Identification of an Ascaris G protein-coupled acetylcholine receptor with atypical muscarinic pharmacology.

Abstract

Acetylcholine (ACh) is a neurotransmitter/neuromodulator in the nematode nervous system and induces its effects through interaction with both ligand-gated ion channels (LGICs) and G protein-coupled receptors (GPCRs). The structure, pharmacology and physiological importance of LGICs have been appreciably elucidated in model nematodes, including parasitic species where they are targets for anthelmintic drugs. Significantly less, however, is understood about nematode ACh GPCRs, termed GARs (G protein-linked ACh receptors). What is known comes from the free-living Caenorhabditis elegans as no GARs have been characterized from parasitic species. Here we clone a putative GAR from the pig gastrointestinal nematode Ascaris suum with high structural homology to the C. elegans receptor GAR-1. Our GPCR, dubbed AsGAR-1, is alternatively spliced and expressed in the head and tail of adult worms but not in dorsal or ventral body wall muscle, or the ovijector. ACh activated AsGAR-1 in a concentration-dependent manner but the receptor was not activated by other small neurotransmitters. The classical muscarinic agonists carbachol, arecoline, oxotremorine M and bethanechol were also AsGAR-1 agonists but pilocarpine was ineffective. AsGAR-1 activation by ACh was partially antagonized by the muscarinic blocker atropine but pirenzepine and scopolamine were largely ineffective. Certain biogenic amine GPCR antagonists were also found to block AsGAR-1. Our conclusion is that Ascaris possesses G protein-coupled ACh receptors that are homologous in structure to those present in C. elegans, and that although they have some sequence homology to vertebrate muscarinic receptors, their pharmacology is atypically muscarinic.

Full text

Page 1

Identification of an Ascaris G protein-coupled acetylcholine receptor
with atypical muscarinic pharmacologyq
Michael J. Kimbera,*, Laura Sayeghb, Fouad El-Shehabib, Chuanzhe Songa, Mostafa Zamaniana,
Debra J. Woodsc, Tim A. Daya, Paula Ribeirob
aDepartment of Biomedical Sciences, Iowa State University, Ames, IA 50011, USA
bInstitute of Parasitology, McGill University, Macdonald Campus, 21,111 Lakeshore Road, Ste. Anne de Bellevue, Que., Canada H9X 3V9
cPfizer Animal Health, 7000 Portage Road, Kalamazoo, MI 49001, USA
a r t i c l ei n f o
Article history:
Received 15 January 2009
Received in revised form 26 February 2009
Accepted 2 March 2009
Keywords:
Nematode
G protein-coupled receptor
Acetylcholine
Muscarinic
Ascaris
Yeast
a b s t r a c t
Acetylcholine (ACh) is a neurotransmitter/neuromodulator in the nematode nervous system and induces
its effects through interaction with both ligand-gated ion channels (LGICs) and G protein-coupled recep-
tors (GPCRs). The structure, pharmacology and physiological importance of LGICs have been appreciably
elucidated in model nematodes, including parasitic species where they are targets for anthelmintic drugs.
Significantly less, however, is understood about nematode ACh GPCRs, termed GARs (G protein-linked
ACh receptors). What is known comes from the free-living Caenorhabditis elegans as no GARs have been
characterized from parasitic species. Here we clone a putative GAR from the pig gastrointestinal nema-
tode Ascaris suum with high structural homology to the C. elegans receptor GAR-1. Our GPCR, dubbed
AsGAR-1, is alternatively spliced and expressed in the head and tail of adult worms but not in dorsal
or ventral body wall muscle, or the ovijector. ACh activated AsGAR-1 in a concentration-dependent man-
ner but the receptor was not activated by other small neurotransmitters. The classical muscarinic ago-
nists carbachol, arecoline, oxotremorine M and bethanechol were also AsGAR-1 agonists but
pilocarpine was ineffective. AsGAR-1 activation by ACh was partially antagonized by the muscarinic
blocker atropine but pirenzepine and scopolamine were largely ineffective. Certain biogenic amine GPCR
antagonists were also found to block AsGAR-1. Our conclusion is that Ascaris possesses G protein-coupled
ACh receptors that are homologous in structure to those present in C. elegans, and that although they have
some sequence homology to vertebrate muscarinic receptors, their pharmacology is atypically
muscarinic.
? 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
1. Introduction
Nematode cholinergic neurotransmission and neuromodulation
are mediated by both ionotropic and metabotropic receptors. Non-
selective cation permeablenicotinic
(nAChR) and the recently identified ACh-gated chloride channels
(Putrenko et al., 2005), belong to the family of cys-loop ligand-
gated ion channels (LGICs) whereas the G protein-linked acetyl-
choline receptors (GARs) are rhodopsin-like G protein-coupled
receptors (GPCRs). Relatively more research attention has been
given to nAChRs as they mediate fast, excitatory neurotransmis-
sion and are the site of action of a number of anti-nematodal drugs
including levamisole and pyrantel (Robertson and Martin, 1993;
Robertson et al., 1994). Comparatively little is known of the struc-
acetylcholine receptors
ture, pharmacology and physiological significance of nematode
GARs, particularly in parasitic species.
Caenorhabditis elegans offers some insight into the nematode
GAR complement with three GARs having been identified (Hwang
et al., 1999; Lee et al., 1999, 2000). These receptors have sequence
homology with the five known classes of vertebrate muscarinic
receptors; GAR-1 and GAR-2 are similar to the mammalian sub-
types M2 and M4, which preferentially couple to Gi/oclass G-pro-
tein a sub-units, whereas GAR-3 has more homology with M1,
M3 and M5, which couple to Gq/11proteins. While the pharmacol-
ogy of these GAR receptors has not been strenuously interrogated,
they are in some ways similar to but in other ways different from,
vertebrate muscarinic receptors (Lee et al., 1999, 2000). Finally,
each C. elegans GAR modulates some key nematode behaviours.
The expression of GAR-1 in head ciliated sensory neurons and
the posterior ventral microtubule (PVM) mechanosensory neuron
(Lee et al., 2000) suggest a role in sensory perception and GAR-1
RNA interference (RNAi)-silenced worms have a ‘‘sluggish” loco-
motory phenotype (Keating et al., 2003). GAR-2 is expressed in
0020-7519/$36.00 ? 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.ijpara.2009.03.001
qNote. Nucleotide sequence data reported in this paper are available in the
GenBank
* Corresponding author. Tel.: +1 515 294 5833; fax: +1 515 294 2315.
E-mail address: michaelk@iastate.edu (M.J. Kimber).
TMdatabase under the Accession Nos. FJ609743 and FJ609744.
International Journal for Parasitology 39 (2009) 1215–1222
Contents lists available at ScienceDirect
International Journal for Parasitology
journal homepage: www.elsevier.com/locate/ijpara

