Use of high-density tiling microarrays to identify mutations globally and elucidate mechanisms of drug resistance in Plasmodium falciparum.

Abstract

The identification of genetic changes that confer drug resistance or other phenotypic changes in pathogens can help optimize treatment strategies, support the development of new therapeutic agents, and provide information about the likely function of genes. Elucidating mechanisms of phenotypic drug resistance can also assist in identifying the mode of action of uncharacterized but potent antimalarial compounds identified in high-throughput chemical screening campaigns against Plasmodium falciparum.
Here we show that tiling microarrays can detect de novo a large proportion of the genetic changes that differentiate one genome from another. We show that we detect most single nucleotide polymorphisms or small insertion deletion events and all known copy number variations that distinguish three laboratory isolates using readily accessible methods. We used the approach to discover mutations that occur during the selection process after transfection. We also elucidated a mechanism by which parasites acquire resistance to the antimalarial fosmidomycin, which targets the parasite isoprenoid synthesis pathway. Our microarray-based approach allowed us to attribute in vitro derived fosmidomycin resistance to a copy number variation event in the pfdxr gene, which enables the parasite to overcome fosmidomycin-mediated inhibition of isoprenoid biosynthesis.
We show that newly emerged single nucleotide polymorphisms can readily be detected and that malaria parasites can rapidly acquire gene amplifications in response to in vitro drug pressure. The ability to define comprehensively genetic variability in P. falciparum with a single overnight hybridization creates new opportunities to study parasite evolution and improve the treatment and control of malaria.

Full text

Page 1

Genome Biology 2009, 10:R21
Open Access
2009 Dharia et al.Volume 10, Issue 2, Article R21
Research
Use of high-density tiling microarrays to identify mutations globally
and elucidate mechanisms of drug resistance in Plasmodium
falciparum
Neekesh V Dharia*, Amar Bir Singh Sidhu†‡, María Belén Cassera§,
Scott J Westenberger*, Selina ER Bopp*, Rich T Eastman†, David Plouffe¶,
Serge Batalov¶, Daniel J Park¥, Sarah K Volkman#**, Dyann F Wirth¥#,
Yingyao Zhou¶, David A Fidock††† and Elizabeth A Winzeler*¶
Addresses: *Department of Cell Biology, ICND 202, The Scripps Research Institute, North Torrey Pines Road, La Jolla, CA 92037, USA.
†Department of Microbiology, Columbia University College of Physicians and Surgeons, West 186th Street, New York, NY 10032, USA. ‡The
Broad Institute of MIT and Harvard, Cambridge Center, Cambridge, MA 02142, USA. §Department of Biochemistry, Albert Einstein College of
Medicine at Yeshiva University, Morris Park Avenue, Bronx, NY 10461, USA. ¶Genomics Institute of the Novartis Research Foundation, John
Jay Hopkins Drive, San Diego, CA 92121, USA. ¥The Broad Institute of MIT and Harvard, Cambridge Center, Cambridge, MA 02142, USA.
#Department of Immunology and Infectious Diseases, Harvard School of Public Health, Huntington Avenue, Boston, MA 02115, USA. **School
for Health Studies, Simmons College, The Fenway, Boston, MA 02115, USA. ††Department of Medicine, Columbia University College of
Physicians and Surgeons, West 186th Street, New York, NY 10032, USA.
Correspondence: Elizabeth A Winzeler. Email: winzeler@scripps.edu
© 2009 Dharia et al.; licensee BioMed Central Ltd.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Malaria drug resistance <p>Using tiling microarrays, a mechanism by which Plasmodium falciparum parasites acquire resistance to the antimalarial fosmidomycin has been elucidated</p>
Abstract
Background: The identification of genetic changes that confer drug resistance or other phenotypic changes in
pathogens can help optimize treatment strategies, support the development of new therapeutic agents, and
provide information about the likely function of genes. Elucidating mechanisms of phenotypic drug resistance can
also assist in identifying the mode of action of uncharacterized but potent antimalarial compounds identified in
high-throughput chemical screening campaigns against Plasmodium falciparum.
Results: Here we show that tiling microarrays can detect de novo a large proportion of the genetic changes that
differentiate one genome from another. We show that we detect most single nucleotide polymorphisms or small
insertion deletion events and all known copy number variations that distinguish three laboratory isolates using
readily accessible methods. We used the approach to discover mutations that occur during the selection process
after transfection. We also elucidated a mechanism by which parasites acquire resistance to the antimalarial
fosmidomycin, which targets the parasite isoprenoid synthesis pathway. Our microarray-based approach allowed
us to attribute in vitro derived fosmidomycin resistance to a copy number variation event in the pfdxr gene, which
enables the parasite to overcome fosmidomycin-mediated inhibition of isoprenoid biosynthesis.
Conclusions: We show that newly emerged single nucleotide polymorphisms can readily be detected and that
malaria parasites can rapidly acquire gene amplifications in response to in vitro drug pressure. The ability to define
comprehensively genetic variability in P. falciparum with a single overnight hybridization creates new opportunities
to study parasite evolution and improve the treatment and control of malaria.
Published: 13 February 2009
Genome Biology 2009, 10:R21 (doi:10.1186/gb-2009-10-2-r21)
Received: 20 September 2008
Revised: 5 January 2009
Accepted: 13 February 2009
The electronic version of this article is the complete one and can be
found online at http://genomebiology.com/2009/10/2/R21

Page 2

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.2
Genome Biology 2009, 10:R21
Background
With many complete eukaryotic genomes and draft eukaryo-
tic sequencing projects deposited in the National Center for
Biotechnology Information database, attention is shifting to
discovering genomic diversity and associating this genetic
variation with defined phenotypes. This is of particular inter-
est with the human malarial parasite Plasmodium falci-
parum, whose extensive genetic variability and sexual
recombination facilitates the emergence and spread of drug
resistance [1,2], resulting in treatment failure for many of the
licensed antimalarial agents [3,4]. Identifying the genetic
changes that are involved in drug resistance or other pheno-
typic changes can help with the development of effective ther-
apies, improve understanding of parasite biology and gene
function, and assist in elucidating the mode of action of
uncharacterized chemical compounds that exhibit antimalar-
ial activity in high-throughput cellular screening campaigns
[5-7]. Traditional genetic methods have been used to discover
such genetic changes but with much difficulty, time, and cost
for the experimentally intractable P. falciparum.
Traditional forward genetic methods that have been used to
discover Plasmodium genes involved in drug resistance
include genetic crosses and analysis of linkage patterns of
sexual assortment that occur naturally during parasite trans-
mission from mammal to insect. For example, the primary
genetic determinant of chloroquine drug resistance in P. fal-
ciparum was identified through a costly genetic cross involv-
ing chimpanzees [8,9]. Allelic replacement experiments
confirmed that resistance was mediated by point mutations in
the chloroquine resistance transporter (pfcrt, MAL7P1.27)
[10]. Crosses can also be performed at a significantly reduced
cost using rodent malaria models, but the mechanism of drug
resistance in these systems may not extend to human malaria
[11]. In certain instances, linkage disequilibrium studies of
sensitive and resistant field isolates, using single nucleotide
polymorphisms (SNPs) reported by the recent sequencing
projects [12-14], can also uncover genetic determinants of
resistance. Indeed, recent analysis of such data has identified
selective sweeps associated with chloroquine and antifolate
drug resistance [12,15].
An alternative reverse genetic approach leverages knowledge
from other systems to predict the candidate genes that might
be involved in antimalarial drug resistance. For instance,
membrane transporters encoded by multidrug resistance
(mdr) genes can contribute to drug resistance in other organ-
isms. In the case of P. falciparum, amplification of the pfmdr1
gene (PFE1150w) leads to mefloquine resistance [16,17], and
point mutations in this gene modulate in vitro susceptibility
to multiple antimalarial agents [1,18,19]. SNPs in the dihy-
drofolate reductase-thymidylate synthase gene (pfdhfr-ts,
PFD0830w) confer resistance to antifolate drugs [1,18,20],
and a candidate gene approach has been used to successfully
correlate in vitro derived resistance to the macrolide azithro-
mycin with a point mutation in a ribosomal protein that is
part of the apicoplast translation machinery [21]. These can-
didate gene approaches, however, have limited predictive
value with drugs that are specific to malarial parasites and
have unknown modes of action.
Not withstanding some earlier successes with classical
genetic approaches, technological advances in genomics
research are beginning to afford unprecedented power in
genome-wide discovery of mutations, thus facilitating high-
throughput approaches for discovering genes that are
involved in drug resistance. Particularly in laboratory-
adapted isogenic isolates, genomic methods are making it
possible to differentiate between genetic changes associated
with resistance and random mutations. Genome re-sequenc-
ing has proven especially useful for SNP detection; however,
its primary limitation is in not being able to detect copy
number variations (CNVs), which are likely to be a common
response to drug pressure. Alternative microarray-based
approaches have been used to discover a novel amplification
event surrounding GTP cyclohydrolase I (pfgch1, PFL1155w)
that may be important for antifolate drug resistance [22,23].
Microarray approaches can rapidly identify variable genomic
regions and assess CNVs at relatively low cost, providing a
distinct advantage over conventional sequencing approaches.
Here we describe the production of a custom high-density til-
ing 25mer oligonucleotide microarray, based on the 3D7 ref-
erence isolate, and the development of analytical tools for the
genome-wide identification of mutations in laboratory and
clinical isolates of P. falciparum. This enabled us to identify
more than 90% of reported SNPs in Dd2 with respect to 3D7,
and the precise mapping of amplification events surrounding
pfmdr1 and pfgch1, all in a fast, single hybridization experi-
ment. We illustrate the utility of this approach by reporting
evidence of a molecular and biochemical basis of parasite
resistance to fosmidomycin: amplification of the gene encod-
ing the putative target P. falciparum 1-deoxy-D-xylulose 5-
phosphate reductoisomerase (pfdxr, PF14_0641) in parasite
lines selected for decreased fosmidomycin susceptibility in
vitro.
Results
Microarray design
One goal of this study was to determine whether we could use
hybridization methods to detect SNPs and CNVs globally in
the P. falciparum genome and to implement a robust and
user-friendly software package to analyze these data. We first
constructed a custom high-density microarray containing
over 4.8 million probes at 5 m feature size to the sequenced
3D7 isolate [24]. The microarray covers approximately 90%
of coding regions, which comprise 53% of the genome, and
60% of noncoding regions, and it is only limited by the high
AT content of the P. falciparum genome [24]. Unlike the
yeast tiling microarray [25], our microarray contains only
perfect match probes, and thus we were able to tile through

