Mice expressing an error-prone DNA polymerase in mitochondria display elevated replication pausing and chromosomal breakage at fragile sites of mitochondrial DNA.

Abstract

Expression of a proof-reading deficient form of mitochondrial DNA (mtDNA) polymerase gamma, POLG, causes early death accompanied by features of premature ageing in mouse. However, the mechanism of cellular senescence remains unresolved. In addition to high levels of point mutations of mtDNA, the POLG mutator mouse harbours linear mtDNAs. Using one- and two-dimensional agarose gel electrophoresis, we show that the linear mtDNAs derive from replication intermediates and are indicative of replication pausing and chromosomal breakage at the accompanying fragile sites. Replication fork arrest is not random but occurs at specific sites close to two cis-elements known as O(H) and O(L). Pausing at these sites may be enhanced in the case of exonuclease-deficient POLG owing to delayed resumption of DNA replication, or replisome instability. In either case, the mtDNA replication cycle is perturbed and this might explain the progeroid features of the POLG mutator mouse.

Full text

Page 1

Published online 25 February 2009Nucleic Acids Research, 2009, Vol. 37, No. 72327–2335
doi:10.1093/nar/gkp091
Mice expressing an error-prone DNA polymerase in
mitochondria display elevated replication pausing
and chromosomal breakage at fragile sites of
mitochondrial DNA
Laura J. Bailey1, Tricia J. Cluett1, Aurelio Reyes1, Tom A. Prolla2,
Joanna Poulton3, Christiaan Leeuwenburgh4and Ian J. Holt1,*
1MRC-Dunn Human Nutrition Unit, Wellcome Trust-MRC Building, Hills Road Cambridge, CB2 0XY, UK,
2Department of Genetics and Medical Genetics, University of Wisconsin, Madison, WI,3Nuffield Department
of Obstetrics and Gynaecology, The Women’s Centre, John Radcliffe Hospital, Headington, Oxford OX3 9DU,
UK and4Institute on Aging, Department of Aging and Geriatrics College of Medicine, University of Florida,
Gainesville, FL 32611, USA
Received December 17, 2008; Revised January 29, 2009; Accepted February 4, 2009
ABSTRACT
Expression of a proof-reading deficient form of
mitochondrial DNA (mtDNA) polymerase c, POLG,
causes early death accompanied by features of
premature ageing in mouse. However, the mecha-
nism of cellular senescence remains unresolved. In
addition to high levels of point mutations of mtDNA,
the POLG mutator mouse harbours linear mtDNAs.
Usingone-and two-dimensional
electrophoresis, we show that the linear mtDNAs
derive from replication intermediates and are indi-
cative of replication pausing and chromosomal
breakage at the accompanying fragile sites. Repli-
cation fork arrest is not random but occurs at spe-
cific sites close to two cis-elements known as OH
and OL. Pausing at these sites may be enhanced in
the case of exonuclease-deficient POLG owing to
delayed resumption of DNA replication, or replisome
instability. In either case, the mtDNA replication
cycle is perturbed and this might explain the pro-
geroid features of the POLG mutator mouse.
agarose gel
INTRODUCTION
Mitochondria have been proposed to play an important
role in longevity and ageing. Ablation of the mitochon-
drial (1), but not the cytosolic (2) form of superoxide dis-
mutase has profound and widespread deleterious effects
on organismal health; and over-expression of catalase
in mice increases longevity (3). The case for mitochondrial
DNA (mtDNA) involvement in ageing is uncertain,
as many reports have detected only low levels of
mutant mtDNA (4); an exception is the accumulation of
partially deleted (or partially duplicated) mtDNAs in
the Substantia nigra of aged individuals, particularly
those with Parkinson’s disease (5,6). The creation of
a mouse with a mutant mtDNA polymerase lacking a
functionalproof-readingdomain
perturbing mtDNA metabolism is highly deleterious
and shortens the life-span of the mouse (7,8). However,
the high levels of point mutations found in the mutator
mouse are never reached in the course of normal ageing
(9). The first mice with the premature ageing phenotype
also had high levels of sub-genomic linear pieces of
mtDNA, (‘deleted’ mtDNAs), in addition to full-length
circular molecules of 16kb (8). The most prominent
linear DNA species’ spanned ?11kb, from the major
non-coding region (NCR) to the cluster of five tRNA
genes that are interrupted by a short spacer region,
which functions as a prominent start site of lagging
strand DNA synthesis (OL) (8). These fragments are
not archetypal mtDNA deletions, mapping as they do
to the reciprocal region of most pathological deletions
and being linear as oppose to circular molecules (10,11).
Initiation and termination of replication occur fre-
quently in the NCR (12,13), and OL appears to be a
replication pause site (14). Replication fork arrest in the
NCR (nt 15424–16300) and at OL(nt 5160–5191) predicts
a prominent replication intermediate with a bubble span-
ning ?11kb, with junctions susceptible to nicking
demonstratedthat
*To whom correspondence should be addressed. Tel: 44 12 23 25 28 40; Fax: 44 12 23 25 28 45; Email: holt@mrc-dunn.cam.ac.uk
? 2009 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 2