Page 2

ventral nerve cord motorneurons, cooperatively modulating worm
locomotion with GABABreceptors (Dittman and Kaplan, 2008), and
is also expressed in the hermaphroditic specific motorneuron
(HSN) vulval motorneuron, where its activation inhibits egg-laying
(Bany et al., 2003). GAR-3 has two known roles; it serves to regu-
late normal pharyngeal function, allowing appropriate excitation–
contraction coupling (Steger and Avery, 2004) and it provides a
mechanism for male spicule protraction during reproduction (Liu
et al., 2007). Therefore, in nematodes, GARs function both in the
central and peripheral nervous systems. This is also true for verte-
brate muscarinic receptors, which are involved in a plethora of
physiological activities, amongst them: memory (Hamilton and
Nathanson, 2001); thermoregulation (Gomeza et al., 1999); regu-
lating contractility of the heart, urinary bladder, trachea and stom-
ach (Stengel et al., 2000); constriction of the pupils and control of
salivation (Matsui et al., 2000); cerebral vasodilation (Yamada
et al., 2001) and modulation of dopaminergic neurotransmission
in the CNS (Gerber et al., 2001; Zhang et al., 2002).
Evidence for GARs in parasitic nematodes is less explicit and is
based on the responses of parasite tissue preparations to classical
muscarinic ligands. Colquhoun et al. (1991) initially described a
mixed cholinergic pharmacology in Ascaris somatic musculature;
the muscarinic agonists muscarone, furtrethonium and arecoline
produced muscle depolarization but the majority tested were
either weak or ineffective. Also, the archetypal muscarinic antago-
nist, atropine, was found to be a poor antagonist of the parasite
‘‘muscarinic” receptor, a finding confirmed by others (Segerberg
and Stretton, 1993; Martin and Valkanov, 1996). Segerberg and
Stretton (1993) also found that the muscarinic antagonist
N-methyl-scopolamine was somewhat ineffective. These studies
indicate that parasitic nematodes possess GARs albeit with phar-
macology that, although similar to mammalian muscarinic recep-
tors, is clearly not identical.
Involvement in key nematode behaviours such as sensory per-
ception, locomotion, pharyngeal pumping and reproduction ear-
marks GARs for consideration as potential drug targets for
controlling nematode parasites but specific knowledge of GAR
form and function in parasitic species is lacking. Here we address
this by identifying a transcript that encodes a putative GAR from
the gastrointestinal roundworm Ascaris suum. This receptor
appears analogous to C. elegans GAR-1 in terms of structure and
perhaps function, as it is expressed in a manner generally con-
served to that of GAR-1 in the head and tail of adult worms.
Functional expression of the receptor with a yeast-based system
revealed AsGAR-1 has atypical muscarinic pharmacology that
may make it therapeutically discernable from host muscarinic
receptors.
2. Materials and methods
2.1. Parasite material
Adult Ascaris suum were collected from a local abattoir, trans-
ported to the laboratory and maintained at 33 ?C, in Locke’s solu-
tion (NaCl, 155 mM; KCl, 5 mM; CaCl2, 2 mM; NaHCO3, 1.5 mM;
glucose, 5 mM).
2.2. Rapid amplification of cDNA ends (RACE)
Total RNA was extracted from an adult female Ascaris fresh tis-
sue preparation using TRI Reagent (Sigma); mRNA was then puri-
fied from this extract using the Dynabeads mRNA Purification Kit
(Dynal Biotech). cDNA suitable for rapid amplification of cDNA
ends (RACE) PCR was constructed from the Ascaris mRNA using
the SMART RACE cDNA Amplification Kit (Clontech) and used as
a template in RACE PCR with either a 50RACE primer (50GCAAT
AAGCGTTGTCCAATAGTAAACAAC 30) or 30RACE primer (50CATTGG
CAATGCGATGGTCATTGTGG 30) designed from expressed sequence
tag (EST) sequence information (see Section 3). The components for
this reaction were as suggested by the manufacturer and the
touchdown PCR cycling conditions were as follows: 94 ?C for
30 s, 72 ?C for 3 min (5 cycles); 94 ?C for 30 s, 70 ?C for 30 s,
72 ?C for 3 min (5 cycles); 94 ?C for 30 s, 68 ?C for 30 s, 72 ?C for
3 min (30 cycles). Reactions were performed with a Thermo
Hybaid Px2 thermal cycler and visualized on 1.2% agarose gel con-
taining ethidium bromide. Discrete amplicons were gel excised,
purified (PureLink Gel Extraction Kit, Invitrogen) and ligated into
the pGEM-T Easy vector (Promega) prior to subcloning and
sequence analysis. DNA sequencing was edited and aligned using
VectorNTI v10.3 software (Invitrogen).
2.3. Reverse transcription (RT)-PCR
Adult female Ascaris were dissected and a number of tissue-spe-
cific preparations obtained. Sectioning the parasite posterior to the
circumpharyngeal nerve ring generated a ‘head’ preparation con-
sisting of said neuropile, some pharyngeal musculature, body wall
muscle and anterior sensory structures. Sectioning the parasite
anterior to the perianal nerve ring generated a ‘tail’ preparation
that included the perianal nerve ring and associated posterior sen-
sory structures, body wall muscle and a small amount of intestinal
tract. Dorsal and ventral body wall preparations were composed of
muscle strips and associated sections of the dorsal and ventral
nerve cords, respectively. Finally, the ovijector was dissected and
flushed to remove residual eggs.
Total RNA was extracted from each preparation using TRI Re-
agent and reverse transcribed into cDNA using the RETROscript
Kit (Ambion). A relative semi-quantitative multiplex RT-PCR was
performed on each cDNA template. We amplified both of the puta-
tive receptor isoforms in this reaction and compared their intensity
with normalized 18S rRNA. The QuantumRNA 18S Internal Stan-
dards Kit (Ambion) was used as a source of primers to amplify
the 18S target combined with receptor-specific primers flanking
the deletion site in the third intracellular loop (As18SF: 50ACC
GAACGAAGCAGCGTTGATATGTTAAG 30; As18SR: 50TGACCTGAGCG
CATGCATCA 30). We used Platinum Taq DNA polymerase (Invitro-
gen) and manufacturer’s buffer system for that enzyme in the reac-
tion, which had the following cycle profile: 94 ?C for 2 min, then
94 ?C for 30 s, 57 ?C for 30 s, 72 ?C for 1 min (35 cycles). Reactions
were visualized on a 1.2% agarose gel containing ethidium
bromide.
2.4. Yeast functional expression
Receptor isoforms were PCR-amplified using primers that
added NcoI (50GCCATACCATGGACGATTCTTACATCCCTAACG 30)
and BamHI (50GCCATAGGATCCTTAAATTGCTTTATTAAAATTTCCAC
30) to the 50and 30ends of the amplicon, respectively. These prim-
ers were sufficient to amplify both isoforms, clones of which were
verified upon later sequencing. Purified amplicons were digested
and ligated into NcoI/BamHI linearized yeast expression vector
Cp4258, before transformation into JM109 competent Escherichia
coli (Promega). Individual clones were selected and Luria-Bertani
(LB) broth cultured, the plasmid DNA purified using HiSpeed Plas-
mid Midi Kit (QIAGEN) and sequenced to confirm receptor orienta-
tion and fidelity.
The receptor functional assay is an adaptation of that described
by Wang et al. (2006). The Saccharomyces cerevisiae strains used
(CY19043, CY10560, CY13393, CY13395, CY13399 and YEX 108;
kindly provided by J. Broach, Princeton University, USA) differed
in their expression of G-protein a subunits, allowing differential
coupling of receptor activation to a pheromone responsive cell
1216
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222