Page 3

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.3
Genome Biology 2009, 10:R21
the genome with overlapping probes of alternating stranded-
ness averaging 25 nucleotides in length with a base pair spac-
ing of two to three nucleotides. Thus, each nucleotide in the
coding genome could be probed from 9 to 13 times on the
microarray. This probe density allows for detection of poly-
morphisms within a distance of several nucleotides, and the
density is much greater than our previous P. falciparum
microarray that had 327,989 non-overlapping 25 mer oligo-
nucleotide probes spaced approximately every 50 base pairs
[22] or the microarray, also used for SNP and CNV detection,
designed at The Sanger Institute that has about 2.5 million
probes [26].
To validate our microarray-based approach, genomic DNA
preparations from the culture-adapted Dd2, HB3, and 3D7
parasite lines were labeled and hybridized to the microarray.
We used these lines as references because of the availability of
high-quality sequence data generated by traditional sequenc-
ing methods. Following hybridization, the arrays were
washed and scanned, and the microarray data normalized to
a baseline synthetic array using the nonlinear piece-wise run-
ning median line for invariant probes [27]. This synthetic
array was constructed by taking the mean for each probe
across all arrays for analysis. This method of normalization
was chosen over quantile normalization [27], a popular
method for gene expression analysis, because the reference
isolate and other isolates were expected to have different dis-
tributions of probe intensities as a consequence of their natu-
ral genetic variation.
Gene amplification and deletion events
We next sought to determine whether we could detect known
CNVs and deletions using our microarray-based approach, in
view of the key role that CNVs can play in the phenotypes of
diverse organisms, including malarial parasites. For this
analysis, we used only probes that mapped to only one loca-
tion in the 3D7 reference genome (87.7% of total probes). The
data were subject to two different analyses. First, we system-
atically detected gene deletion events using a match-only
integral distribution (MOID) algorithm [28], similar to one
previously used in our laboratory to detect CNVs with the pre-
vious generation of microarrays [22]. For this analysis, we
modeled the background hybridization by using Affymetrix
eukaryotic background control probes. This required at least
ten unique probes per gene, and thus we excluded 95 highly
variable subtelomeric genes (Additional data file 1). We con-
sidered one of two criteria to designate a gene as absent: the
probe hybridization results fell within the distribution of
background probes with a P value cutoff of 1 × 10-2; or the
gene had less than a 2.5-fold increase in intensity at the 70th
percentile with respect to background. Using the MOID algo-
rithm, we identified a total of 5,461 genes with ten or more
probes in 3D7 as present, indicating a low false-positive rate.
We also confirmed that a group of six subtelomeric cytoad-
herence genes on chromosome 2 were deleted in Dd2 com-
pared with 3D7, in accordance with the findings of a previous
report [22] (Additional data file 1).
Second, we detected amplification events by determining the
log2 ratio of unique probes in the isolate compared with the
reference isolate. Each chromosome was scanned with sliding
windows of 1,000 probes, and a z-test was performed on each
window to determine whether the probes had a log2 ratio
greater than zero. We were able to identify known amplifica-
tion events in Dd2 surrounding pfmdr1 on chromosome 5
and pfgch1 on chromosome 12 [22] using a z-value cutoff of
18, which was used as a cutoff for the analysis below (Addi-
tional data file 2). Quantitative PCR had earlier determined
that this isolate harbored 3-4 copies of pfmdr1 [29,30], and
quantitative RT-PCR of our freshly cloned Dd2 line indicated
the presence of three copies (data not shown). With our
method, we did not detect a threefold increase in intensity for
this region. Instead we saw a 1.6-fold intensity increase, with
a log2 ratio of approximately 0.7 (Figure 1). Hybridization-
based methods may not be linear with respect to copy number
detection because of probe or scanner signal saturation. Lin-
earity could possibly be achieved by shortening the hybridiza-
tion times or by performing titrations. However, it would
probably be more efficient to perform quantitative PCR than
to collect whole-genome data. The goal of our study was to
discover CNVs and not to extensively characterize them.
With a large number of probes to both coding and intergenic
regions, we predicted that our method would allow us to
delineate the breakpoints of amplification events with high
accuracy, when comparing isolate genomic hybridizations
with a reference isolate. To determine whether we could pre-
cisely detect the previously determined boundaries of ampli-
fication events, we scanned through the regions surrounding
the amplifications and performed a paired t-test comparing
the probe intensities on either side of each position on a chro-
mosome with the window size dependent on the size of the
amplification event. The position with the best t-statistic was
considered to be the breakpoint of the amplification event,
and reported ranges included positions with a t-statistic
greater than 90% of the peak.
PCR analysis of the pfmdr1 amplification event in Dd2 previ-
ously estimated the breakpoints to be 888,335 on the 5' end
and 970,240 on the 3' end [31]. Microarray-based mapping
localized the amplification breakpoints at approximately
888,543 (888,393 to 888,689) and 970,202 (969,734 to
970,348) with a 2 kilobase (kb) window size (Figure 1). This
amplification event could not be as precisely mapped because
the breakpoints occur in intergenic tracts of monomeric A or
T; nevertheless, we were still able to identify the region to
within a few hundred bases. Our method also identified the
GTP cyclohydrolase I amplification event in Dd2, which
included three genes, namely PFL1145w, PFL1150c, and
PFL1155w (pfgch1), confirming our initial report [22]. With
our high-density microarray, we detected the breakpoints of

Page 4

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.4
Genome Biology 2009, 10:R21
this amplification as 971,195 (971,185 to 971,218) and 976,476
(976,448 to 976,525) using a 500 base pair window size. In
HB3, the amplification event surrounding pfgch1 was much
larger, about 161 kb, with breakpoints at 942,424 (942,144 to
942,717) and 1,103,325 (1,103,153 to 1,103,624) when
scanned with a 4 kb window size. Our initial report indicated
this amplification event contained 39 genes (PFL1125w to
PFL1315w) [22], but our higher resolution microarray identi-
fied the breakpoints within the coding regions of PFL1125w
and PFL1315w, suggesting a full-length CNV for 37 of the 39
genes (Additional data files 1 and 2).
Polymorphism detection
In addition to gene amplification events, drug resistance may
also arise through the emergence of SNPs; thus, we next
tested whether the microarray could globally detect these pol-
ymorphisms (Figure 2). As with CNV detection, probes that
mapped to only one location in the 3D7 reference genome
were used for the analysis. A z-test was performed on the dif-
ference in log intensities of the reference and test isolate
hybridization with a sliding window of three overlapping
probes. If there was no difference in the genomic sequence
hybridizing to the probes, then the intensity differences
formed a normal distribution centered on a mean of zero. The
standard deviation of the normal distribution was empirically
determined by replicate hybridizations of rank-invariant
probes for the z-test. The appearance of SNPs between the
experimental genomic DNA and the reference isolate resulted
in intensities that were higher in the reference isolate. Based
on our empirical data, we classified probes with a P value of
less than 1 × 10-8 and a higher mean in the reference hybridi-
zations as ones containing polymorphisms in the isolate.
Combining the data from the sliding windows of three probes
enabled us to establish the boundaries within which the poly-
morphisms were contained. To predict the precise position of
SNPs, we used an empirically determined model of loss of
hybridization based on the SNP position in probes (Addi-
tional data file 3 [Figure S1]). An F-test was then performed
with the model, based on the null hypothesis of the mean
equaling zero, in order to position the polymorphism predic-
tion at the peak of the P value.
Our SNP prediction validation was performed by comparing
the 3D7 reference isolate to Dd2 and HB3, which have
recently been sequenced to greater than 8× coverage by the
Broad Institute [12]. In our analysis, we included high quality
SNPs (Phred score >25 for each SNP and more than 25 base
pairs from either end of an alignment or base pair call with
Phred score <20) that were present in four or more reads
(Dd2), and excluded SNPs in hypervariable subtelomeric
regions defined in recent re-sequencing efforts [12]. Because
the HB3 genome was assembled before SNP detection in the
work by Volkman and coworkers [12], we were unable to
examine individual HB3 sequence reads to determine cover-
age and quality values for SNPs and thus had a larger set of
SNPs about which we were less confident. Initial analyses
with the test set limited to SNPs that mapped to at least three
unique probes on the microarray provided coverage of 75.9%
for coding regions and 41.2% for noncoding regions, but
resulted in suboptimal detection rates (Additional data file 3
[Table S1]). Therefore, the test set was limited to SNPs that
mapped to six or more unique probes on the array, which
restricted our microarray coverage to 58.5% of coding regions
and 23.2% of noncoding regions. This produced a validation
set of 1,737 SNPs in Dd2 and 3,344 SNPs in HB3 (Additional
data file 3 [Table S2] and Additional data file 4).
From this set of high-quality SNPs we were able to identify
91.1% of SNPs (1,582 true positives, 155 false negatives) with
a false discovery rate of 10.5% (185 false positives) when com-
paring two hybridizations of Dd2 with two reference hybridi-
zations and using a P value cutoff of 1 × 10-8. Detection rate
Amplification event surrounding pfmdr1 on chromosome 5 in Dd2
Figure 1
Amplification event surrounding pfmdr1 on chromosome 5 in Dd2. The log2 ratio of the intensity of each unique probe in Dd2 was divided by the intensity
of each unique probe in 3D7 to generate the plot. The probe log ratios were colored by the moving average over a 500 base pair window as indicated in
the color bar. A normal distribution around zero was expected if the copy number was the same. The ends of chromosome 5 are highly polymorphic
subtelomeric regions and thus showed much lower probe intensity in Dd2 when compared with the reference 3D7. The amplification containing 14 genes
including pfmdr1 (marked with an asterisk) is enlarged in the inset. Mb, megabases.
0.2 Mb
0.4 Mb0.6 Mb
0.8 Mb
1.0 Mb
-6
-4
-2
0
2
4
6