by single-strand (S1) nuclease, which could result in the
release of one branch of the bubble (illustrated schemati-
cally in Figure 1). If the abundant linear DNAs of the
mutator mouse were broken replication intermediates
then this would offer an explanation of the phenotypic
consequences of POLG exonuclease deficiency. In the
absence of repair, chromosomal breakage is effectively
futile replication, and a high steady-state level of linear
DNAs would imply that whatever repair systems exist
in mitochondria for dealing with strand breaks, they
are overwhelmed in the mutator mouse. As well as being
wasteful, chromosomal breaks are hazardous, as the resul-
tant DNA ends can invade other molecules precipitating
illegitimate recombination, and genome rearrangement.
Even if they remain intact, paused or stalled replication
forks can reverse creating ends which are equally recom-
binogenic, and so cells go to considerable lengths to rescue
or remove stalled replication forks (15,16).
Here we show that linear mtDNAs, of the type docu-
mented previously in the mutator mouse (8), can indeed
be generated from mtDNA of control mice by means of
single-strand nuclease treatment, and so they are inferred
to derive from paused replication intermediates. In solid
tissue of mutator mouse, paused replication intermediates
were highly abundant indicating that expression of
a proof-reading defective mtDNA polymerase leads to
elevated or prolonged replication pausing. These findings
suggest that perturbed mtDNA replication is an important
feature of the mutator mouse that is likely to contribute
to its pathophysiology.
MATERIALS AND METHODS
Solid tissue analysis utilized control female BALB/CJ
mice aged 4–6 weeks (Figure 1) or mutator mice POLG
D257A, of a mixed 129/ICR/B6 genetic background (7)
and wild-type littermates (Figures 2–5). Mouse liver
mtDNA isolation, restriction digestion and 2D-AGE
were as described previously (12). 1D-AGE conditions
are indicated in the figure legends. S1 nuclease treatment
was 1U for 10min at 378C (Figures 1 and 2), or 1U for
1min at 378C (Figure 5). From (17), mouse mtDNA
probes were 50–30: a nt 8201–8625; ACGCCTAATCAA
CAACCGTCTC and CATGGACTTGGATTAACTAT
GTGATATGC; a2 8031–8625 TTACACCTACTACCC
AACTAT CCATAAATC and CATGGACTTGGATTA
ACTATGTGATATGC; b nt 14903–15401 CAGACAA
CTACATACCAGCTAATCCAC and ACCAGCTTTG
GGTGCTGGTG; c nt 4081–4676 AACAAAATACTTC
GTCACACAAGCAACAGC and GAAGGCCTCCTAG
GGATAGTAATATCA; d nt 15511–16034 ATCAATG
GTTC AGGTCATAAAATAATCATCAAC and GCCT
TAGGTGATTGGGTTTTGC; e nt 16068–356 TCAAT
ACCAAATTTTAACTCTCCAAACCCCCCA and AC
GCCGAAGATAATTAGTTTGGGTTAATCG;
5203–5697 GAGATTTCTCTACACCTTCGAATTTGC
and TTCCTGCTCCTGCTTCTACTATTGATG.
XhoI/S1 treated mouse mtDNA was recovered from
1D agarose gels by electrophoresis at 70V for 2h into
RecochipsTM(TaKaRa, Japan) and ligated overnight
f nt
with 200U of T4 ligase (New England Biolabs), at 228C;
the junction of the ligated DNA fragments was amplified
over the course of 30 cycles of 948C for 30s, 688C for
30s and 728C for 30s using Biotaq (Bioline), or KOD
HiFi DNA polymerase (Novagen). SacI/S1 digested
mtDNA was gel-extracted, cloned and sequenced using
the same approach. Primers were 50–30: TGACTTGTCC
CACTAATAATCGGAG nt 5568–5592 and CCCAAAG
AATCAGAACAGATGCTG nt 6044–6021; GGATATA
CGACTGCTATAGCTACTGAGG, nt 13 843–13 870
combined with CCTTAAATAAGACATCTCGATGGT
ATCG, nt 15840–15867 or CCATGTCTTGATAGTAT
AAACATTACTCTGGTC,
case of material eluted into Recochip 2 (see Figure 3A)
a second round of PCR was employed using nested
primers: GAGGAATATCCAGAGACTTGGGGATCT
AACTG nt 13 815–13 846 and GGTCTTGTAAACCT
GAAATGAAGATCTTCTCTTCTC nt 15314–15350.
In all cases there was a final extension step of 728C
for 10min with Biotaq polymerase to ensure addition
of a terminal adenine nucleotide. After cloning into
pcr2.1 (Invitrogen) the products were sequenced by
Geneservices.
Neutral 2D agarose gel electrophoresis (2D-AGE) was
essentially as described previously (12). Typical conditions
were: first dimension electrophoresis, 28V for 15h
at room temperature in a 0.4% agarose gel; second dimen-
sion electrophoresis 1% agarose, 260mA for 6h at 48C.
After electrophoresis, gels were alkaline blotted onto
nylon membranes and hybridized to radiolabelled probes
corresponding to nt 15511–16034 and nt 5568–6044 of
the mouse mitochondrial genome, by overnight incuba-
tion at 658C in 7% SDS, 0.25M sodium phosphate
pH 7.4. Post-hybridization washes were 1? SSC three
times, followed by 1? SSC, 0.1% SDS twice, each for
20min at 658C. Filters were exposed to X-ray film and
developed after 3–7 days, or exposed to phosphor imaging
plates for quantification of spots of RIs and unit length
fragments (1n), using a TyphoonTMphosphorimager (GE
Healthcare).
nt 15286–15318. In the
RESULTS
Single-strand nuclease treatment ofcontrol mouse liver
mtDNA generates linear DNA molecules of ~11kb
To test the idea that replication forks paused in the vicin-
ity of the NCR and OLare fragile, purified liver mtDNA
of normal control mice was treated with single-strand
specific S1 nuclease and the products of the reaction frac-
tionated in 1D on agarose gels. S1 nuclease-treated
mtDNA revealed a doublet not detectable in untreated
samples (Figure 1A–F). The products of S1 nuclease
treatment were very similar to the sub-genomic linear
mtDNAs reported for the POLG mutator mouse (8),
as they covered approximately the region from the NCR
to OL, based on the results of a series of hybridizations
to probes scattered around the mouse mitochondrial
genome (Figure 1A–F). However, the shorter of the two
bands lacked at least some of the NCR, as it was not
detected with a probe spanning nucleotide numbers
2328
Nucleic Acids Research, 2009, Vol. 37,No. 7