Page 3

growth pathway. Initial studies indicated that the two AsGAR iso-
forms expressed most effectively in strain YEX 108 (MATa PFUS1-
HIS3 PGPA1-Gaq(41)-GPA1-Gaq(5) can1 far1D1442 his3 leu2 lys2
sst2D2 ste14::trp1::LYS2 ste18g6-3841 ste3D1156 tbt1-1 trp1 ura3)
and therefore, this strain was used throughout the study. YEX
108 is identical to the strain used by Wang et al. (2006) except that
it expresses a chimeric Ga subunit in which the last five amino
acids of yeast Ga (gpa1) are replaced with those of rat Gaq.
Mid-log phase cells were transformed with 1 lg receptor/vector
construct or 1 lg empty vector (mock-transfected control) in the
presence of 200 lg salmon sperm DNA (Invitrogen), according to
standard protocols. Positive transformants were selected in
leucine-deficient media [1? YNB (Difco), 1? yeast synthetic drop-
out medium supplement without leucine (Sigma), 10 mM ammo-
nium sulphate (Sigma), 2% glucose] and those colonies expressing
the receptor were verified by PCR prior to the functional assay.
For the agonist assay, 4 mL leucine-deficient media was inocu-
lated with receptor-expressing yeast or the mock controls and
grown at 30 ?C until the OD600was approximately 1. The cells were
washed three times with leucine and histidine deficient medium
[1? YNB (Difco), 1? yeast synthetic drop out medium supplement
without leucine, tryptophan, uracil and histidine (Sigma) supple-
mented with uracil (Sigma) and L-tryptophan (Sigma), 10 mM
ammonium sulphate (Sigma), 2% glucose, 50 mM 4-Morpholine-
propanesulfonic acid (MOPS), pH 6.8] then resuspended in 1 mL
leucine and histidine-deficient media containing 1.5 mM 3-ami-
no-1,2,4-triazole (Sigma) to a density of ? 15–20 cells/lL. Approx-
imately 3000 cells were added to each well of a black-walled, clear
bottom 96-well plate containing the same medium and test ago-
nist in a total volume of 200 lL. Cells were grown at 30 ?C for
approximately 30 h before addition of 20 lL Alamar Blue (Invitro-
gen). Alamar blue is a cell growth indicator and its reduction re-
sults in a blue to pink colour change. Fluorescence (520 nm
excitation/560 nm emission) was measured at 30 min intervals
for up to 4 h using a FLEXStation plate fluorometer (Molecular De-
vices) preset at 30 ?C. For the antagonist assays the same protocol
was used but antagonists were also included when cells and ago-
nist were added to the 96-well plate. All drugs used in the study
were obtained from Sigma (St. Louis, MO). Assay data analysis
and dose-response curve fits were performed using Prizm 5.0
(GraphPad Software, San Diego, CA).
3. Results
3.1. A homolog of GAR-1 is expressed in Ascaris suum
Our hypothesis was that GARs are present in animal parasitic
nematodes and that given the degree of structural conservation
amongst nematodes, animal parasitic nematodes would share a
similar GAR complement to that of C. elegans. To examine this
hypothesis, we searched the Ascaris EST data set for GAR orthologs
with the tBLASTn algorithm (www.ncbi.nlm.nih.gov/blast) using
C. elegans GAR sequences as queries. This approach returned a
number of ESTs with varying degrees of similarity to the C. elegans
receptors. The EST with highest homology was chosen for further
examination. RACE PCR identified a transcript possessing the SL1
spliced leader sequence and a predicted 1953 nucleotide open
reading frame. The 651 amino acid encoded peptide possesses fea-
tures typical of a rhodopsin class G protein-coupled receptor
(GPCR) including seven predicted transmembrane helices with
rhodopsin signatures. A comparison of our putative GPCR with a
non-redundant protein dataset
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)
encoded on our transcript most closely aligns with acetylcholine
GPCRs and, in particular, invertebrate GARs. The most closely
related molecule is C. elegans GAR-1, which is 50% identical to
usingthe
revealed
blastp algorithm
peptidethe
our putative Ascaris receptor at the amino acid level (see Fig. 1A)
and when the variable third intracellular (i3) loop is subtracted,
this homology rises to 78% identity. Thus, we believe the putative
Ascaris receptor constitutes a GAR-1 ortholog and have designated
it AsGAR-1 accordingly. The most similar muscarinic receptor is
M2, which is 21% identical to AsGAR-1. Further RT-PCR and se-
quence analysis of the AsGAR-1 open reading frame indicated the
presence of an alternatively spliced isoform of the receptor, identi-
cal to the first save for a 27 amino acid deletion in the predicted i3
loop. Examination of this deletion did not reveal any motifs that
would denote predictable functionality other than a possible con-
served tyrosine phosphorylation site that is not present in the
shorter isoform (see Fig. 1A). Caenorhabditis elegans GARs also dis-
play alternate splicing, resulting in multiple receptor isoforms that,
like AsGAR-1, vary with respect to i3 loop deletions (Park et al.,
2000, 2003; Suh et al., 2001). In keeping with the adopted C. ele-
gans nomenclature, the longer Ascaris isoform was designated As-
GAR-1a and the shorter isoform AsGAR-1b.
3.2. AsGAR-1 displays tissue-specific distribution
Caenorhabditis elegans GARs are expressed in a tissue-specific
manner; for example, GAR-1 is expressed in a set of ciliated sen-
sory neurons in the head of C. elegans and in the PVM mechanosen-
sory neuron (Lee et al., 2000). Also, although all GAR splice variants
are expressed in a temporally similar manner, typically through all
life cycle stages, one isoform is expressed at higher levels than the
others (Park et al., 2000, 2003; Suh et al., 2001). To examine the
gross spatial distribution of AsGAR-1, and also to examine the rel-
ative expression levels of the two AsGAR-1 isoforms, we used a
multiplexed relative semi-quantitative RT-PCR protocol, with 18S
rRNA as our internal standard, performed on RNA extracted from
tissue-specific preparations.
AsGAR-1 could be amplified from two of our RNA preparations,
the ‘head’ and ‘tail’ (Fig. 1B). The ‘head’ preparation was generated
from the circumpharyngeal nerve ring and anterior sensory struc-
tures and included some body wall and pharyngeal muscle. Ampli-
fication of AsGAR-1 from this preparation indicates expression in
one or more of these structures. The ‘tail’ preparation contained
RNA from the perianal nerve ring and posterior sensory structures
as well as body wall muscle and a small section of gut. A positive
PCR result also indicates AsGAR-1 expression in one or more of
these structures. There was no amplification of the receptor from
the dorsal or ventral body wall muscle or ovijector RNA prepara-
tions. Both AsGAR-1 isoforms were amplified from the ‘head’ and
‘tail’ RNA although the longer isoform (AsGAR-1a) was expressed
more strongly in both cases, approximately 9-fold more than the
shorter isoform.
3.3. AsGAR-1 is an acetylcholine receptor
AsGAR-1 has high sequence homology to known ACh GPCRs. To
determine whether AsGAR-1 is an ACh receptor we monitored the
response of the putative receptor to ACh using a histidine auxotro-
phic yeast functional expression assay (Wang et al., 2006). Briefly,
the GPCR of interest is expressed in a modified auxotrophic yeast
strain that carries the His3 reporter gene under the transcriptional
control of the pheromone-responsive FUS1 promoter. His3 confers
the ability to synthesize histidine and the FUS1 promoter links this
synthesis to an endogenous pheromone-signaling pathway. It is
this pathway that is stimulated by activation of the heterologous
GPCR. Thus, in histidine-deficient media, receptor expression and
activation will induce yeast growth. We were able to output yeast
growth as fluorescence through the addition of Alamar Blue (Invit-
rogen). Reduction of this dye by the reproducing yeast produces a
colour change from dark blue to hot pink that can be measured
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222
1217