0.84 Mb
0.9 Mb
0.96 Mb1.02 Mb
-4
-2
0
2
4

*
log2 (Dd2/3D7)
Base pair position along chromosome 5 (MAL5)
-2
0
2
log2 (Dd2/3D7)
-1
1
1.2 Mb

Page 5

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.5
Genome Biology 2009, 10:R21
was defined as the percentage of the SNP validation set that
was confirmed by microarray analysis; false discovery rate
was the percentage of SNPs detected by microarray that were
not polymorphic by Broad Institute sequencing [12]. For the
HB3 SNPs, we detected 85.0% of SNPs (2,842 true positives
and 502 false negatives) with a false discovery rate of 16.7%
(569 false positives) using the same P value cutoff. The lower
detection rate in HB3 may be due to the lack of sequence read
information and thus less confidence in SNP identification
from the original sequencing effort [12]. For Dd2 we also
obtained similar lower detection rates when including lower-
quality SNPs that had fewer than four reads. In Saccharomy-
ces cerevisiae, Gresham and coworkers identified 96.2% of
the published SNPs (944 out of 981) with a 95.9% false dis-
covery rate (22,082 false positives) [25]. With a more strin-
gent prediction signal cutoff, Gresham and coworkers [25]
were able to obtain an impressively low false discovery rate of
0.87% with 81.7% detection using the well characterized
model organism S. cerevisiae. In comparison, with a P value
cutoff of 1 × 10-5, we detected 93.9% of SNPs in Dd2 with a
57.6% false discovery rate. Although we were unable to
achieve false discovery rates of less than 1% because of the
incomplete sequencing of the isolates and the nonclonal
nature of parasite cultures, our SNP identification and false
discovery rates approach those of conventional sequencing -
the current gold standard (Tables 1 to 2 and Additional data
file 3 [Figure S2]).
To scrutinize our false discovery and false negative rates, we
used PCR amplification and subsequent sequencing of
selected predicted polymorphisms with low P values classi-
fied as 'false positives', as well as 'false negative' polymor-
phisms with high probe coverage that were missed by our
method. Any 'false positives' arising from indels present in
sequencing reports were manually filtered and excluded from
false discovery rates for Dd2 P-value cutoffs of 1 × 10-8 or 1 ×
10-10. Our results showed that 50% of the remaining high-
quality 'false positives' were actually polymorphisms that
SNPs in Dd2
Figure 2
SNPs in Dd2. (a) Plot of -log10 P values for z-test (blue line) performed with Dd2 versus the 3D7 reference; detected are all of the reported single
nucleotide polymorphisms (SNPs) in the pfcrt gene that were represented in the microarray (red triangles). Two SNPs were not detected (black triangles)
because of the lack of unique probes to these positions. The thin and thick black arrows correspond to SNPs indicated in panel b. The P-value cutoff was
1 × 10-8 (black line). (b) Visualization of probe intensity log ratios in Dd2 versus 3D7. Each probe is shown as a single pixel and is colored based on its log
ratio. Continuous strips of dimmer pixels correspond to SNPs that map to multiple unique probes, as indicated by the thin and thick white arrows. (c)
Probes were tiled through the genome with an offset of two to three base pairs of alternating strands. The position marked in red is the position of the
SNP marked by the thick arrows in panels a and b. The base pair positions on the left indicate the start of the probe with respect to the plus strand of
chromosome 5 and its orientation.
0
10
20
30
40
50
60
70
458 kb
459 kb
460 kb
461 kb
462 kb
-log10 (p)
Base pair position along chromosome 7 (MAL7)
pfcrt
-3
-2
-1
0
1
2
3
log2 (Dd2/3D7)
TTAAAATATCCCACTACAACATTCT
TTTTATAGGGTGATGTTGTAAGAGA
AATATCCCACTACAACATTCTCTTG
ATAGGGTGATGTTGTAAGAGAACCA
TCCCACTACAACATTCTCTTGGTTC
GGTGATGTTGTAAGAGAACCAAGAT
ACTACAACATTCTCTTGGTTCTAAT
ATGTTGTAAGAGAACCAAGATTATT
CAACATTCTCTTGGTTCTAATAATC
TGTAAGAGAACCAAGATTATTAGAT
ATTCTCTTGGTTCTAATAATCTAAA
AGAGAACCAAGATTATTAGATTTCG
461193 -
461195 +
461197 -
461199 +
461201 -
461203 +
461205 -
461207 +
461209 -
461211 +
461213 -
461215 +
(a)(b)
(c)

Page 6

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.6
Genome Biology 2009, 10:R21
were either different in the laboratory isolates that we ana-
lyzed or not detected by the re-sequencing project, similar to
the 64% error rate described by Jiang and coworkers [26].
This suggests that our actual false discovery rate is approxi-
mately 6%. We did not detect 8.9% of the reported SNPs with
good probe coverage in Dd2, and for all of these 'false nega-
tives' sequenced there indeed was a polymorphism that was
not detected by our arrays. More stringent P-value cutoffs
increased the false negative rate but improved the false dis-
covery rate. Additionally, the prediction of SNP location also
increased with more stringent P values and higher density
probe coverage. When the prediction signal contained more
than ten probes that included the SNP, we were able to local-
ize the position of the polymorphism prediction to within
seven base pairs in more than 95% of cases and to within ten
base pairs in more than 98% of cases. Even with weaker sig-
nals (four probes), we were able to localize approximately
95% of SNPs to within ten base pairs (Table 3).
Comparison with previous studies
Previous microarray-based studies of P. falciparum have
assessed genetic variability in the parasite [22,26,32] but
these microarrays were not designed with the probe density
and coverage to detect small changes in the genome that
result from in vitro evolution or drug resistance. For example,
the recent study by Jiang and coworkers [26] reports rates of
polymorphic probes for genes across various laboratory iso-
lates but fails to detect the hallmark mutation resulting in the
K76T mutation in pfcrt, presumably because of insufficient
probe coverage. The authors did not report individual poly-
morphisms identified in each of the laboratory isolates, and
thus it was not possible to compare our methods directly.
Another advantage of our current study is that the overlap-
ping nature of probes allowed us to use one or two microarray
replicate hybridizations to detect polymorphisms instead of
three to four hybridizations required in previous studies
[22,26].
Detection of mutations in an engineered parasite line
Classical genetic approaches are essential for elucidating gene
function, but the transfection process and the subsequent
drug selection are population bottlenecks. Emerging para-
sites may contain changes elsewhere in the genome that are
undetected by standard controls but contribute to phenotype.
To determine systematically additional mutations that arose
or were selected in an engineered parasite line, we hybridized
genomic DNA from 3D7attB to the microarray. The 3D7attB line
was generated from 3D7 by the insertion of an attB recombi-
nation site for Bxb1 integrase flanked by the human dhfr gene
as a selectable marker [33]. We detected a deletion of a subte-
lomeric region of chromosome 6 (1.38 to 1.41 megabases) and
a polymorphism in the histone 2B gene (PF11_0062; Figure
3a and Additional data file 4). Sequencing revealed two novel
point mutations resulting in a nonsynonymous mutation of
A100F in this highly conserved gene (Figure 3b), strengthen-
ing the importance of whole genomic screening for undetec-
ted mutations in engineered lines.
Selection and characterization of fosmidomycin
resistance
Malarial parasites, unlike mammals, employ a nonmeval-
onate based 2-C-methyl-D-erythritol-4-phosphate (MEP)
pathway for synthesis of essential isoprenoids such as ubiqui-
nones and dolichols [34]. 1-Deoxy-D-xylulose 5-phosphate
reductoisomerase (DXR), a key enzyme of the MEP pathway,
catalyzes the conversion of 1-deoxy-D-xylulose 5-phosphate
(DOXP) to MEP and is of particular therapeutic interest
because of its requirement for isoprenoid synthesis in P. fal-
Table 1
SNP prediction results: Dd2 SNP call rates
z-test P valueTrue positivesFalse positives Detection rate (%) False discovery rate (%)
1 × 10-5
1 × 10-8
1 × 10-10
1,635
1,582
1,532
2,193
185
39
93.9
91.1
88.0
57.3
10.5
2.48
SNP, single nucleotide polymorphism.
Table 2
Previously published SNP prediction results: yeast SNP call rates
Prediction signalTrue positivesFalse positives Detection rate (%)False discovery rate (%)
>0
>5
>5,347
944
801
760
22,082
7
0
96.2
81.7
77.5
95.9
0.87
0.00
Based on data from Gresham and coworkers [25]. SNP, single nucleotide polymorphism.