Page 3

15511–16034 (Figure 1D). To improve the resolution of
the S1 nuclease products, mouse liver mtDNA was
first digested with XhoI, which cuts mouse mtDNA
once only at nt 13558. A probe corresponding to nt
14903–15401 of mouse mtDNA revealed a series of
bands of ?2–2.5kb when control mtDNA samples were
treated with S1 nuclease (Figure 1G-ii). On the basis
of their mobility and the probe applied, such fragments
extend from the XhoI site at nt 13558 to positions in
the NCR. Another series of restriction fragments modified
by S1 nuclease treatment mapped near OL(Figure 1G-iii).
These findings corroborate the earlier data from 2D
agarose gels suggesting that mitochondrial replication
pauses in the vicinity of the NCR and OL (12–14).
Furthermore, theanalysis
mtDNA demonstrates that linear mtDNAs can be derived
from replication intermediates, by single-strand nuclease
digestion.
ofcontrolmouse liver
Mapping and sequencing of the11kblinear fragments
of mouse mtDNA from controland mutator mice
Mitochondrial DNA was prepared from liver mitochon-
driaof mutatormiceand age-matchedcontrols
(littermates) purified on sucrose-gradients and analysed
by 1D-AGE. Restriction digested and undigested mutator
mouse mtDNA yielded bands barely detectable in
controls (Figure 2A and B). The majority of these bands
were shorter than the expected restriction fragment, and
the short XhoI digestion products (3 in Figure 2A) were
similar to those produced in control mice by the combined
XhoI/S1 nuclease treatment (Figure 1G-ii). The fragments
?2.5kb in size were detected by a probe covering
nt 14903–15401 (Figure 2A), but not by probes corre-
sponding to nt 8031–8625 (Figure 2B) or 12605–12963
(not shown), and so they must logically extend from
the XhoI restriction site at nt 13558 to the NCR. S1
nuclease treatment of XhoI digested mutator mouse
mtDNA increased the abundance of the 13558-NCR
fragments (Figure 2C), suggesting that at least some of
them were derivatives of replication intermediates. Gel-
extraction of S1/XhoI digested fragments ?2–2.5kb was
followed by circularization, PCR amplification and
sequencing, to define the junctions. This provided con-
firmation that one end (depicted as red diamonds
in Figure 3B) frequently mapped to the NCR. The S1
nuclease treatment removed only the single-stranded
Figure 1. Linear 11kb fragments of mtDNA are released from control mouse liver mtDNA by single-stranded nuclease treatment. The figure shows
a schematic diagram of a replication intermediate of mammalian mtDNA, where fork arrest has occurred in the NCR and near OL; nicking by S1, or
other, nuclease can in theory release a linear fragment of mtDNA of ?11kb as illustrated. S1 nuclease treatment of Balb C mouse liver mtDNA
yielded just such fragments based on a series of probes from around the mouse mitochondrial genome (Panels A–F). (Panels A–D) represent a single
gel: 0.62% agarose, 60V, 30h; whereas, the mtDNA of (Panel E) and (Panel F) was separated on a 0.5% agarose gel, at 65V for 30h. Treating
mouse liver mtDNA with XhoI or SacI, in addition to S1 nuclease, produced shorter fragments (Panel G, i–iii), after separation at 100V for 4h on a
0.8% agarose gel. Probes were assigned lowercase letters (a–f), and the numbers at the foot of the gel panels indicate the span of the probes, based on
the revised mouse mtDNA reference sequence (17).
Nucleic Acids Research,2009, Vol.37, No. 7 2329