Page 4

fluorometrically. Receptor activation was calculated as increased
yeast growth relative to mock-transfected control tested on the
same 96-well plate.
AsGAR-1 shows some constitutive activity when expressed in
yeast. Cultures transformed with AsGAR-1a or -1b plasmids
showed approximately 3–4 times more cell growth than the
mock-transfected control in the absence of test ligand (Fig. 2A).
The receptor was further activated, however, when the cells were
treated with ACh. ACh (10?4M) activated AsGAR-1, producing a
15 ± 3-fold growth increase in yeast expressing AsGAR-1a (n = 8,
P = <0.05), and a 13.4 ± 0.8-fold increase in growth in yeast
expressing AsGAR-1b (n = 9, P = <0.05)(see Fig. 2A and B). The re-
sponse to ACh between the two strains was not significantly differ-
ent. To confirm this response was ACh-specific we screened the
two receptors with other potential ligands. Phylogenetic analysis
indicated that AsGAR-1 was similar to both GARs identified from
other invertebrates and vertebrate muscarinic receptors but the
next most related cluster of GPCRs were invertebrate biogenic
amine receptors. We therefore, screened AsGAR-1 with a panel of
aminergic neurotransmitters. None of these small signaling mole-
cules significantly activated either AsGAR-1 isoform, suggesting
ACh specifically activates these receptors (Fig. 2A and B).
Subsequent experiments to pharmacologically profile AsGAR-1
used the b isoform in the YEX 108 yeast strain. AsGAR-1b was cho-
sen because although both isoforms responded in a similar manner
to potential ligands, in combination with YEX 108 it gave the most
consistent responses. Using this pairing, the AsGAR-1 response to
ACh was found to be concentration-dependent (see Fig. 2E) with
a half maximal effective concentration (EC50) of 20.3 ± 1.7 lM.
3.4. AsGAR-1 displays atypical ‘‘muscarinic” pharmacology
Invertebrate GARs have notable sequence homology to verte-
brate muscarinic receptors but there is evidence that GARs are
pharmacologically distinct. In terms of agonists for example,
C. elegans GAR-2 was found to be unresponsive to the muscarinic
agonists arecoline and oxotremorine (Lee et al., 2000; Suh et al.,
2001). Similarly for antagonists, the same receptor was not blocked
A
B
Fig. 1. A G protein-linked acetylcholine receptor (GAR), dubbed AsGAR-1, is expressed in the pig gastrointestinal roundworm, Ascaris suum. (A) AsGAR-1 has high homology
with GAR-1, a Caenorhabditis elegans G protein-coupled ACh receptor. Alignment of the two AsGAR-1 isoforms, a and b, with C. elegans GAR-1 (Swiss-Prot ID Q18007) and the
most closely related muscarinic receptor, M2 (Swiss-Prot ID P08172). The seven predicted transmembrane domains of AsGAR-1 are indicated with bars. A possible tyrosine
phosphorylation site present in AsGAR-1a but not AsGAR-1b is marked (?). Shading indicates the degree of conservation. Alignment was constructed using the blosum62mt2
matrix and Vector NTI v10.3 software (Invitrogen). (B) AsGAR-1 is expressed in a tissue-specific manner. A multiplexed relative semi-quantitative reverse transcription (RT)-
PCR reaction resulted in AsGAR-1a and b amplification from specific RNA preparations. AsGAR-1a (upper amplicon) and AsGAR-1b (middle amplicon) were observed in head
(H) and tail (T) preparations but not in dorsal (D) or ventral (V) body wall muscle preparations or an ovijector preparation (O). 18S rRNA was used as our normalized internal
standard (lower amplicon).
1218
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222

Page 5

by atropine (Lee et al., 2000), an antagonist that classically defines
muscarinic-like pharmacology. Our hypothesis was AsGAR-1
would show a pharmacological profile similar to C. elegans GARs
and different from vertebrate muscarinic receptors. To test this
hypothesis we first screened AsGAR-1 with a panel of cholinergic
agonists at 10?4M (see Fig. 2C). The most potent of these com-
pounds was carbachol, a non-selective cholinergic agonist, which
elicited a 10.8 ± 1.7-fold increase in yeast growth relative to
mock-transfected yeast (n = 4, P 6 0.05). Arecoline increased yeast
growth 10.2 ± 1.6-fold (n = 4, P 6 0.05). The vertebrate muscarinic
agonists oxotremorine M and bethanechol were less potent, pro-
ducing an 8.2 ± 1.7-fold increase (n = 3, P 6 0.05) and a 7.7 ± 0.8-
fold increase (n = 3, P 6 0.05) in yeast growth, respectively. Finally,
the muscarinic agonist pilocarpine produced a modest 1.9 ± 0.5-
fold increase in yeast growth, which was not significant (n = 3,
P = 0.07). In summary, the relative rank order potency of choliner-
gic agonists at AsGAR-1 was ACh > carbachol = arecoline > oxotre-
morine M > bethanechol>>pilocarpine.
Next we examined the ability of some muscarinic antagonists to
block AsGAR-1 activation by ACh. To do this, antagonists were
tested at 10?4M in the presence of 10?4M ACh. Yeast growth in
the presence of antagonist with ACh was expressed as a percentage
of growth in ACh alone. Further, antagonists were tested in media
supplemented with histidine to confirm that any observed growth
inhibition was due to receptor antagonism and not cytotoxicity.
Atropine reduced yeast growth to 37.8 ± 15.1% of control, blocking
ND
ACh
OA
DA
TA
HA
5-HT
A
0
5
10
15
20
Fold increase in RFU
ACh
Carb
Arec
Oxo
Beth
Pilo
0
5
10
15
Fold increase in RFU
-8-7-6-5-4 -3
0
40000
80000
120000
160000
Log [ACh], M
RFU
ND
ACh
OA
DA
TA
HA
5-HT
A
0
5
10
15
Fold increase in RFU
Atr
Pir
Sco
Prom
DPH
Cim
Spip
Mian
Prop
0
20
40
60
80
100
120
% control
-6.0-5.5 -5.0-4.5-4.0
0
100000
200000
300000
Log [Promethazine], M
RFU
EF
AB
CD
Fig. 2. AsGAR-1, an Ascaris suum homolog of the Caenorhabditis elegans G protein-linked acetylcholine receptor, GAR-1, has atypical muscarinic pharmacology. (A) AsGAR-1a
is activated by 10?4M acetylcholine (ACh), but not by a panel of other neurotransmitters. Receptor activation is expressed as a fold increase in fluorescence (RFU) over mock-
transfected yeast. Octopamine (OA), dopamine (DA), tyramine (TA), histamine (HA), serotonin (5-HT), adrenaline (A) all at 10?4M, no drug (ND). The data are the means and
SEM of at least three separate experiments, each with three to six replicates. (B) AsGAR-1b is activated by ACh, but not by other neurotransmitters, drugs as in A. (C) AsGAR-1
activation by a panel of muscarinic agonists: carbachol (Carb), arecoline (Arec), oxotremorine M (Oxo), bethanechol (Beth) and pilocarpine (Pilo) all at 10?4M. (D) Antagonism
of AsGAR-1 by muscarinic antagonists, expressed as a percentage of AsGAR-1 activation by ACh (10?4M). Atropine (Atr), pirenzepine (Pir), scopolamine (Sco), promethazine
(Prom), diphenhydramine (DPH), cimetidine (Cim), spiperone (Spip), mianserin (Mian) and propranolol (Prop) all 10?4M. (E) ACh activates AsGAR-1b in a concentration-
dependent manner with an EC50of 20.3 ± 1.7 lM. }, no agonist and N, mock-transfected yeast. (F) A representative dose response curve showing the dose-dependent
antagonism of ACh induced AsGAR-1b activation by promethazine. Promethazine was the most potent AsGAR-1 blocker with an IC50of 17.6 ± 4.2 lM based on three separate
experiments, each with 3–6 replicates.
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222
1219