Page 7

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.7
Genome Biology 2009, 10:R21
ciparum as well as several pathogenic eubacteria including
Bacillus anthracis, Helicobacter pylori, Yersinia pestis, and
Mycobacterium tuberculosis [35]. Recent clinical studies
with the specific DXR inhibitor fosmidomycin have shown
that this agent is well tolerated in humans and can cure P. fal-
ciparum infection, either alone or more potently in combina-
tion with clindamycin or artesunate [36-38]. These trials have
yet to report resistance to fosmidomycin, including in areas
with a high prevalence of parasite resistance to several other
clinically used antimalarials.
To gain insight into how fosmidomycin resistance could
evolve in P. falciparum, Dd2 parasites were exposed to drug
in vitro and selected under stepwise increases in concentra-
tion. Two fosmidomycin-resistant clones, named FOS-RDd2-
CL1 and FOS-RDd2-CL2, were isolated from two separate flasks.
These were then subjected to 72-hour [3H]hypoxanthine
incorporation assays to determine the degree of resistance.
Fosmidomycin 50% inhibitory concentration (IC50) values for
FOS-RDd2-CL1 and FOS-RDd2-CL2 were 2,219 ± 136 and 2,623 ±
78 nmol/l, respectively, compared with an approximately
eightfold lower IC50 value of 307 ± 49 nmol/l for the parental
Dd2 line (Figure 4a). Fosmidomycin-resistant lines exhibited
no change in their IC50 value for chloroquine compared with
Dd2 (data not shown).
To confirm that fosmidomycin resistance was related to the
MEP pathway, infected erythrocytes were pretreated for 24
hours with fosmidomycin and the parasites released by
saponin treatment. Intact erythrocyte-free parasites were
then metabolically labeled with [2-14C]pyruvic acid in the
presence of fosmidomycin. As expected, the Dd2 parental line
showed DOXP accumulation while MEP synthesis was
reduced in a dose-dependent way in treated parasites (Figure
4b). In contrast, the synthesis of DOXP and MEP was unaf-
fected by drug in fosmidomycin-resistant parasites (Figure
4b). The fact that DOXP did not accumulate in a dose-
dependent manner in Dd2 could be due to negative feedback
regulation, as previously observed in P. falciparum [39,40].
As a control, the synthesis of adenosine metabolites through
the purine pathway was analyzed under the same treatment
conditions using [2-3H]adenosine as the metabolic precursor
(Additional data file 3 [Figure S3AB]). No significant differ-
ences in [2-3H]adenosine uptake were observed between
untreated and fosmidomycin-treated parasites both in Dd2
and FOS-RDd2-CL1. Similarly, no significant differences in par-
asite growth were observed during the 24-hour treatment
(Additional data file 3 [Figure S3C]). To test the stability of
the fosmidomycin-resistant phenotype, frozen stocks of the
FOS-RDd2-CL1 clone were thawed and parasites maintained in
the absence of drug pressure for 6 weeks. Fosmidomycin
assays with this parasite line yielded an IC50 value of 2,958 ±
101 nmol/l, which was comparable with in vitro selected
resistant lines maintained under drug (Figure 4a). These
studies demonstrate that fosmidomycin resistance can be
readily and stably acquired in vitro by selective pressure on
culture-adapted malarial parasites.
To investigate the genetic basis of this drug resistance, DNA
from these fosmidomycin-resistant mutants and the parental
Dd2 line were hybridized to the arrays. Unexpectedly, we
identified a single large amplification event in the genome, on
chromosome 14 of the fosmidomycin-resistant clones com-
Table 3
Accuracy of Dd2 SNP positioning
Signal probes0 bp (%) ± 2 bp (%) ± 5 bp (%)± 10 bp (%)
4 to 5
6 to 7
8 to 10
11 to 13
8.9
13.5
17.7
18.2
50.0
60.7
67.4
69.3
83.7
88.6
92.1
91.1
94.7
97.8
98.2
98.1
bp, base pairs; SNP, single nucleotide polymorphism.
Mutation in 3D7attB histone 2B
Figure 3
Mutation in 3D7attB histone 2B. (a) Plot of -log P-value for z-test (blue line) performed with 3D7attB versus the 3D7 reference detected a polymorphism in
the histone 2B gene with a P-value cutoff of 1 × 10-8 (black line). (b) Sequencing of the histone 2B gene in 3D7attB revealed two consecutive point
mutations resulting in a coding nonsynonymous mutation.
223.7 kb
Base pair position along chromosome 11 (MAL11)
223.8 kb223.9 kb224 kb
0
10
20
30
40
-log10 (p)
...TTACCAGGAGAATTAGCTAAACACGCAGTTTCT 223,996
... L P G E L A K H A V S 105
...TTACCAGGAGAATTATTTAAACACGCAGTTTCT...
... L P G E L F K H A V S ...
3D7
3D7attB
pfh2b
(a)(b)

Page 8

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.8
Genome Biology 2009, 10:R21
pared with Dd2. This CNV contained 23 genes (PF14_0641 to
PF14_0663) and was approximately 100 kb in size (Figure 4b
and Additional data file 2). The first gene in the amplification
event was identified as pfdxr, the putative target of fosmid-
omycin in Plasmodium, and the amplification event included
the entire upstream intergenic region for this gene. The log2
ratio of FOS-RDd2-CL1/Dd2 intensity for the region was
approximately 0.7, suggesting the presence of three copies of
this region. Quantitative RT-PCR demonstrated an approxi-
mately 3.8-fold increase in the pfdxr transcript level and a
approximately 2.7-fold increase in gene copy number in FOS-
RDd2-CL1 when compared with Dd2 (Figure 4d). These investi-
gations suggest that fosmidomycin pressure selected for par-
asites that had amplified the pfdxr gene. Finally, the entire
open reading frames of pfdxr and pfdxs (DOXP synthase,
MAL13P1.186), the most likely candidate resistant determi-
nants in the mevalonate-independent isoprenoid synthesis
pathway, were sequenced and analyzed for the presence of
mutations. No sequence changes were observed in compari-
son with the wild-type parasite line.
Development of software tools
We created a powerful MATLAB-based graphical user inter-
face that implements our methods to visualize SNPs, perform
SNP prediction, and visualize gene CNVs, allowing research-
ers to interpret the microarray data. This software is freely
Fosmidomycin resistance
Figure 4
Fosmidomycin resistance. (a) Fosmidomycin 50% inhibitory concentration (IC50) values (means and standard deviations) were calculated from
independent [3H]hypoxanthine assays in duplicate; the number of assays (n) is indicated in parenthesis. Drug susceptibility profiles of Dd2 (wild-type) (n =
7), FOS-RDd2-CL1 (n = 5), FOS-RDd2-CL2 (n = 3), and control FOS-RDd2-CL1-no drug (n = 3). Tests for significant differences between the parental and drug-
resistant isolates were performed using analysis of variance with Bonferroni posttests with  = 0.001; significant differences (P value < 0.001) are marked
with three asterisks (***). (b) Effect of fosmidomycin on 1-deoxy-D-xylulose 5-phosphate (DOXP) and 2-C-methyl-D-erythritol-4-phosphate (MEP)
biosynthesis in intact erythrocyte-free parasites exposed to fosmidoymicin for 24 hours and then labeled with [2-14C]pyruvic acid as a metabolic
precursor. Means and standard deviations were calculated from four independent experiments performed in duplicate. Differences between control (no
drug) Dd2 and fosmidomycin-treated Dd2 were significant by Student's t-test for DOXP (1 mol/l drug: P value 1 × 10-8; 2 mol/l drug: P value 1 × 10-6)
and MEP (1 mol/l drug: P value 4 × 10-6; 2 mol/l drug: P value 5 × 10-8) and are marked with three asterisks (***). (c) To generate the plot, the log2 ratio
of the intensity of each unique probe in FOS-RDd2-CL1 was divided by the intensity of each unique probe in Dd2. The probe log ratios were colored by the
moving average over a 500 base pair window as indicated in the color bar. The amplification was approximately 100 kb and contained 23 genes including
pfdxr (marked with an asterisk). (d) Quantitative RT-PCR analysis of pfdxr transcript level and quantitative PCR analysis gene copy number in FOS-RDd2-CL1
compared with Dd2. The means and standard deviations of two independent quantitative RT-PCR and quantitative PCR assays are represented.
Significance differences (P value < 0.001) in Ct values were determined by Wilcoxon rank sum test and are marked with three asterisks (***).
2.7Mb
Base pair position along chromosome 14 (MAL14)
2.75Mb 2.8Mb2.85Mb 2.9Mb
-4
-2
0
2
*
-2
0
2
-1
1
log2 (FOS-R / Dd2)
Dd2-Cl1
log2 (FOS-R / Dd2)
Dd2-Cl1
0
500
1000
1500
2000
2500
3000
3500
Fosmidomycin IC50 (nM)
Dd2
(wild-type)FOS-R
Dd2-Cl1
FOS-R
Dd2-Cl2
FOS-R
no drug
Dd2-Cl1
0
100
200
300
400
Percent (%) relative to control