Page 4

overhang created by XhoI and so there was no suggestion
that the nuclease treatment removed any uninterrupted
duplex DNA from the NCR end of the fragments.
Several of the fragment ends were close to, yet rarely coin-
cident with, 50-ends of H-strand DNA mapped previously
to the NCR (blue vertical lines in Figure 3B), which are
putative initiation, pause or termination sites (12,13,18).
However, similar-sized fragments of much lower abun-
dance in control samples (yellow diamonds, Figure 3B)
mapped at or near the most prominent 50ends previously
designated as OH, albeit that nt 16065 was the most
common end of linear dsDNA (this report), whereas
16034 was the most abundant free 50DNA end (12).
The other terminus of the linear mtDNA molecules was
often in the vicinity of OL(Figure 3C and D), based on
sequence analysis of SacI digested products of ?4kb
(Figure 2D, species 6). Here again the DNA ends were
dispersed across a region of several hundred nucleotides
(red diamonds in Figure 3D). The ends of the cloned frag-
ments near OLwere less dispersed in control mouse sam-
ples and half of them coincided with prominent free 50
ends ofDNAmapped by
(Figure 3D and Supplementary Figure 2). The minor dif-
ferences in map positions notwithstanding, the end map-
ping data indicate that the linear DNA species of mutator
mouse mitochondria are similar to single-stranded nucle-
ase generated fragments of controls, and so support the
view that they are related to replication pausing.
ligation-mediated PCR
Enhanced replication pausing atdefined sites
in mutator mouse mtDNA
Neutral 2D-AGE has been widely used to characterize
replication intermediates (19,20). If, as suggested above,
Figure 2. Linear 11kb fragments of mtDNA are present at high abundance in mutator mouse liver mtDNA, in the absence of single-strand nuclease
treatment. Liver mtDNA samples isolated from wild-type (Wt) and mutator (M) mice were digested with restriction enzymes, XhoI, MluI or SacI, or
left uncut, and fractionated by 1D-AGE in TBE buffer. Separation conditions were 55V for 20h in 0.4% agarose (Panels A and B) or 100V for 4h
in 0.8% agarose (Panels C and D). After Southern blotting, membranes were probed with PCR products corresponding to nt 14903–15401 (Panels A
and C); and nt 8031–8625 (Panels B and D) of mouse mtDNA. The samples in panels (C) and (D) were treated additionally with single-strand
specific (S1) nuclease after restriction digestion (see ‘Materials and Methods’ section). The two lanes in panel (C) are different exposures of the same
gel; a longer exposure of the digest of Wt mtDNA was needed to show that S1 nuclease generated some fragments of similar size to the abundant
short fragments seen in mutator mouse mtDNA digests. The species that distinguished mutator mouse mtDNA from wild-type mtDNA are
interpreted as follows: 1—replicating theta structures, or eyebrows, as illustrated at the base of the figure. Wild-type mtDNA samples also include
theta structures but their low abundance means they are difficult to detect unless 2D-AGE is applied (12); 2—linear mtDNA fragments of approx-
imately 11kb; 3—XhoI digested mtDNA fragments with one end corresponding to the restriction site at nt 13 558 and the other mapping to the
major non-coding region (NCR); 4—SacI fragments ?7kb, spanning nt 9047 to the NCR; 5—fragments ?8kb, with one end close to OLthe other nt
13 558; 6—fragments ?4kb, with termini at nt 9047 and near OL. The fragments labelled 7 in panel D were gel-extracted, converted to circles, cloned
and sequenced, without recourse to S1 nuclease treatment, and found to contain point mutations, which indicated that the novel fragments were the
result of SacI site gains (see Supplementary Figure 3 for details).
2330
Nucleic Acids Research, 2009, Vol. 37,No. 7

Page 5

replication pausing in the NCR and near OLis much more
frequent or prolonged in the mutator mouse then this
should manifest as accumulated replication intermediates.
Therefore, control and mutator mouse mtDNA was
digested with DraI, or AccI and BspHI, or BclI, and
the products separated by 2D-AGE. Southern hybridiza-
tion to probes detecting the fragment of mtDNA contain-
ing the NCR region revealed a prominent spot on
the standard replication fork (Y) arc in mutator mouse
samples (Figure 4A). A prominent spot on an arc of
replication intermediates is indicative of replication paus-
ing (21); the position of the pause on the three arcs
(Figure 4A) allied to previous 2D-AGE analyses (13,22)
mapped the pause to the NCR, not far from OH. Thus,
this pause site mapped to the same position as one of the
ends of the linear mtDNA fragments (Figures 2 and 3).
Quantification by phosphorimager analysis indicated
that the pause was 12-fold stronger in mutator mouse
samples than wild-type littermates (Figure 4B). The
other end of the linear fragments mapped approximately
to OL (Figure 3C) and so the region spanning nt
3102–7084 with OLnear its centre was analysed, revealing
an 11-fold increase in signal towards the apex of the
ascending Y arc, in mutator mouse liver samples
compared to controls (Figure 5A and B). This is the por-
tion of the arc where replication intermediates paused
in the vicinity of OLwould be expected to resolve. Thus,
both termini of the linear fragments correspond to narrow
regions of prominent replication pausing. Nevertheless,
the cloned fragments need not be perfectly representative
of the paused replication intermediates; for instance, fork
regression and nuclease digestion in vivo could generate
junctions that were no longer partially single stranded
(23), thereby decreasing their fragility. Hence, regressed
forks would be more resistant to S1 nuclease and so
under-represented among the cloned fragments. After
2D-AGE, nuclease-digested, regressed forks would resolve
lower on the ascending Y arc, i.e. closer to the unit length
fragment (1n), than forks where regression had not
occurred, and this could explain why there was a smear
Figure 3. The ends of the prominent linear molecules of mutator mouse mtDNA map to the NCR and in the vicinity of OL. S1 products of mutator
mouse mtDNA were recovered from specific regions of agarose gels using RecochipsTM; repeated separation of some of the material by 1D-AGE
(0.8% agarose, 4h, 100V) was used to confirm successful recovery (panel A, i and ii; panel D, iii). Fragments were circularized, and the junction
amplified, cloned and sequenced. Panel (B) A partial linear map of the mouse mitochondrial genome encompassing the NCR. The ends (red
diamonds) identified by direct sequencing were nt 16033, 16016, 15997, 15995, 15978, 15956 (Recochip 1); and 15875, 15751, 15751, 15750,
15747, 15529, 15489, 15487, 15486, 15467 and 15389 (Recochip 2). Scarcer ends mapping to the NCR were also cloned and sequenced from
control littermates (yellow diamonds). The NCR of mouse mtDNA includes three so-called conserved sequenced boxes (CSBs 1–3), a conserved
central domain, and a predicted clover-leaf structure, TAS, which is believed to effect termination of 7S DNA (D-loop) synthesis. Three of the ends
(15751, 15751 and 15750) in the conserved central domain are flanked by a GC-rich sequence CCGGGCCC and GGGGG, which is extremely rare
in the L-strand of mammalian mtDNAs, suggesting that this may represent a cis-element. Free 50ends of DNA identified previously by LM-PCR are
represented as vertical blue lines; in panel B the free 50ends comprise two clusters, cluster I (OH) and cluster II (12,13,38). The height of the most
prominent free end (nt 16 034) was set arbitrarily and the others expressed as a fraction of its height. Panel (C) The sequenced SacI/S1 products with
an end mapping close to OL(nt 5160–5191) were nt 4946, 5082, 5133, 5201, 5217, 5255, 5257, 5318, 5477 (red diamonds) in mutator mouse samples
and nt 5169, 5193, 5196, 5199, 5244 and 5362 (yellow diamonds) in controls. In humans, free 50ends are concentrated in the tRNACysgene (C),
which is adjacent to OL(38,39) and free 50ends map to similar positions in mouse mtDNA (see Supplementary Figure 2); in panel (C) they are again
represented as blue vertical lines. Panel (D) SacI/S1-treated mutator mouse mtDNA analysed by 1D-AGE, iii is the material that was used to define
the ends of DNA represented as red diamonds in panel (C).
Nucleic Acids Research,2009, Vol.37, No. 72331