Page 6

AsGAR-1 activation by 62.2%. Two other muscarinic antagonists
were lesseffective. Pirenzepine
76.6 ± 10.7% of control (a 23.4% decrease in AsGAR-1 activation)
and scopolamine reduced yeast growth to 85.9 ± 11.7% of control
(14.1% inhibition).
As described earlier, we screened AsGAR-1 with biogenic
amines due to shared sequence homology between AsGAR-1 and
biogenic amine GPCRs but found that none of the amines activated
our receptor. Extending this rationale, we also tested some antag-
onists of biogenic amine receptors at 10?4M for their ability to
block AsGAR-1 (Fig. 2D). We first tested some known histamine
receptor antagonists and found that promethazine, a H1 receptor
blocker, reduced AsGAR-1 activation to 10 ± 3.5% of control. This
was the most potent AsGAR-1 blocker identified in our study; pro-
methazine inhibition was concentration-dependent with a half
maximal inhibitory concentration (IC50) of 17.6 ± 4.2 lM (Fig. 2F).
Another H1 receptor blocker, diphenhydramine, was much less
effectiveand actuallyincreased
(106.6 ± 8.5% of control). The H2 receptor antagonist cimetidine
elicited a mild blockade of AsGAR-1 to 83.9 ± 5.5% of control. Spip-
erone, a potent dopamine and serotonin receptor antagonist also
partially blocked ACh activation of AsGAR-1, reducing yeast
growth to 52.8 ± 7.6% of control. Our final antagonists tested were
adrenergic receptor blockers and both were effective at antagoniz-
ing ACh activation of AsGAR-1. Mianserin, a a2-adrenergic and
serotonergicreceptorantagonist,
24 ± 0.1% of control while propranolol, a non-selective b-adrener-
gic receptor blocker, reduced yeast growth to 41.2 ± 8.9% of control
levels. To summarize, the rank order potency of those antagonists
testedwas promethazine > mianserin > atropine > proprano-
lol > spiperone > pirenzepine > cimetidine > scopolamine > diphen-
hydramine. None of the compounds impaired yeast growth in the
presence of histidine indicating the inhibition observed was recep-
tor-specific.
reducedyeast growthto
yeast growthslightly
reducedyeast growthto
4. Discussion
Here we found that the pig gastrointestinal roundworm, A.
suum, has a GAR that is structurally and likely functionally orthol-
ogous to a GAR present in C. elegans. In terms of structural homol-
ogy, AsGAR-1 possesses features consistent with GARs beyond that
of sequence identity, for example, the expression of multiple iso-
forms of the receptor. Vertebrate muscarinic receptors do not dis-
play alternative splicing whereas this appears to be a feature of
invertebrate GARs; all three C. elegans GARs are alternatively
spliced (Park et al., 2000, 2003; Suh et al., 2001) and the Drosophila
melanogaster ACh GPCR characterized by Millar et al. (1995) also
shows splicing (NCBI Reference Sequences NP_523844.2 and
NP_726440.1). Each of these variants differs from their canonical
receptors by deletions in the i3 loops, more specifically, towards
the middle of these highly variable regions. The physiological sig-
nificance of these deletions is unclear. Even between receptors
with high overall homology such as AsGAR-1 and C. elegans GAR-
1, the i3 loops share little similarity and the deletions here do
not appear to be conserved either in terms of their locations or
the amino acids deleted. One possibility is that because the i3 loop
plays a role in G-protein coupling, these deletions may have an ef-
fect on receptor/G-protein interaction or the specificity of that
interaction. It seems more likely, however, that this is not the case
as no isoform-specific G-protein preference was noted during the
functional expression of C. elegans GARs, which also have deletions
in the middle of the i3 loop (Park et al., 2000, 2003; Suh et al.,
2001). Further, the key muscarinic receptor motifs determining
GPCR/G-protein interaction and the selectivity of that interaction
are located in the i2 loop and at the N- and C-termini of the i3 loop
(Kunkel and Peralta, 1993; Blüml et al., 1994a,b; Zhu et al., 1994;
Blin et al., 1995; Burstein et al., 1995; Högger et al., 1995; Jones
et al., 1995; Liu et al., 1995), not in the middle of the i3 loop where
the GAR deletions typically manifest. A more likely physiological
consequence of these deletion events may be an alteration in ago-
nist-induced receptor desensitization and internalization. Musca-
rinic receptor desensitization occurs via receptor phosphorylation
(Haga and Haga, 1990), typically by protein kinase C (PKC) and/
or G protein-receptor kinases (GRK) at conserved serine and thre-
onine sites in the i3 loop (Haga et al., 1990, 1996; Kameyama et al.,
1994; Nakata et al., 1994; Pals-Rylaarsdam et al., 1995; Pals-Ryla-
arsdam and Hosey, 1997). Deletion events removing the major
phosphorylation sites could alter the kinetics of receptor desensiti-
zation. The 27 amino acid deletion in AsGAR-1b removes a con-
served tyrosine phosphorylation site (see Fig. 1) that, although
different to the serine and threonine residues that typically serve
as substrates for PKC and GRK, may alter the signaling properties
of AsGAR-1b.
Demonstrating functional GAR homology between A. suum and
C. elegans is more difficult but we provide preliminary evidence
that suggests AsGAR-1 could serve a similar functional role to
GAR-1 in C. elegans. This is based on a broadly conserved expres-
sion pattern. Lee et al. (2000) used a GAR-1 promoter-GFP fusion
approach to demonstrate the expression of GAR-1 in a subset of
C. elegans amphidial sensory neurons, and also in the PVM
mechanosensory (stretch) neuron. This strongly supports a role
for GAR-1 in mediating or modulating nematode sensory percep-
tion. We demonstrated AsGAR-1 expression in the head and tail
of Ascaris. These were fairly complex tissue preparations and being
more explicit about cellular expression is difficult. Both head and
tail preparations contained RNA from sensory structures (anterior
amphids, posterior phasmids), nerve rings, somatic and visceral
musculature but a lack of receptor expression in body wall muscle
supports the hypothesis that AsGAR-1 is expressed in areas where
sensory and neuronal elements are enriched. In broad terms the
AsGAR-1 expression pattern is similar to that of GAR-1 in C. elegans
and a conserved functional role in sensory perception could be
hypothesized. In addition to this presumed role in sensory percep-
tion, Keating et al. (2003) observed a ‘‘sluggish” GAR-1 RNAi phe-
notype with a decrease in the number of body bends per minute
compared with the normal nematode sinusoidal waveform. It
may be that GAR-1, like GAR-2, is also a component of the circuits
that regulate nematode locomotion adding to its attractiveness as a
possible drug target. Further study using a more visual in situ ap-
proach such as immunocytochemistry or in situ hybridization will
help delineate AsGAR-1 expression in Ascaris and shed light on its
functionality in this parasite.
Using a yeast expression assay we were able to develop a phar-
macological profile of AsGAR-1. Our hypothesis was that this pro-
file would resemble that of C. elegans GAR-1 and be different to
classical muscarinic pharmacology. In terms of agonist activation,
this was generally found to be the case. Our rank order of agonist
potency at AsGAR-1 correlated with what is known of GAR-1, but
importantly was different to that of vertebrate muscarinic recep-
tors. Specifically, we found pilocarpine to be an ineffective agonist
of AsGAR-1 whereas it is an effective agonist at the M2 receptor,
albeit less potent than other classical muscarinic agonists (McKin-
ney et al., 1991; Lazareno et al., 1993; Bräuner-Osborne and Brann,
1996). Examination of the antagonist profile also supports our
hypothesis, underlining the pharmacological differences between
GARs and muscarinic receptors. Atropine inhibited ACh activation
of AsGAR-1 by 62% but inhibited the M2 muscarinic receptor by
90% (Lee et al., 1999). Pirenzepine inhibited ACh activation of As-
GAR-1 by 23%, but M2 by 84% (Lee et al., 1999). Finally, scopol-
amine inhibited ACh activation of AsGAR-1 by 14%, but M2 by
98% (Lee et al., 1999). Clearly the classical muscarinic antagonists
have much reduced efficacy at the parasite receptor. The pharma-
1220
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222