DOXPMEPDOXPMEP
Control (no drug)
1 µM fosmidomycin
2 µM fosmidomycin
Dd2 (wild-type)
(d)
FOS-R
Dd2-Cl1
0
1
2
3
4
5
pfdxr copies relative to Dd2

transcript
(mRNA)
gene
(DNA)
Dd2 (wild-type)
FOS-RDd2-Cl1
***
***
***
***
***
(a)(b)
(c)

Page 9

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.9
Genome Biology 2009, 10:R21
available as a standalone application without restrictions for
Mac OS X and Windows platforms from our website [41].
Discussion
Recent studies suggest that CNVs of genes, involved in
diverse processes from cell cycle regulation to sexual differen-
tiation, may be a common strategy used by P. falciparum to
overcome environmental stresses and drug pressure
[22,31,42]. The amplification of GTP cyclohydrolase I, the
first enzyme of the folate biosynthesis pathway, is hypothe-
sized to shuttle more substrate into this pathway in the pres-
ence of various antifolate antimalarials and was missed in the
sequencing efforts [22]. This is not surprising because
sequencing the human genome missed a large number of
CNVs subsequently described by various microarray analyses
[43-46]. Compared with the microarrays used in all of these
studies, our method not only allows for more powerful statis-
tics with hundreds to thousands of unique probes for most
genes, but it also allows for accurate break point mapping
with probes to intergenic regions. We applied our method to
fosmidomycin-resistant parasites and identified an increase
in gene copy number of the putative target pfdxr as a plausi-
ble mechanism for in vitro derived resistance. This approach
can be extended to additional antimalarial compounds to
determine candidate mechanisms of resistance and poten-
tially identify drug targets when the mechanism of action is
unknown.
Although CNVs in pfmdr1 and pfgch1 have been reported, the
amplification of pfdxr is the first example of resistance due to
the amplification of the target enzyme of a drug in Plasmo-
dium. These amplification events may be common methods
for parasites to increase transcription of important genes in
light of recent studies confirming the inflexibility of the pro-
grammed asexual stage transcriptome to respond to drug
pressure [47] because parasites have evolved in a relatively
stable environment of the human host. Elucidating the mech-
anism of resistance to fosmidomycin is important in view of
its promising role in clinical combination therapies [36-38].
Although the volume of blood obtained with a finger stick
may not yield enough parasite DNA to do these experiments,
5 to 10 ml of leukocyte-depleted infected blood may yield
enough material for a successful hybridization. In additional,
clonal field isolates may be pushed into short-term culture for
characterization by microarray.
Our method allows for rapid and accurate detection of SNPs
in the parasite, as illustrated by our detection of known SNPs
in the established drug resistance genes dhfr-ts and pfcrt in
Dd2 (Figure 2a, b). This method achieved greater than 90%
SNP detection with low false positive rates of about 10%, sim-
ilar to those reported by re-sequencing efforts [12]. Polymor-
phisms identified by microarray improve the confidence of
SNPs identified by sequencing, and perhaps these two meth-
ods can be implemented in a complementary way for large-
scale detection of genetic variation. The existence of up to 13
probes covering a single base pair location provided the
equivalent of multiple-fold coverage that sequencing can pro-
vide. Insertions and deletions (indels) are common mutations
that we also wished to evaluate by microarray. Unfortunately,
indels were not systematically reported by re-sequencing
efforts, and thus we were unable to determine the accuracy of
indel identification by microarrays compared with sequenc-
ing. However, we did find that many 'false positives' were
actually insertions or deletions present in the sequencing
reports, suggesting that our method can also accurately detect
indels. We also identified nonsynonymous point mutations in
the engineered parasite line 3D7attB, illustrating the utility of
our microarray for discovering undetected and unexpected
genetic changes that may arise or be selected during genetic
manipulation and subsequent selection of parasites.
Traditional sequencing methods, like those used to sequence
all P. falciparum isolates to date, are considered to be the gold
standard. Yet their consensus accuracies of 99.99% would
still result in thousands of potential errors. Furthermore,
shotgun sequencing methods
Escherichia coli with parasite DNA, which can be difficult
with P. falciparum because of its extremely high AT content.
PCR amplification steps may also bias the results, and tradi-
tional sequencing methods have missed CNVs that are an
important mechanism for drug resistance in P. falciparum
and other species, including humans [43-45]. Next genera-
tion sequencing technologies are quickly becoming more
affordable and are beginning to be used to assess genetic var-
iability in a number of organisms with SNP detection rates
that are comparable [48-50] to those of our microarray-based
method. However, these methods also have their caveats.
With a highly repetitive AT-rich genome like P. falciparum,
masking or filtering steps may limit the detection of polymor-
phisms in many intergenic regions and coding regions. Our
hybridization-based method achieves detection rates similar
to those of sequencing and is much faster, requiring a single
overnight experiment followed by rapid computational anal-
ysis with results presented in a form readily accessible to
researchers.
involve transforming
Conclusions
Our whole-genome approach will prove particularly helpful
when elucidating mechanisms of drug resistance in vitro or in
clinical isolates of P. falciparum, as demonstrated by the
identification of pfdxr amplification in fosmidomycin resist-
ance. This method can also be applied to screening popula-
tions of P. falciparum and tracking the spread of drug
resistance, to discover the genetic basis of other phenotypic
changes, and to address more fundamental questions in P.
falciparum biology, such as the basal rates of point mutations
and CNVs in laboratory culture. By probing genetic variability
in P. falciparum with a single hybridization in a single over-
night experiment, this tiled microarray methodology will