Page 6

on the ascending Y arc, rather than a more tightly defined
spot (Figure 5A-2). Logically there must also have been
molecules that had regressed and yet retained some single-
stranded DNA, as S1 nuclease treatment enhanced the
pausing on the Y arc (Figure 5A and illustrated in 5C).
Although almost nothing is known about the reactivation
of replication at pause sites in mitochondria, the appara-
tus to re-start replication is ubiquitous in systems where
Figure 4. Enhanced replication pausing in the NCR of POLG mutator mouse mtDNA. (A) 2D-AGE analysis of mtDNA of control (WT) and
mutator mouse liver was performed after digestion with AccI and BspHI (panels 1 and 2), DraI (panels 3 and 4) or BclI (panels 5 and 6). Arrows
indicate the position on a standard Y arc where replication forks frequently arrest [for details of replication fork arrest, see (40)]. Restriction site
blockage accounts for the high molecular mass fragments of mtDNA (slow-moving Y-like arcs or SMYs), which were previously attributed to RNA
incorporation during mtDNA replication (12). (B) The abundance of paused replication forks mapping to the NCR was 12 times higher than
controls based on TyphoonTMphosphorimager (GE Healthcare) quantification of paused RIs. n=3 experiments using mtDNA derived from two
distinct groups of control and mutator mouse livers.
Figure 5. Increased replication pausing in the vicinity of OLin mutator mouse mtDNA. (A) Liver mtDNA samples from mutator mouse and
controls (WT) were digested with BclI and probed with a PCR product spanning nt 5568–6044 after N2D-AGE, to reveal a fragment encompassing
the OLregion. (B) Pausing at OLwas increased 11-fold based on phosphorimager analysis of gels such as the ones shown in panels 1 and 2. Although
increased pausing on the Y arc was more apparent after a brief single-strand (S1) nuclease treatment (1U for 1min at 378C) (panels 3 and 4),
quantification indicated that the S1 treatment decreased the relative abundance of paused RIs between POLG mutator mouse and control samples
(data not shown), and so the data in B relate to samples that were not treated with S1 nuclease. At least some of the increase in signal on the Y arc
produced by S1 nuclease (panel A-4) can be attributed to the removal of single-stranded DNA from regressed forks, as illustrated in (C).
2332
Nucleic Acids Research, 2009, Vol. 37,No. 7