Page 7

cological differences between GARs and muscarinic receptors may
lie in the conservation, or lack thereof, of key amino acids that de-
fine the ligand receptor interaction. Numerous amino acids in the
transmembrane domains and extracellular loops of muscarinic
receptors have been defined as important for ligand binding and
stabilization of the active state of the receptor (Wess et al., 1991;
Heitz et al., 1999; Hulme et al., 2001). Many of these residues are
conserved between muscarinic receptors and AsGAR-1 but, impor-
tantly, several are not, including the critical tryptophan at position
155 of the M2 receptor (W155), N404, T187 and T190. Such amino
acid variation could result in the altered pharmacological profile
we observed.
Further evidence for the pharmacological distinction between
GARs and muscarinic receptors was provided by the response of
AsGAR-1 to select amine receptor antagonists. Some histamine
receptor antagonists are widely known to have anticholinergic ef-
fects but we found their activity at AsGAR-1 to be different to that
at muscarinic receptors. Promethazine, an H1 receptor antagonist,
diphenhydramine, an H1 antagonist, and cimetidine, an H2 antag-
onist, all display varying degrees of vertebrate muscarinic receptor
antagonism (Kubo et al., 1987; Gwee and Cheah, 1990, 1991; Orze-
chowski et al., 2005; Liu et al., 2006). Only promethazine was an
effective antagonist of AsGAR-1. Mianserin is an antagonist at a2
adrenergic receptors and peripheral 5-HT and histamine receptors
(for review, see Marshall, 1983) and although it is a very weak
muscarinic receptor antagonist (Richelson and Nelson, 1984) it is
an effective AsGAR-1 antagonist at the concentration tested. Final-
ly, propranolol and spiperone were somewhat effective AsGAR-1
antagonists but have not been reported to have any anti-musca-
rinic actions. Ultimately, assessment of the ligand activity at As-
GAR-1 observed in this study leads to the conclusion that
AsGAR-1 displays, at best, atypical muscarinic pharmacology.
In this study we used the yeast, Saccharomyces cerevisiae, as a
host for the heterologous expression of AsGAR-1. Saccharomyces
cerevisiae is a relatively familiar vehicle for GPCR expression and
has been used previously to study muscarinic receptors (Schmidt
et al., 2003; Scarselli et al., 2007), but its utility for invertebrate
GPCR expression is less well reported (Minic et al., 2005). We be-
lieve that the technique employed here is a useful addition to the
parasitologist’s toolbox. In our experience this application has sev-
eral advantages over receptor expression in alternative cell lines.
Yeasts are highly amenable to genetic transformation and obtain-
ing stably transfected lines is more straightforward and rapid than
for mammalian or insect cell lines. Once optimized, we found both
agonist and antagonist assays to be robust and highly suited to our
high-throughput platform (FLEXStation, Molecular Devices). The
yeast system was more cost effective than other assays we have
used as expensive media and cultureware were generally not re-
quired. Finally, this yeast assay was amenable to AsGAR-1 expres-
sion when other cell lines were not; we unsuccessfully attempted
AsGAR-1 expression in two commonly used mammalian cell lines
(CHO and HEK-293) and the insect cell line, Sf9, and in each case,
although we successfully transfected each cell line and observed
mRNA transcription, no functional protein could be detected. In
our hands, only two downsides to this assay were noted. Firstly,
we observed an overall decrease in the potency of ligands, both
agonists and antagonists, compared with other functional expres-
sion formats.Forexample,
20.3 ± 1.7 lM, between one and two orders of magnitude higher
than the approximate EC50for C. elegans GAR-1 expressed in Xeno-
pus oocytes (Park et al., 2000). Others have observed similar po-
tency decreases compared with other assay formats (Wang et al.,
2006) which may be attributable either to accessibility of the
receptor to ligand (a factor of the thick yeast cell wall), or to imper-
fect interaction between the exogenous receptor and the endoge-
nous signaling mechanism. For this reason, high concentrations
theAsGAR-1ACh EC50
was
of agonist and antagonist were used in this study. A second down-
side to the assay was a degree of AsGAR-1 constitutive activity,
which was manifest as yeast growth in response to no drug (see
Fig. 2A). Relative to receptor activation by ACh, the level of consti-
tutive activity encountered was small and not a hindrance to As-
GAR-1 deorphanization. Previous investigators have not reported
consistent constitutive receptor activity using this expression sys-
tem so this activity may not be a problem inherent to the assay
platform but rather, particular to AsGAR-1.
Twocriteriaareimportantinthevalidationofamoleculeasapo-
tential novel drug target for nematode control. One is that the mol-
ecule plays an important biological role, such that interference
with that molecule is detrimental to the parasite. A second is that
theparasitemoleculecanbeselectivelytargetedrelativetothehost.
Further work will be required to define the physiological role of As-
GAR-1 but we provide some evidence that its function is conserved
with that of the C. elegans ortholog, GAR-1. Thus we may find that
Ascaris GARs are also involved in sensory perception, regulation of
locomotion, pharyngeal contractility and reproduction; all are
attractive targets for chemotherapeutic intervention. We have also
demonstrated thatAsGAR-1is pharmacologically differentto verte-
brate muscarinic receptors. This opens the door to the possibility of
drugs acting selectively on parasite GARs and not host G protein-
coupled ACh receptors. On this basis, parasitic nematode GARs war-
rant further investigation as potential novel drug targets.
Acknowledgements
The authors thank Dr. James Broach, Princeton University, for
the yeast strains used here and Cheryl Clark, Iowa State University,
for her assistance with worm collection. Pfizer, Inc. (MK), NIH
Grant No. AI049162 (TAD) and the Natural Sciences and Engineer-
ing Research Council of Canada (PR) supported this research.
References
Bany, I.A., Dong, M.Q., Koelle, M.R., 2003. Genetic and cellular basis for acetylcholine
inhibition of Caenorhabditis elegans egg-laying behavior. J. Neurosci. 23, 8060–
8069.
Blin, N., Yun, J., Wess, J., 1995. Mapping of single amino acid residues required for
selective activation of Gq/11 by the M3 muscarinic acetylcholine receptor. J.
Biol. Chem. 270, 17741–17748.
Blüml, K., Mutschler, E., Wess, J., 1994a. Identification of an intracellular tyrosine
residue critical for muscarinic receptor-mediated stimulation of phosphatidyl
inositol hydrolysis. J. Biol. Chem. 269, 402–405.
Blüml, K., Mutschler, E., Wess, J., 1994b. Functional role of a cytoplasmic aromatic
amino acid in muscarinic receptor-mediated activation of phospholipase C. J.
Biol. Chem. 269, 11537–11541.
Bräuner-Osborne, H., Brann, M.R., 1996. Pharmacology of muscarinic acetylcholine
receptor subtypes (M1–M5): high throughput assays in mammalian cells. Eur. J.
Pharmacol. 295, 93–102.
Burstein, E.S., Spalding, T.A., Hill-Eubanks, D., Brann, M.R., 1995. Structure-function
of muscarinic receptor coupling to G proteins: random saturation mutagenesis
identifies a critical determinant of receptor affinity for G proteins. J. Biol. Chem.
270, 3141–3146.
Colquhoun,L., Holden-Dye,L., Walker,
cholinoceptors on the somatic muscle cells of the parasitic nematode Ascaris
suum. J. Exp. Biol. 158, 509–530.
Dittman, J.S., Kaplan, J.M., 2008. Behavioral impact of neurotransmitter-activated G-
protein-coupled receptors: muscarinic
Caenorhabditis elegans locomotion. J. Neurosci. 28, 7104–7112.
Gerber, D.J., Sotnikova, T.D., Gainetdinov, R.R., Huang, S.J., Caron, M.G., Tonegawa, S.,
2001. Hyperactivity, elevated dopaminergic transmission and response to
amphetamine in M1 muscarinic acetylcholine receptor-deficient mice. Proc.
Natl. Acad. Sci. USA 98, 15312–15317.
Gomeza, J., Shannon, H., Kostenis, E., Felder, C., Zhang, L., Brodkin, J., Grinberg, A.,
Sheng, H., Wess, J., 1999. Pronounced pharmacological deficits in M2 muscarinic
acetylcholine receptor knockout mice. Proc. Natl. Acad. Sci. USA 96, 1692–1697.
Gwee, M.C.E., Cheah, L.S., 1990. Selectivity of cimetidine and ranitidine actions at
some cholinergic sites in the anaesthetised cat. Eur. J. Pharmacol. 183, 2004–
2005.
Gwee, M.C.E., Cheah, L.S., 1991. Antimuscarinic and anticholinesterase activity of
cimetidineandranitidine:clinicallysignificant?Br.J.Clin.Pharmac.32,260–261.
Haga, K., Haga, T., 1990. Dual regulation by G proteins of agonist-dependent
phosphorylation of muscarinic acetylcholine receptors. FEBS Lett. 268, 43–47.
R.J.,1991. Thepharmacology of
and GABABreceptors regulate
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222
1221