Page 10

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.10
Genome Biology 2009, 10:R21
allow researchers using the accompanying software to quickly
and accurately ascribe phenotypic variations to changes at the
gene level. This will facilitate a deeper understanding of how
the parasite is evolving worldwide both in field and labora-
tory-adapted field isolates, supporting the new drive to
reduce the burden of malaria more effectively.
Materials and methods
DNA methods
Cultured isolates of 3D7 (MRA-151), Dd2 (MRA-156), HB3
(MRA-155), and 3D7attB (MRA-845) were obtained from the
Malaria Research and Reference Reagent Resource Center
(MR4; American Type Culture Collection, Manassas, VA,
USA). P. falciparum parasite lines were propagated in human
erythrocytes as previously described [33,51]; Dd2 was freshly
cloned from the MR4 isolate. Genomic DNA was isolated by
standard phenol-chloroform extraction. Fifteen micrograms
of genomic DNA from each isolate and 10 ng each of Bio B, Bio
C, Bio D, and Cre Affymetrix control plasmids (Affymetrix
Inc., Santa Clara, CA, USA) were fragmented with DNaseI
and end-labeled with biotin [52]. The samples were hybrid-
ized to the microarrays overnight at 45°C in Affymetrix buff-
ers, washed, and scanned [22].
Background subtraction and microarray normalization
Background subtraction was performed for each array using
Affymetrix eukaryotic background control probes. Because of
the varying background hybridization of probes based on
their GC content, the background probes were split into bins
based on GC content, and the mean for each bin was calcu-
lated. The appropriate background value, based on GC con-
tent, was subtracted from probes used for the analyses. As
described above, the arrays were normalized to a synthetic
baseline array constructed by taking the means across all
probes for all arrays used in the experiment. The probe inten-
sities were log transformed and placed into 100 equally sized
and spaced bins. After removing outliers, the median for each
bin was set to the median of the corresponding bin in the syn-
thetic baseline microarray.
Probe selection
The microarray contains probes to the P. falciparum 3D7
nuclear, mitochondrial, and apicoplast genomes, as well as
isolate-specific probes for HB3 and Dd2, P. knowlesi specific
probes, and eukaryotic control probes (standard Affymetrix
and Arabidopsis thaliana). Unique probe mapping was
determined by blasting P. falciparum probe sequences
against the reference genome (PlasmoDB version 5.3) and
determining the number of perfect matches. We excluded
from our analysis any probes that had more than one perfect
match.
Nucleotide sequencing
Primers were designed to amplify 400 to 500 base pairs of
Dd2 genomic DNA with the false positive or false negative
position near the center. Independent PCR products were
sequenced by ABI sequencing (Applied Biosystems Inc., Fos-
ter City, CA, USA).
In vitro selection of fosmidomycin-resistant parasites
and antimalarial drug assays
The P. falciparum Dd2 line (a mefloquine-resistant deriva-
tive of W2 originally from Indochina) was used for the selec-
tion of fosmidomycin resistance. For the drug selection
experiment, approximately 2 × 1010 mixed stage parasites
were exposed to 100 nmol/l of fosmidomycin for 5 days. Cul-
tures were maintained carefully by smearing every day and
feeding twice daily with drug-containing RPMI media. After
initial drug treatment, fosmidomycin drug concentration was
increased to 400 nmol/l and kept at this level for the follow-
ing 7 days. At this drug concentration, dying asexual-stage
parasites were observed by microscopic examination of
Giemsa-stained smears. The fosmidomycin drug selection
level was then increased to 700 nmol/l, which eliminated
asexual stage parasites from detection by microscopy, and
cultures were further maintained at this drug level through-
out the experiment. Reappearance of healthy asexual stage
parasites growing in the presence of drug were observed
approximately 6 weeks after the start of the selection experi-
ment. Once parasitemia reached 2% to 3%, frozen stocks of
fosmidomycin-resistant parasites were prepared using Glyc-
erolyte 57 (Baxter Healthcare, Deerfield, IL, USA). During the
entire selection process 30% to 40% red blood cells were
replaced with freshly washed cells once a week. Drug selected
parasites were cloned by limiting dilution in 96-well tissue
culture plates in the presence of 700 nmol/l of fosmidomycin,
with an inoculum of 0.5 infected red blood cells per well. Par-
asite clones were detected after 3 weeks of growth using the P.
falciparum lactate dehydrogenase-specific Malstat assay
[53].
Parasites were phenotypically characterized for their drug
susceptibility profiles using [3H]hypoxanthine incorporation
assays, as described previously [54]. The response to fosmid-
omycin and chloroquine was measured in vitro in 96-well
plates using 72-hour [3H]hypoxanthine assays, starting with
an initial parasitemia of 0.4% to 0.5%. IC50 values were calcu-
lated using linear regression [54,55].
Metabolite profiling
One cycle after sorbitol synchronization, predominantly ring-
stage cultures at about 10% parasitemia were treated for 24
hours with 1 mol/l or 2 mol/l fosmidomycin. Untreated
cultures were incubated in parallel. After treatment, parasites
were isolated from their host erythrocytes by incubating with
20 pellet volumes of 0.015% saponin in phosphate-buffered
saline (PBS), and then washed three times with PBS at room
temperature. Parasitemia and parasite morphology were
determined by microscopic analysis of Giemsa-stained blood
smears immediately before and after saponin treatment.
Untreated or treated intact erythrocyte-free parasites were

Page 11

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.11
Genome Biology 2009, 10:R21
resuspended in RPMI 1640 medium and labeled for 1 hour
with 14 mol/l [2-14C]pyruvic acid (10 to 40 mCi/mmol; Per-
kin Elmer, Waltham, MA, USA) or 1 mol/l [2-3H]adenosine
(23 Ci/mmol; Amersham Biosciences, Piscataway, NJ, USA)
in the absence (controls) or presence of fosmidomycin. After
incubation, parasites were centrifuged and washed twice with
ice-cold PBS. Parasites were immediately extracted with eth-
anol/water (1:1 vol/vol; 1 × 0.3 ml at 55°C for 1.5 hours) [39]
for subsequent high-performance liquid chromatography
(HPLC) analysis of DOXP and MEP metabolites. Purine
metabolites were extracted by perchloric acid treatment.
Briefly, samples were mixed 1:6 (vol/vol) with 0.5 mol/l
HClO4, vigorously mixed, and incubated for 20 minutes at
4°C. Samples were centrifuged and supernatants were neu-
tralized with 5 mol/l KOH for 20 minutes at 4°C. All extracts
were filtered through YM-10 Centricon columns (MW reten-
tion = 10000; Amicon, Millipore, Billerica, MA, USA). Analy-
ses of metabolites were accomplished by using 2 × 108
parasites.
At the beginning of treatment, 1 ml culture from each condi-
tion was used in [3H]hypoxanthine incorporation assays to
test growth inhibition. After 12 hours of treatment,
[3H]hypoxanthine was added at a final concentration of 5
Ci/ml. After an additional 12 hours of incubation, cells were
harvested according to the method described by Desjardins
and colleagues [54].
DOXP and MEP intermediates were analyzed by HPLC as
described previously [39]. Briefly, the ethanol/water frac-
tions were analyzed using a reverse-phase column (Luna
C18[2], 150 × 4.6 mm, 3 m; Phenomenex, Torrance, CA,
USA). The eluants were 20 mmol/l N, N-dimethylhexylamine
in 10% methanol with the pH adjusted to 7.0 with formic acid
(solution A) and 50% methanol containing 2 mmol/l N, N-
dimethylhexylamine, pH 7.0 (solution B). The HPLC gradient
was 10% to 50% methanol in 50 minutes. The eluant was
monitored at 270 nm at a flow rate of 0.75 ml/minute. The
adenosine metabolites inosine, hypoxanthine and inosine
monophosphate were analyzed in a reverse-phase (Luna
C18[2], 150 × 4.6 mm, 3 m; Phenomenex, Torrance, CA,
USA) ion-pair HPLC system. The mobile phases were 8
mmol/l tetrabutylammonium bisulfate (Fluka, Sigma
Aldrich, St. Louis, MO, USA) and 100 mmol/l KH2PO4 with
the pH adjusted to 6.0 with KOH (solution A), and 30% ace-
tonitrile containing 8 mmol/l tetrabutylammonium bisulfate
and 100 mmol/l KH2PO4 (pH 6) as solution B. The HPLC gra-
dient was from 0% to 100% solution B in 20 minutes. The elu-
ant was monitored at 254 nm and the flow rate was 1 ml/
minute. Aliquots from both HPLC systems were collected
based on UV detection of internal standards and subjected to
liquid scintillation counting. For the comparison of the influ-
ence of fosmidomycin treatment on the biosynthesis of the
different metabolites, the same numbers of treated or
untreated parasites were analyzed.
Quantification of pfdxr copy number and transcript
levels
Real-time PCR and real-time RT-PCR methods were
employed to quantify pfdxr gene copy number and transcript
levels respectively in fosmidomycin-resistant and parental
lines. Genomic DNA extractions were performed using Qia-
gen DNeasy kits (Qiagen, Hilden, Germany), and RNA sam-
ples were prepared from the trophozoite-stage synchronized
parasites using Trizol (Invitrogen, Carlsbad, CA, USA).
DNase-treated RNA was reverse transcribed using the Super-
Script® III First-Strand Synthesis System (Invitrogen,
Carlsbad, CA, USA). Genomic DNA and cDNA templates (at
concentrations 1, 0.5, 0.25, 0.125, 0.625, 0.0312, and 0.01562
ng) were PCR amplified using the QuantiTect SYBR Green
PCR Kit (Qiagen, Hilden, Germany) with pfdxr-specific prim-
ers (forward: 5'-TCAAGAACTTGCGATATTATAGAGG;
reverse: 5'-TTGGCTCAGGTTTCAACTCTTACAT) or actin-
specific primers (forward: 5'-AGCAGCAGGAATCCACACA;
reverse: 5'-TGATGGTGCAAGGGTTGTAA).
method was employed to assess the copy number and tran-
script level (Applied Biosystems Inc., Foster City, CA, USA).
The 2-Ct
Database version
All gene information and base pair positions were taken from
PlasmoDB version 5.3 [56].
Microarrays and probe definition files
The microarray probe definition file, raw microarray data
(CEL files), and result files from our analysis are available for
download from our website [41]. Microarrays can only be cus-
tom ordered in bulk quantities, and thus upon request, the
authors will coordinate groups wishing to obtain microarrays
and have authorized Affymetrix to sell the microarrays to any-
one who wishes to buy them.
Abbreviations
CNV: copy number variation; DOXP: 1-deoxy-D-xylulose 5-
phosphate; DXR: 1-deoxy-D-xylulose 5-phosphate reductoi-
somerase; HPLC: high-performance liquid chromatography;
IC50: 50% inhibitory concentration; kb: kilobase; MEP: 2-C-
methyl-D-erythritol-4-phosphate; MOID: match-only inte-
gral distribution; MR4: Malaria Research and Reference Rea-
gent Resource Center; PBS: phosphate-buffered saline; RT-
PCR: reverse transcription polymerase chain reaction; SNP:
single nucleotide polymorphism.
Authors' contributions
NVD, ABSS, MBC, DAF, and EAW conceived and designed
the experiments. NVD, ABSS, MBC, SJW, SERB, RTE, and
DP performed the experiments. SB and EAW designed the
microarray. NVD developed analysis methods and analyzed
the microarray data. SJW, DJP, SKV, DFW, and YZ contrib-
uted materials, data, and ideas. NVD, ABSS, MBC, DAF, and