Page 7

faithful replication is required, and so it is unlikely to
be absent from mitochondria. If pausing is prolonged,
rather than elevated, in the mutator mouse, then this
wouldimplicatePOLG
Alternatively oradditionally,
POLG of mouse may be less processive than the wild-
type enzyme; in vitro this is true of proof-reading deficient
forms of yeast (24), but not mammalian (25), POLG. The
exonuclease-deficient POLG of the mutator mouse may,
nevertheless, make the mitochondrial replisome prone
to collapse on encountering an obstacle to replication,
such as that presented by a pause site. In turn, this
might increase the amount of single-strandedness at the
fork thereby creating fragile sites; chromosomal breakage
at such sites could thereby account for the high levels
of linear DNA fragments in mutator mouse tissues.
Other fragments of mtDNA present in mutator mouse,
at higher abundance than wild-type littermates, were
incompatible with pausing near OHand OL. Some of the
most prominent of these fragments were products of SacI
digestion (species 7, Figure 2D). Cloning and sequencing
indicated that such fragments were the result of point
mutations creating new restriction sites (Supplementary
Figure 3), rather than replication pausing, which provides
further evidence of POLG-generated mutational hotspots
in mammalian mtDNA (26,27).
inre-starting
exonuclease-deficient
replication.
DISCUSSION
Replication pausing mayexplain the progeria-like
features of themutator mouse
That the high incidence of point mutations in the
mtDNA of the mutator mouse (8) is a manifestation of
the crippled exonuclease function of POLG is not a doubt.
However, it remains unclear whether the impact of the
point mutations on oxidative phosphorylation is respon-
sible for the progeria-like features. Respiratory enzyme
activities were reduced by up to 50% of control values
in the mutator mouse, yet the respiratory enzyme capacity
of heart was barely below normal (8). In any case,
decreased respiratory chain capacity is a well-recognized
feature of mitochondrial disease in man, and yet there
is scant evidence of progeria in such disorders (10,28).
The accumulated paused replication intermediates and
linear mtDNA fragments characterized here are a key dis-
tinguishing feature of the mutator mouse: could they
account for the premature ageing phenotype of the
mutator mouse? The high steady-state level of particular
replication intermediates (Figures 4 and 5) indicates that
replication is subject to long delays at specific pause sites,
or else pausing occurs at much higher frequency than
normal during the replication of mtDNA in mice expres-
sing a proof-reading deficient POLG. However, the linear
11kb DNA species generated by breakage of the DNA
at the pause sites is present at a similar level throughout
the life of the mutator mouse, from embryonic develop-
ment to its early death: it does not increase with age.
Nevertheless, enhanced pausing and the failure of innu-
merable rounds of mtDNA replication could well prove
deleterious over time, especially when one considers the
close parallels between the mutator mouse phenotype
and the impact of mutations in the RecQ helicase WRN,
which are responsible for progeria-like syndromes (see
below). Hence, we hypothesize that it is the long-term
impact of chromosomal breakage and aborted replication
that leads to premature ageing of the mutator mouse.
The problem of chromosome breakage could be exacer-
bated by the free ends of the linear DNAs precipitating
recombination, via strand-invasion; thereby giving rise
to deletions (29). Even if the fragile sites remained intact
in vivo, free DNA ends could be generated by fork rever-
sal. Hence, recombination between the two branches of
replication intermediates paused near OHand OLcould
account for the preponderance of deletions in the
so-called major arc of human mtDNA (30). By the same
token, prolonged replication pausing could also underlie
the elevated level of mtDNA deletions in the mutator
mouse that was reported recently (31). However, we
question whether such a low level of deletions (only detect-
able using a PCR-based assay) is, of itself, relevant to the
progeria-like features of the mutator mouse, particularly
as high levels of single or multiple deletions fail to elicit
progeria in humans (10,28).
Parallels between mutantforms ofPOLG and WRN
suggestDNA replication defects often underpin
progeria-like syndromes
Cultured cells from human premature aging syndromes
show replicative senescence. For instance, mutations in
the WRN gene, a RecQ helicase, and in XPD, a helicase
involved in nucleotide excision repair, each cause a
progeria-like syndrome with some features that are similar
to the mutator mouse. WRN protein is implicated in rep-
lication fork recovery (32), and S phase is prolonged in
cultured fibroblasts lacking functional WRN. As men-
tioned above, replication may well be prolonged in the
mitochondria of the mutator mouse, based on the
high steady-state level of mitochondrial replication inter-
mediates (Figures 4 and 5). Fragile sites are prevalent in
nuclear DNA where there is a dearth of the RecQ helicase
WRN, leading to chromosomal breakage (33). The sensi-
tivity of mtRIs to single-strand nuclease in controls and
the high level of sub-genomic linear mtDNA fragments
(?11kb) in mutator mouse (Figures 1 and 2, respectively),
coupled with the high abundance of specific replication
intermediates, suggest that replication pausing in mito-
chondria produces fragile sites, and that breakage at
such sites occurs at high frequency in the mutator
mouse. Thus, here again mutant WRN and POLG pro-
duce similar molecular phenotypes. Furthermore, WRN is
the only RecQ helicase with 30–50exonuclease activity (34),
and it has been shown to be involved in DNA repair
resulting from oxidative damage (35). By analogy with
WRN, POLG may be directly involved in DNA repair
and depend on its 30–50exonuclease activity for this
function. Therefore 30–50exonuclease-deficient POLG
may represent double jeopardy: increased errors during
DNA synthesis and reduced DNA repair capacity. As
such, prolonged pausing may reflect an effort to execute
DNA repair, in which case replication pausing would
Nucleic Acids Research,2009, Vol.37, No. 72333

