gene-specific sgRNA, 4 bp upstream and 6 bp downstream from its endogenous genomic locus and 20 bp homology arms, into the EcoRI site of pIK127 (Peft-3::gfp::h2b::tbb-2 39UTR) (#65631; Addgene) or BglII site of pIK137 (Peft-3::gfp::h2b: "
    Dataset: Katic
Show more