Page 12

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.12
Genome Biology 2009, 10:R21
EAW wrote the paper. SJW, SERB, RTE, DJP, and SKV
revised drafts of the paper.
Additional data files
The following additional data are included with the online
version of this article: a table listing MOID gene present calls
and average log2 ratios for Dd2, HB3, 3D7attB, and FOS-RDd2-
CL1 (Additional file 1); a table listing CNVs predicted by our
algorithm in Dd2, HB3, 3D7attB, and FOS-RDd2-CL1 (Additional
data file 2); supplementary tables S1 and S2, and figures S1 to
S3 (Additional data file 3); and a table listing polymorphisms
predicted by our algorithm in Dd2, HB3, 3D7attB, and FOR-
RDd2-CL1 (Additional data file 4).
Additional data file 1MOID gene present calls and average log2 ratiosPresented is a table listing MOID gene present calls and average log2 ratios for Dd2, HB3, 3D7attB and FOS-RDd2-CL1
Click here for file Additional data file 2Predicted CNVsPresented is a table listing CNVs predicted by our algorithm in Dd2, HB3, 3D7attB and FOS-RDd2-CL1. Click here for file Additional data file 3 Supplementary tables and figuresTable S1 contains SNP prediction results for Dd2. Table S2 contains SNP test set filtering information. Figure S1 is the probe behavior based on SNP position. Figure S2 is a genome-wide view of poly-morphisms detected by microarray and sequencing in Dd2 relative to 3D7. Figure S3 contains control experiments for fosmidomycin resistance metabolite profiling.Click here for file Additional data file 4 Predicted polymorphismsPresented is a table listing polymorphisms predicted by our algo- rithm in Dd2, HB3, 3D7attB, and FOR-RDd2-Cl1. Click here for file
Acknowledgements
We thank V Bounkeua for helpful discussions and careful reading of the
manuscript and C Kidgell for genomic DNA hybridization samples. This
work was supported by grants to EAW from the US National Institutes of
Health (AI059472) and the WM Keck Foundation, and a grant to DF from
the US National Institutes of Health (AI060342; PI Jim Sacchettini). Drug
discovery research at the Genomics Institute of the Novartis Research
Foundation is supported by funds from the Wellcome Trust and Medicines
for Malaria Venture.
References
1.Ekland EH, Fidock DA: Advances in understanding the genetic
basis of antimalarial drug resistance. Curr Opin Microbiol 2007,
10:363-370.
2. Ringwald P: Susceptibility of Plasmodium falciparum to antimalarial drugs:
Report on global monitoring: 1996-2004 Geneva, Switzerland: World
Health Organization; 2005.
3. Richie TL: High road, low road? Choices and challenges on the
pathway to a malaria vaccine. Parasitology 2006, 133:S113-S144.
4. Thera MA, Doumbo OK, Coulibaly D, Diallo DA, Kone AK, Guindo
AB, Traore K, Dicko A, Sagara I, Sissoko MS, Baby M, Sissoko M,
Diarra I, Niangaly A, Dolo A, Daou M, Diawara SI, Heppner DG,
Stewart VA, Angov E, Bergmann-Leitner ES, Lanar DE, Dutta S, Sois-
son L, Diggs CL, Leach A, Owusu A, Dubois M-C, Cohen J, Nixon JN,
et al.: Safety and immunogenicity of an AMA-1 malaria vac-
cine in Malian adults: results of a phase 1 randomized con-
trolled trial. PLoS ONE 2008, 3:e1465.
5.Weisman JL, Liou AP, Shelat AA, Cohen FE, Kiplin Guy R, DeRisi JL:
Searching for new antimalarial therapeutics amongst known
drugs. Chem Biol Drug Des 2006, 67:409-416.
6. Chong CR, Chen X, Shi L, Liu JO, Sullivan DJ: A clinical drug library
screen identifies astemizole as an antimalarial agent. Nat
Chem Biol 2006, 2:415-416.
7.Plouffe D, Brinker A, McNamara C, Henson K, Kato N, Kuhen K,
Nagle A, Adrian F, Matzen JT, Anderson P, Nam T-g, Gray NS, Chat-
terjee A, Janes J, Yan SF, Trager R, Caldwell JS, Schultz PG, Zhou Y,
Winzeler EA: In silico activity profiling reveals the mechanism
of action of antimalarials discovered in a high-throughput
screen. Proc Natl Acad Sci USA 2008, 105:9059-9064.
8. Wellems TE, Panton LJ, Gluzman IY, do Rosario VE, Gwadz RW,
Walker-Jonah A, Krogstad DJ: Chloroquine resistance not linked
to mdr-like genes in a Plasmodium falciparum cross. Nature
1990, 345:253-255.
9.Fidock DA, Nomura T, Talley AK, Cooper RA, Dzekunov SM, Ferdig
MT, Ursos LMB, bir Singh Sidhu A, Naudé B, Deitsch KW, Su X-z,
Wootton JC, Roepe PD, Wellems TE: Mutations in the P. falci-
parum digestive vacuole transmembrane protein PfCRT and
evidence for their role in chloroquine resistance. Mol Cell
2000, 6:861-871.
10.Sidhu ABS, Verdier-Pinard D, Fidock DA: Chloroquine resistance
in Plasmodium falciparum malaria parasites conferred by pfcrt
mutations. Science 2002, 298:210-213.
11.Hunt P, Afonso A, Creasey A, Culleton R, Sidhu ABS, Logan J, Valder-
ramos SG, McNae I, Cheesman S, Rosario Vd, Carter R, Fidock DA,
Cravo P: Gene encoding a deubiquitinating enzyme is
mutated in artesunate- and chloroquine-resistant rodent
malaria parasites&sect. Mol Microbiol 2007, 65:27-40.
Volkman SK, Sabeti PC, DeCaprio D, Neafsey DE, Schaffner SF, Mil-
ner DA, Daily JP, Sarr O, Ndiaye D, Ndir O, Mboup S, Duraisingh MT,
Lukens A, Derr A, Stange-Thomann N, Waggoner S, Onofrio R, Ziau-
gra L, Mauceli E, Gnerre S, Jaffe DB, Zainoun J, Wiegand RC, Birren
BW, Hartl DL, Galagan JE, Lander ES, Wirth DF: A genome-wide
map of diversity in Plasmodium falciparum. Nat Genet 2007,
39:113-119.
Jeffares DC, Pain A, Berry A, Cox AV, Stalker J, Ingle CE, Thomas A,
Quail MA, Siebenthall K, Uhlemann A-C, Kyes S, Krishna S, Newbold
C, Dermitzakis ET, Berriman M: Genome variation and evolution
of the malaria parasite Plasmodium falciparum. Nat Genet 2007,
39:120-125.
Mu J, Awadalla P, Duan J, McGee KM, Keebler J, Seydel K, McVean
GAT, Su X-z: Genome-wide variation and identification of vac-
cine targets in the Plasmodium falciparum genome. Nat Genet
2007, 39:126-130.
Wootton JC, Feng X, Ferdig MT, Cooper RA, Mu J, Baruch DI, Magill
AJ, Su X-z: Genetic diversity and chloroquine selective sweeps
in Plasmodium falciparum. Nature 2002, 418:320-323.
Price RN, Uhlemann A-C, Brockman A, McGready R, Ashley E,
Phaipun L, Patel R, Laing K, Looareesuwan S, White NJ, Nosten F,
Krishna S: Mefloquine resistance in Plasmodium falciparum and
increased pfmdr1 gene copy number. Lancet 2004, 364:438-447.
Sidhu ABS, Uhlemann A-C, Valderramos SG, Valderramos J-C,
Krishna S, Fidock DA: Decreasing pfmdr1 copy number in Plas-
modium falciparum malaria heightens susceptibility to meflo-
quine, lumefantrine, halofantrine, quinine, and artemisinin. J
Infect Dis 2006, 194:528-535.
Jiang H, Joy D, Furuya T, Su Xz: Current understanding of the
molecular basis of chloroquine-resistance in Plasmodium fal-
ciparum. J Postgrad Med 2006, 52:271-276.
Reed MB, Saliba KJ, Caruana SR, Kirk K, Cowman AF: Pgh1 modu-
lates sensitivity and resistance to multiple antimalarials in
Plasmodium falciparum. Nature 2000, 403:906-909.
Gregson A, Plowe CV: Mechanisms of resistance of malaria
parasites to antifolates. Pharmacol Rev 2005, 57:117-145.
Sidhu ABS, Sun Q, Nkrumah LJ, Dunne MW, Sacchettini JC, Fidock
DA: In vitro efficacy, resistance selection, and structural mod-
eling studies implicate the malarial parasite apicoplast as the
target of azithromycin. J Biol Chem 2007, 282:2494-2504.
Kidgell C, Volkman SK, Daily J, Borevitz JO, Plouffe D, Zhou Y, John-
son JR, Le Roch KG, Sarr O, Ndir O, Mboup S, Batalov S, Wirth DF,
Winzeler EA: A systematic map of genetic variation in Plasmo-
dium falciparum. PLoS Pathog 2006, 2:e57.
Nair S, Miller B, Barends M, Jaidee A, Patel J, Mayxay M, Newton P,
Nosten Fo, Ferdig MT, Anderson TJC: Adaptive copy number
evolution in malaria parasites. PLoS Genetics 2008, 4:e1000243.
Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carl-
ton JM, Pain A, Nelson KE, Bowman S, Paulsen IT, James K, Eisen JA,
Rutherford K, Salzberg SL, Craig A, Kyes S, Chan M-S, Nene V, Shal-
lom SJ, Suh B, Peterson J, Angiuoli S, Pertea M, Allen J, Selengut J, Haft
D, Mather MW, Vaidya AB, Martin DMA, et al.: Genome sequence
of the human malaria parasite Plasmodium falciparum. Nature
2002, 419:498-511.
Gresham D, Ruderfer DM, Pratt SC, Schacherer J, Dunham MJ, Bot-
stein D, Kruglyak L: Genome-wide detection of polymorphisms
at nucleotide resolution with a single DNA microarray. Sci-
ence 2006, 311:1932-1936.
Jiang H, Yi M, Mu J, Zhang L, Ivens A, Klimczak L, Huyen Y, Stephens
R, Su X-z: Detection of genome-wide polymorphisms in the
AT-rich Plasmodium falciparum genome using a high-density
microarray. BMC Genomics 2008, 9:398.
Bolstad BM, Irizarry RA, Astrand M, Speed TP: A comparison of
normalization methods for high density oligonucleotide
array data based on variance and bias. Bioinformatics 2003,
19:185-193.
Zhou Y, Abagyan R: Match-only integral distribution (MOID)
algorithm for high-density oligonucleotide array analysis.
BMC Bioinformatics 2002, 3:3.
Cowman AF, Galatis D, Thompson JK: Selection for mefloquine
resistance in Plasmodium falciparum is linked to amplification
of the pfmdr1 gene and cross-resistance to halofantrine and
quinine. Proc Natl Acad Sci USA 1994, 91:1143-1147.
Ferreira ID, Rosário VE, Cravo PV: Real-time quantitative PCR
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.