Page 8

form part of a mitochondrial fidelity-surveillance system,
and one function of pause sites would be to act as DNA
repair checkpoints. The formation of replication inter-
mediates with fragile sites could therefore be envisaged
as a mechanism for rejecting defunct copies of mtDNA;
if pausing is extended due to a high mutant load that
cannot be repaired efficiently then strand breakage
occurs, which effectively aborts replication. The 11kb
linear mtDNAs would therefore be a manifestation of
aborted replication.
While, in this scenario, the underlying problem is after
all the high level of point mutations generated by the
exonuclease-deficient POLG, the effect on cell fitness is
indirect: essential factors involved in DNA metabolism
eventually become exhausted in mitochondria of affected
cells due to increased replication activity that is itself
the result of inadequate DNA repair capacity, owing to
the mutant form of POLG creating many more mutations
than normal and being unable to assist in their repair.
In any event, the 11kb linear mtDNAs are evidence
of futile replication and so it is reasonable to suggest
that this might underpin the progeria-like features of
the mutator mouse, more especially as there is scant
evidence that impairment of oxidative phosphorylation
causes progeria. Indeed it would be remarkable if the
life-long requirement for increased mtDNA replication
in the mutator mouse came at no cost to the animal.
The ‘aberrant replication’ hypothesis can also explain
the modest impact of mutant POLG on ROS production
(36), which has puzzled many researchers, as elevated
ROS is a frequently allied to mitochondrial diseases
[(37) and references therein]. According to our hypothesis,
progeria-like phenotypes of the mutator mouse are not
primarily a consequence of the downstream effects of
expressing mutant mtDNA, but an effect of trying to
prevent mutations accumulating to such a level that
ROS homeostasis and mtDNA expression are catastrophi-
cally compromised. Moreover, because both nuclear and
mtDNA metabolism are co-dependent on numerous
factors, including DNA ligase III, uracil DNA glyco-
sylase, Flap endonuclease 1, Brca1, RNase H1 and the
nucleotide precursor pool, the increased sequestration
of such materials by mitochondria with deficient POLG
might conceivably impact on nuclear DNA replication.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
ACKNOWLEDGEMENTS
We thank Dr M. Yang for preparing mouse mtDNA.
FUNDING
Medical Research Council [to I.J.H. and J.P.]; the
WellcomeTrust[toJ.P.];
Framework 6 Integrated Programme – EU Mitocombat
[to I.H. and A.R.]; National Institutes of Health grants
AG021905 [to T.A.P.], AG17994 and AG21042 [to C.L.].
the European Union
Funding for open access charge: Medical Research
Council.
Conflict of interest statement. None declared.
REFERENCES
1. Li,Y., Huang,T.T., Carlson,E.J., Melov,S., Ursell,P.C., Olson,J.L.,
Noble,L.J., Yoshimura,M.P., Berger,C., Chan,P.H. et al. (1995)
Dilated cardiomyopathy and neonatal lethality in mutant mice
lacking manganese superoxide dismutase. Nat. Genet., 11, 376–381.
2. Reaume,A.G., Elliott,J.L., Hoffman,E.K., Kowall,N.W.,
Ferrante,R.J., Siwek,D.F., Wilcox,H.M., Flood,D.G., Beal,M.F.,
Brown,R.H. Jr. et al. (1996) Motor neurons in Cu/Zn superoxide
dismutase-deficient mice develop normally but exhibit enhanced
cell death after axonal injury. Nat. Genet., 13, 43–47.
3. Schriner,S.E., Linford,N.J., Martin,G.M., Treuting,P.,
Ogburn,C.E., Emond,M., Coskun,P.E., Ladiges,W., Wolf,N.,
Van Remmen,H. et al. (2005) Extension of murine life span
by overexpression of catalase targeted to mitochondria. Science,
308, 1909–1911.
4. Jacobs,H.T. (2003) The mitochondrial theory of aging: dead or
alive? Aging Cell, 2, 11–17.
5. Bender,A., Krishnan,K.J., Morris,C.M., Taylor,G.A., Reeve,A.K.,
Perry,R.H., Jaros,E., Hersheson,J.S., Betts,J., Klopstock,T. et al.
(2006) High levels of mitochondrial DNA deletions in substantia
nigra neurons in aging and Parkinson disease. Nat. Genet., 38,
515–517.
6. Kraytsberg,Y., Kudryavtseva,E., McKee,A.C., Geula,C.,
Kowall,N.W. and Khrapko,K. (2006) Mitochondrial DNA dele-
tions are abundant and cause functional impairment in aged human
substantia nigra neurons. Nat. Genet., 38, 518–520.
7. Kujoth,G.C., Hiona,A., Pugh,T.D., Someya,S., Panzer,K.,
Wohlgemuth,S.E., Hofer,T., Seo,A.Y., Sullivan,R., Jobling,W.A.
et al. (2005) Mitochondrial DNA mutations, oxidative stress, and
apoptosis in mammalian aging. Science, 309, 481–484.
8. Trifunovic,A., Wredenberg,A., Falkenberg,M., Spelbrink,J.N.,
Rovio,A.T., Bruder,C.E., Bohlooly,Y.M., Gidlof,S., Oldfors,A.,
Wibom,R. et al. (2004) Premature ageing in mice expressing defec-
tive mitochondrial DNA polymerase. Nature, 429, 417–423.
9. Vermulst,M., Bielas,J.H., Kujoth,G.C., Ladiges,W.C.,
Rabinovitch,P.S., Prolla,T.A. and Loeb,L.A. (2007) Mitochondrial
point mutations do not limit the natural lifespan of mice. Nat.
Genet., 39, 540–543.
10. Holt,I.J., Harding,A.E., Cooper,J.M., Schapira,A.H., Toscano,A.,
Clark,J.B. and Morgan-Hughes,J.A. (1989) Mitochondrial
myopathies: clinical and biochemical features of 30 patients
with major deletions of muscle mitochondrial DNA. Ann. Neurol.,
26, 699–708.
11. Zeviani,M., Servidei,S., Gellera,C., Bertini,E., DiMauro,S. and
DiDonato,S. (1989) An autosomal dominant disorder with
multiple deletions of mitochondrial DNA starting at the D-loop
region. Nature, 339, 309–311.
12. Yasukawa,T., Reyes,A., Cluett,T.J., Yang,M.Y., Bowmaker,M.,
Jacobs,H.T. and Holt,I.J. (2006) Replication of vertebrate mito-
chondrial DNA entails transient ribonucleotide incorporation
throughout the lagging strand. EMBO J., 25, 5358–5371.
13. Yasukawa,T., Yang,M.Y., Jacobs,H.T. and Holt,I.J. (2005) A
bidirectional origin of replication maps to the major noncoding
region of human mitochondrial DNA. Mol. Cell, 18, 651–662.
14. Holt,I.J., Lorimer,H.E. and Jacobs,H.T. (2000) Coupled leading-
and lagging-strand synthesis of mammalian mitochondrial DNA.
Cell, 100, 515–524.
15. Cox,M.M., Goodman,M.F., Kreuzer,K.N., Sherratt,D.J.,
Sandler,S.J. and Marians,K.J. (2000) The importance of
repairing stalled replication forks. Nature, 404, 37–41.
16. McGlynn,P. and Lloyd,R.G. (2002) Recombinational repair and
restart of damaged replication forks. Nat. Rev., 3, 859–870.
17. Bayona-Bafaluy,M.P., Acin-Perez,R., Mullikin,J.C., Park,J.S.,
Moreno-Loshuertos,R., Hu,P., Perez-Martos,A.,
Fernandez-Silva,P., Bai,Y. and Enriquez,J.A. (2003) Revisiting
the mouse mitochondrial DNA sequence. Nucleic Acids Res., 31,
5349–5355.
2334
Nucleic Acids Research, 2009, Vol. 37,No. 7