Page 8

Haga, K., Haga, T., Ichiyama, A., 1990. Phosphorylation by protein kinase C of the
muscarinic acetylcholine receptor. J. Neurochem. 54, 1639–1644.
Haga, K., Kameyama, K., Haga, T., Kikkawa, U., Shiozaki, K., Uchiyama, H., 1996.
Phosphorylation of human M1 muscarinic acetylcholine receptors by G protein-
coupled receptor kinase 2 and protein kinase C. J. Biol. Chem. 271, 2776–2782.
Hamilton, S.E., Nathanson, N.M., 2001. The M1 receptor is required for muscarinic
activation of mitogen-activated protein (MAP) kinase in murine cerebral
cortical neurons. J. Biol. Chem. 276, 15850–15853.
Heitz, F., Holzwarth, J.A., Gies, J.P., Pruss, R.M., Trumpp-Kallmeyer, S., Hibert, M.F.,
Guenet, C., 1999. Site-directed mutagenesis of the putative human muscarinic
M2 receptor binding site. Eur. J. Pharmacol. 380, 183–195.
Högger, P., Shockley, M.S., Lameh, J., Sadee, W., 1995. Activating and inactivating
mutations in N- and C-terminal i3 loop junctions of muscarinic acetylcholine
Hm1 receptors. J. Biol. Chem. 270, 7405–7410.
Hulme, E.C., Lu, Z.L., Bee, M., Curtis, C.A.M., Saldanha, J., 2001. The conformational
switch in muscarinic acetylcholine receptors. Life Sci. 68, 2495–2500.
Hwang, J.M., Chang, D.J., Kim, U.S., Lee, Y.S., Park, Y.S., Kaang, B.K., Cho, N.J., 1999.
Cloning and functional characterization of a Caenorhabditis elegans muscarinic
acetylcholine receptor. Receptor. Channel. 6, 415–424.
Jones, P.G., Curtis, C.A.M., Hulme, E.C., 1995. The function of a highly-conserved
arginine residue in activation of the muscarinic M1 receptor. Eur. J. Pharmacol.
288, 251–257.
Kameyama, K., Haga, K., Haga, T., Moro, O., Sadee, W., 1994. Activation of a GTP-
binding-protein-coupled receptor kinase (b-adrenergic-receptor kinase-1) by a
muscarinic receptor M2 mutant lacking phosphorylation sites. Eur. J. Biochem.
226, 267–276.
Keating, C.D., Kriek, N., Daniels, M., Ashcroft, N.R., Hopper, N.A., Siney, E.J., Holden-
Dye, L., Burke, J.F., 2003. Whole-genome analysis of 60 G protein-coupled
receptors in Caenorhabditis elegans by gene knockout with RNAi. Curr. Biol. 13,
1715–1720.
Kubo, N., Shirakawa, O., Kuno, T., Tanaka, C., 1987. Antimuscarinic effects of
antihistamines: quantitative evaluation by receptor-binding assay. Jpn. J.
Pharmacol. 43, 277–282.
Kunkel, M.T., Peralta, E.G., 1993. Charged amino acids required for signal
transduction by the M3 muscarinic acetylcholine receptor. EMBO J. 12, 3809–
3815.
Lazareno, S., Farries, T., Birdsall, N.J.M., 1993. Pharmacological characterization of
guanine nucleotide exchange reactions in membranes from CHO cells stably
transfected with human muscarinic receptors M1–M4. Life Sci. 52, 449–456.
Lee, Y.S., Park, Y.S., Chang, D.J., Hwang, J.M., Min, C.K., Kaang, B.K., Cho, N.J., 1999.
Cloning and expression of a G protein linked acetylcholine receptor from
Caenorhabditis elegans. J. Neurochem. 72, 58–65.
Lee, Y.S., Park, Y.S., Nam, S., Suh, S.J., Lee, J., Kaang, B.K., Cho, N.J., 2000.
Characterization of GAR-2, a novel G protein-linked acetylcholine receptor
from Caenorhabditis elegans. J. Neurochem. 75, 1800–1809.
Liu, H., Zheng, Q., Farley, J.M., 2006. Antimuscarinic actions of antihistamines on the
heart. J. Biomed. Sci. 13, 395–401.
Liu, J., Conklin, B.R., Blin, N., Yun, J., Wess, J., 1995. Identification of a receptor/G-
protein contact site critical for signaling specificity and G-protein activation.
Proc. Natl. Acad. Sci. USA 92, 11642–11646.
Liu, Y., LeBoeuf, B., Garcia, L.R., 2007. Gaq-coupled muscarinic acetylcholine
receptors enhance nicotinic acetylcholine receptor signaling in Caenorhabditis
elegans mating behavior. J. Neurosci. 27, 1411–1421.
McKinney, M., Miller, J.H., Gibson, V.A., Nickelson, L., Aksoy, S., 1991. Interactions of
agonists with M2 and M4 muscarinic receptor subtypes mediating cyclic AMP
inhibition. Mol. Pharmacol. 40, 1014–1022.
Marshall, R.J., 1983. The pharmacology of mianserin–an update. Br. J. Clin.
Pharmacol. 15, 263S–268S.
Martin, R.J., Valkanov, M.A., 1996. Effects of acetylcholine on a slow voltage-
activated non-selective cation current mediated by non-nicotinic receptors on
isolated Ascaris muscle bags. Exp. Physiol. 81, 909–925.
Matsui, M., Motomura, D., Karasawa, H., Fujikawa, T., Jiang, J., Komiya, Y., Takahashi,
S., Taketo, M.M., 2000. Multiple functional defects in peripheral autonomic
organs in mice lacking muscarinic acetylcholine receptor gene for the M3
subtype. Proc. Natl. Acad. Sci. USA 97, 9579–9584.
Millar, N.S., Baylis, H.A., Reaper, C., Bunting, R., Mason, W.T., Sattelle, D.B., 1995.
Functional expression of a cloned Drosophila muscarinic acetylcholine receptor
in a stable Drosophila cell line. J. Exp. Biol. 198, 1843–1850.
Minic, J., Persuy, M.A., Godel, E., Aioun, J., Connerton, I., Salesse, R., Pajot-Augy, E.,