Page 13

http://genomebiology.com/2009/10/2/R21
Genome Biology 2009, Volume 10, Issue 2, Article R21 Dharia et al. R21.13
Genome Biology 2009, 10:R21
with SYBR Green I detection for estimating copy numbers of
nine drug resistance candidate genes in Plasmodium falci-
parum. Malar J 2006, 5:1.
Nair S, Nash D, Sudimack D, Jaidee A, Barends M, Uhlemann A-C,
Krishna S, Nosten F, Anderson TJC: Recurrent gene amplifica-
tion and soft selective sweeps during evolution of multidrug
resistance in malaria parasites. Mol Biol Evol 2007, 24:562-573.
Carret CK, Horrocks P, Konfortov B, Winzeler E, Qureshi M, New-
bold C, Ivens A: Microarray-based comparative genomic anal-
yses of the human malaria parasite Plasmodium falciparum
using Affymetrix arrays. Mol Biochem Parasitol 2005, 144:177-186.
Nkrumah LJ, Muhle RA, Moura PA, Ghosh P, Hatfull GF, Jacobs WR
Jr, Fidock DA: Efficient site-specific integration in Plasmodium
falciparum chromosomes mediated by mycobacteriophage
Bxb1 integrase. Nat Methods 2006, 3:615-621.
Jomaa H, Wiesner J, Sanderbrand S, Altincicek B, Weidemeyer C,
Hintz M, uuml , rbachova I, Eberl M, Zeidler J, Lichtenthaler HK, Sol-
dati D, Beck E: Inhibitors of the nonmevalonate pathway of iso-
prenoid biosynthesis as antimalarial drugs. Science 1999,
285:1573-1576.
Rohmer M: The discovery of a mevalonate-independent path-
way for isoprenoid biosynthesis in bacteria, algae and higher
plants. Nat Prod Rep 1999, 16:565-574.
Borrmann S, Adegnika A, Matsiegui P-B, Issifou S, Schindler A, Mawili-
Mboumba D, Baranek T, Wiesner J, Jomaa H, Kremsner P: Fosmid-
omycin-clindamycin for Plasmodium falciparum infections in
African children. J Infect Dis 2004, 189:901-908.
Borrmann S, Issifou S, Esser G, Adegnika A, Ramharter M, Matsiegui
P-B, Oyakhirome S, Mawili-Mboumba D, Missinou M, Kun JJ, Jomaa H,
Kremsner P: Fosmidomycin-clindamycin for the treatment of
Plasmodium falciparum malaria. J Infect Dis 2004, 190:1534-1540.
Borrmann S, Adegnika AA, Moussavou F, Oyakhirome S, Esser G,
Matsiegui P-B, Ramharter M, Lundgren I, Kombila M, Issifou S, Hutch-
inson D, Wiesner J, Jomaa H, Kremsner PG: Short-course regi-
mens of artesunate-fosmidomycin
uncomplicated Plasmodium falciparum malaria. Antimicrob
Agents Chemother 2005, 49:3749-3754.
Cassera MB, Gozzo FC, D'Alexandri FL, Merino EF, del Portillo HA,
Peres VJ, Almeida IC, Eberlin MN, Wunderlich G, Wiesner J, Jomaa
H, Kimura EA, Katzin AM: The methylerythritol phosphate
pathway is functionally active in all intraerythrocytic stages
of Plasmodium falciparum. J Biol Chem 2004, 279:51749-51759.
Cassera MB, Merino EF, Peres VJ, Kimura EA, Wunderlich G, Katzin
AM: Effect of fosmidomycin on metabolic and transcript pro-
files of the methylerythritol phosphate pathway in Plasmo-
dium falciparum. Mem Inst Oswaldo Cruz 2007, 102:377-384.
Winzeler Lab Website [http://www.scripps.edu/cb/winzeler/soft
ware]
Ribacke U, Mok BW, Wirta V, Normark J, Lundeberg J, Kironde F,
Egwang TG, Nilsson P, Wahlgren M: Genome wide gene amplifi-
cations and deletions in Plasmodium falciparum. Mol Biochem
Parasitol 2007, 155:33-44.
Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y,
Scherer SW, Lee C: Detection of large-scale variation in the
human genome. Nat Genet 2004, 36:949-951.
Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Maner S,
Massa H, Walker M, Chi M, Navin N, Lucito R, Healy J, Hicks J, Ye K,
Reiner A, Gilliam TC, Trask B, Patterson N, Zetterberg A, Wigler M:
Large-scale copy number polymorphism in the human
genome. Science 2004, 305:525-528.
Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fie-
gler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Free-
man JL, Gonzalez JR, Gratacos M, Huang J, Kalaitzopoulos D, Komura
D, MacDonald JR, Marshall CR, Mei R, Montgomery L, Nishimura K,
Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, Woodwark
C, Yang F, et al.: Global variation in copy number in the human
genome. Nature 2006, 444:444-454.
Sebat J: Major changes in our DNA lead to major changes in
our thinking. Nat Genet 2007, 39:S3-S5.
Ganesan K, Ponmee N, Jiang L, Fowble JW, White J, Kamchonwong-
paisan S, Yuthavong Y, Wilairat P, Rathod PK: A genetically hard-
wired metabolic transcriptome in Plasmodium falciparum
fails to mount protective responses to lethal antifolates. PLoS
Pathog 2008, 4:e1000214.
Shendure J, Porreca GJ, Reppas NB, Lin X, McCutcheon JP, Rosen-
baum AM, Wang MD, Zhang K, Mitra RD, Church GM: Accurate
multiplex polony sequencing of an evolved bacterial
genome. Science 2005, 309:1728-1732.
31.
32.
33.
34.
35.
36.
37.
38.
in treatment of
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.Bekal S, Craig J, Hudson M, Niblack T, Domier L, Lambert K:
Genomic DNA sequence comparison between two inbred
soybean cyst nematode biotypes facilitated by massively par-
allel 454 micro-bead sequencing. Mol Genet Genomics 2008,
279:535-543.
Hillier LW, Marth GT, Quinlan AR, Dooling D, Fewell G, Barnett D,
Fox P, Glasscock JI, Hickenbotham M, Huang W, Magrini VJ, Richt RJ,
Sander SN, Stewart DA, Stromberg M, Tsung EF, Wylie T, Schedl T,
Wilson RK, Mardis ER: Whole-genome sequencing and variant
discovery in C. elegans. Nat Methods 2008, 5:183-188.
Trager W, Jenson JB: Cultivation of malarial parasites. Nature
1978, 273:621-622.
Winzeler EA, Richards DR, Conway AR, Goldstein AL, Kalman S,
McCullough MJ, McCusker JH, Stevens DA, Wodicka L, Lockhart DJ,
Davis RW: Direct allelic variation scanning of the yeast
genome. Science 1998, 281:1194-1197.
Goodyer ID, Taraschi TF: Plasmodium falciparum: a simple,
rapid method for detecting parasite clones in microtiter
plates. Exp Parasitol 1997, 86:158-160.
Desjardins RE, Pamplin CL 3rd, von Bredow J, Barry KG, Canfield CJ:
Kinetics of a new antimalarial, mefloquine. Clin Pharmacol Ther
1979, 26:372-379.
Fidock DA, Wellems TE: Transformation with human dihydro-
folate reductase renders malaria parasites insensitive to
WR99210 but does not affect the intrinsic activity of pro-
guanil. Proc Natl Acad Sci USA 1997, 94:10931-10936.
PlasmoDB: The Plasmodium Genome Resource [http://
www.plasmodb.org]
50.
51.
52.
53.
54.
55.
56.