Page 9

18. Fish,J., Raule,N. and Attardi,G. (2004) Discovery of a major
D-loop replication origin reveals two modes of human mtDNA
synthesis. Science, 306, 2098–2101.
19. Brewer,B.J. and Fangman,W.L. (1987) The localization of replica-
tion origins on ARS plasmids in S. cerevisiae. Cell, 51, 463–471.
20. Friedman,K.L. and Brewer,B.J. (1995) Analysis of replication
intermediates by two-dimensional agarose gel electrophoresis.
Methods Enzymol., 262, 613–627.
21. Brewer,B.J., Lockshon,D. and Fangman,W.L. (1992) The arrest
of replication forks in the rDNA of yeast occurs independently
of transcription. Cell, 71, 267–276.
22. Bowmaker,M., Yang,M.Y., Yasukawa,T., Reyes,A., Jacobs,H.T.,
Huberman,J.A. and Holt,I.J. (2003) Mammalian mitochondrial
DNA replicates bidirectionally from an initiation zone.
J. Biol. Chem., 278, 50961–50969.
23. Lusetti,S.L. and Cox,M.M. (2002) The bacterial RecA protein
and the recombinational DNA repair of stalled replication forks.
Annu. Rev. Biochem., 71, 71–100.
24. Foury,F. and Vanderstraeten,S. (1992) Yeast mitochondrial DNA
mutators with deficient proofreading exonucleolytic activity.
EMBO J., 11, 2717–2726.
25. Longley,M.J., Ropp,P.A., Lim,S.E. and Copeland,W.C. (1998)
Characterization of the native and recombinant catalytic subunit
of human DNA polymerase gamma: identification of residues
critical for exonuclease activity and dideoxynucleotide sensitivity.
Biochemistry, 37, 10529–10539.
26. Khrapko,K., Coller,H.A., Andre,P.C., Li,X.C., Hanekamp,J.S. and
Thilly,W.G. (1997) Mitochondrial mutational spectra in human cells
and tissues. Proc. Natl Acad. Sci. USA, 94, 13798–13803.
27. Zheng,W., Khrapko,K., Coller,H.A., Thilly,W.G. and
Copeland,W.C. (2006) Origins of human mitochondrial point
mutations as DNA polymerase gamma-mediated errors.
Mutat. Res., 599, 11–20.
28. Suomalainen,A. and Kaukonen,J. (2001) Diseases caused by nuclear
genes affecting mtDNA stability. Am. J. Med. Genet., 106, 53–61.
29. Labib,K. and Hodgson,B. (2007) Replication fork barriers: pausing
for a break or stalling for time? EMBO Rep., 8, 346–353.
30. Samuels,D.C., Schon,E.A. and Chinnery,P.F. (2004) Two direct
repeats cause most human mtDNA deletions. Trends Genet., 20,
393–398.
31. Vermulst,M., Wanagat,J., Kujoth,G.C., Bielas,J.H.,
Rabinovitch,P.S., Prolla,T.A. and Loeb,L.A. (2008) DNA deletions
and clonal mutations drive premature aging in mitochondrial
mutator mice. Nat. Genet., 40, 392–394.
32. Machwe,A., Xiao,L., Lloyd,R.G., Bolt,E. and Orren,D.K. (2007)
Replication fork regression in vitro by the Werner syndrome protein
(WRN): Holliday junction formation, the effect of leading arm
structure and a potential role for WRN exonuclease activity.
Nucleic Acids Res., 35, 5729–5747.
33. Pirzio,L.M., Pichierri,P., Bignami,M. and Franchitto,A. (2008)
Werner syndrome helicase activity is essential in maintaining fragile
site stability. J. Cell Biol., 180, 305–314.
34. Huang,S., Beresten,S., Li,B., Oshima,J., Ellis,N.A. and Campisi,J.
(2000) Characterization of the human and mouse WRN 30!50
exonuclease. Nucleic Acids Res., 28, 2396–2405.
35. Das,A., Boldogh,I., Lee,J.W., Harrigan,J.A., Hegde,M.L.,
Piotrowski,J., de Souza Pinto,N., Ramos,W., Greenberg,M.M.,
Hazra,T.K. et al. (2007) The human Werner syndrome protein
stimulates repair of oxidative DNA base damage by the DNA
glycosylase NEIL1. J. Biol. Chem., 282, 26591–26602.
36. Trifunovic,A., Hansson,A., Wredenberg,A., Rovio,A.T., Dufour,E.,
Khvorostov,I., Spelbrink,J.N., Wibom,R., Jacobs,H.T. and
Larsson,N.G. (2005) Somatic mtDNA mutations cause aging
phenotypes without affecting reactive oxygen species production.
Proc. Natl Acad. Sci. USA, 102, 17993–17998.
37. Vergani,L., Malena,A., Sabatelli,P., Loro,E., Cavallini,L.,
Magalhaes,P., Valente,L., Bragantini,F., Carrara,F., Leger,B. et al.
(2007) Cultured muscle cells display defects of mitochondrial
myopathy ameliorated by anti-oxidants. Brain, 130, 2715–2724.
38. Kang,D., Miyako,K., Kai,Y., Irie,T. and Takeshige,K. (1997)
In vivo determination of replication origins of human mitochondrial
DNA by ligation-mediated polymerase chain reaction. J. Biol.
Chem., 272, 15275–15279.
39. Hyvarinen,A.K., Pohjoismaki,J.L., Reyes,A., Wanrooij,S.,
Yasukawa,T., Karhunen,P.J., Spelbrink,J.N., Holt,I.J. and
Jacobs,H.T. (2007) The mitochondrial transcription termination
factor mTERF modulates replication pausing in human mitochon-
drial DNA. Nucleic Acids Res., 35, 6458–6474.
40. Brewer,B.J. and Fangman,W.L. (1988) A replication fork barrier at
the 30end of yeast ribosomal RNA genes. Cell, 55, 637–643.
Nucleic Acids Research,2009, Vol.37, No. 7 2335