2005. Functional expression of olfactory receptors in yeast and development of
a bioassay for odorant screening. FEBS J. 272, 524–537.
Nakata, H., Kameyama, K., Haga, K., Haga, T., 1994. Location of agonist-dependent-
phosphorylation sites in the third intracellular loop of muscarinic acetylcholine
receptors (M2 subtype). Eur. J. Biochem. 220, 29–36.
Orzechowski, R.F., Currie, D.S., Valancius, C.A., 2005. Comparative anticholinergic
effects of 10 histamine H1 receptor antagonists in two functional models. Eur. J.
Pharmacol. 506, 257–264.
Pals-Rylaarsdam, R., Xu, Y., Witt-Enderby, P., Benovic, J.L., Hosey, M.M., 1995.
Desensitization and internalization of the M2 muscarinic acetylcholine receptor
are directed by independent mechanisms. J. Biol. Chem. 270, 29004–29011.
Pals-Rylaarsdam, R., Hosey, M.M., 1997. Two homologous phosphorylation domains
differentially contribute to desensitization and internalization of the M2
muscarinic acetylcholine receptor. J. Biol. Chem. 272, 14152–14158.
Park, Y.S., Lee, Y.S., Cho, N.J., Kaang, B.S., 2000. Alternative splicing of GAR-1, a
Caenorhabditis elegans G protein-linked acetylcholine receptor gene. Biochem.
Biophys. Res. Comm. 268, 354–358.
Park, Y.S., Kim, S., Shin, Y., Choi, B., Cho, N.J., 2003. Alternative splicing of the
muscarinic acetylcholine receptor GAR-3 in Caenorhabditis elegans. Biochem.
Biophys. Res. Comm. 308, 961–965.
Putrenko, I., Zakikhani, M., Dent, J.A., 2005. A family of acetylcholine-gated chloride
channel subunits in Caenorhabditis elegans. J. Biol. Chem. 280, 6392–6398.
Richelson, E., Nelson, A., 1984. Antagonism by antidepressants of neurotransmitter
receptors of normal human brain in vitro. J. Pharmacol. Exp. Ther. 230, 94–102.
Robertson, S.J., Martin, R.J., 1993. Levamisole-activated single channel currents from
the muscle of the nematode parasite, Ascaris suum. Br. J. Pharmacol. 108, 70–
178.
Robertson, S.J., Pennington, A.J., Evans, A.M., Martin, R.J., 1994. The action of
pyrantel as an agonist and open channel blocker at acetylcholine receptors in
isolated Ascaris suum muscle vesicles. Eur. J. Pharmacol. 271, 273–282.
Scarselli, M., Li, B., Kim, S.K., Wess, L., 2007. Multiple residues in the second
extracellular loop are critical for M3 muscarinic acetylcholine receptor
activation. J. Biol. Chem. 282, 7385–7396.
Schmidt, C., Li, B., Bloodworth, L., Erlenbach, I., Zheng, F.Y., Wess, J., 2003. Random
mutagenesis of the M3 muscarinic acetylcholine receptor expressed in yeast. J.
Biol. Chem. 278, 30248–30260.
Segerberg, M.A., Stretton, A.O.W., 1993. Actions of cholinergic drugs in the
nematode Ascaris suum. J. Gen. Physiol. 101, 271–296.
Steger, K.A., Avery, L., 2004. The GAR-3 muscarinic receptor cooperates with
calcium signals to regulate muscle contraction in the Caenorhabditis elegans
pharynx. Genetics 167, 633–643.
Stengel, P.W., Gomeza, J., Wess, J., Cohen, M.L., 2000. M2 and M4 receptor knockout
mice: muscarinic receptor function in cardiac and smooth muscle in vitro. J.
Pharmacol. Exp. Ther. 292, 877–885.
Suh, S.J., Park, Y.S., Lee, Y.S., Cho, T.J., Kaang, B.K., Cho, N.J., 2001. Three functional
isoforms of GAR-2, a Caenorhabditis elegans G-protein-linked acetylcholine
receptor, are produced by alternate splicing. Biochem. Biophys. Res. Comm. 288,
1238–1243.
Wang, Z.X., Broach, J.R., Peiper, S.C., 2006. Functional expression of CXCR4 in
Saccharomyces cerevisiae in the development of powerful tools for the
pharmacological characterization of CXCR4. In: Ali, H., Haribabu, B. (Eds.),
Methods in Molecular Biology, vol. 332: Transmembrane Signaling Protocols,
Second Edition. Humana Press Inc., Totowa, NJ, pp. 115–127.
Wess, J., Gdula, D., Brann, M.R., 1991. Site-directed mutagenesis of the M3
muscarinic receptor: identification of a series of threonine and tyrosine
residues involved in agonist but not antagonist binding. EMBO J. 10, 3729–
3734.
Yamada, M., Lamping, K.G., Duttaroy, A., Zhang, W., Cui, Y., Bymaster, F.P., McKinzie,
D.L., Felder, C.C., Deng, C.-X., Faraci, F.M., Wess, J., 2001. Cholinergic dilation of
cerebral blood vessels in abolished M5 muscarinic receptor knockout mice.
Proc. Natl. Acad. Sci. USA 98, 14096–14101.
Zhang, W., Yamada, M., Gomeza, J., Basile, A.S., Wess, J., 2002. Multiple muscarinic
receptor subtypes modulate striatal dopamine release, as studied with M1–M5
muscarinic receptor knockout mice. J. Neurosci. 22, 6347–6352.
Zhu, S.Z., Wang, S.Z., Hu, J., El-Fakahany, E.E., 1994. An arginine residue conserved in
most G protein-coupled receptors is essential for the function of the M1
muscarinic receptor. Mol. Pharmacol. 45, 517–523.
1222
M.J. Kimber et al./International Journal for Parasitology 39 (2009) 1215–1222