HECTD2 is associated with susceptibility to mouse and human prion disease.

Abstract

Prion diseases are fatal transmissible neurodegenerative disorders, which include Scrapie, Bovine Spongiform Encephalopathy (BSE), Creutzfeldt-Jakob Disease (CJD), and kuru. They are characterised by a prolonged clinically silent incubation period, variation in which is determined by many factors, including genetic background. We have used a heterogeneous stock of mice to identify Hectd2, an E3 ubiquitin ligase, as a quantitative trait gene for prion disease incubation time in mice. Further, we report an association between HECTD2 haplotypes and susceptibility to the acquired human prion diseases, vCJD and kuru. We report a genotype-associated differential expression of Hectd2 mRNA in mouse brains and human lymphocytes and a significant up-regulation of transcript in mice at the terminal stage of prion disease. Although the substrate of HECTD2 is unknown, these data highlight the importance of proteosome-directed protein degradation in neurodegeneration. This is the first demonstration of a mouse quantitative trait gene that also influences susceptibility to human prion diseases. Characterisation of such genes is key to understanding human risk and the molecular basis of incubation periods.

Full text

Page 1

HECTD2 Is Associated with Susceptibility to Mouse and
Human Prion Disease
Sarah E. Lloyd1,2, Emma G. Maytham1,2, Hirva Pota1,2, Julia Grizenkova1,2, Eleni Molou1,2, James
Uphill1,2, Holger Hummerich1,2, Jerome Whitfield1,2,3, Michael P. Alpers1,2,4, Simon Mead1,2, John
Collinge1,2*
1MRC Prion Unit, University College London Institute of Neurology, London, United Kingdom, 2Department of Neurodegenerative Diseases, University College London
Institute of Neurology, London, United Kingdom, 3Papua New Guinea Institute of Medical Research, Goroka, Eastern Highlands Province, Papua New Guinea, 4Centre for
International Health, Curtin University, Perth, Australia
Abstract
Prion diseases are fatal transmissible neurodegenerative disorders, which include Scrapie, Bovine Spongiform
Encephalopathy (BSE), Creutzfeldt-Jakob Disease (CJD), and kuru. They are characterised by a prolonged clinically silent
incubation period, variation in which is determined by many factors, including genetic background. We have used a
heterogeneous stock of mice to identify Hectd2, an E3 ubiquitin ligase, as a quantitative trait gene for prion disease
incubation time in mice. Further, we report an association between HECTD2 haplotypes and susceptibility to the acquired
human prion diseases, vCJD and kuru. We report a genotype-associated differential expression of Hectd2 mRNA in mouse
brains and human lymphocytes and a significant up-regulation of transcript in mice at the terminal stage of prion disease.
Although the substrate of HECTD2 is unknown, these data highlight the importance of proteosome-directed protein
degradation in neurodegeneration. This is the first demonstration of a mouse quantitative trait gene that also influences
susceptibility to human prion diseases. Characterisation of such genes is key to understanding human risk and the
molecular basis of incubation periods.
Citation: Lloyd SE, Maytham EG, Pota H, Grizenkova J, Molou E, et al. (2009) HECTD2 Is Associated with Susceptibility to Mouse and Human Prion Disease. PLoS
Genet 5(2): e1000383. doi:10.1371/journal.pgen.1000383
Editor: George A. Carlson, McLaughlin Research Institute, United States of America
Received September 23, 2008; Accepted January 15, 2009; Published February 13, 2009
Copyright: ? 2009 Lloyd et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by the Medical Research Council, UK.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: j.collinge@prion.ucl.ac.uk
Introduction
Prion diseases are fatal transmissible neurodegenerative disor-
ders of animals and humans. These include the agriculturally and
economically important diseases of scrapie and Bovine Spongi-
form Encephalopathy (BSE) and the human diseases sporadic
Creutzfeldt-Jakob disease (CJD), variant (vCJD) and kuru.
Sporadic CJD has no known aetiology and vCJD is thought to
have arisen following exposure to BSE prions [1]. Kuru is a prion
disease that reached epidemic proportions in the 1950s in the Fore
linguistic region of Papua New Guinea and is thought to have
been transmitted through endocannibalism by participation in
mortuary feasts [2]. Following the cessation of this practice in the
late 1950’s, the incidence of disease has declined, however, it
remains our only experience of a large epidemic of acquired
human prion disease and provides a useful model for vCJD [3].
Although there was widespread population exposure in the UK
and some other countries to BSE only around 200 have developed
clinical vCJD to date, although the number infected remains
unknown. This represents an on-going public health concern with
a risk of iatrogenic transmission through blood and surgical
instruments. vCJD has not been associated with any unusual
pattern of dietary or occupational exposure to BSE prions and a
significant genetic component to risk seems probable therefore the
identification of susceptibility factors is key to estimating individual
risk [1].
All prion diseases have prolonged clinically silent incubation
periods which in humans span over 50 years [2]. Marked variation
in incubation period occurs between inbred lines of mice and this
is determined by multiple genetic loci in addition to the prion
protein gene [4,5]
Previous studies have identified several quantitative trait loci for
prion disease incubation time in mice. However, the resulting
regions of interest spanned many megabases and were conse-
quently too large for individual candidate gene analysis [6–10].
Several different strategies are available for fine mapping [11–13]
and we chose to use a heterogeneous stock of mice. These are
produced to model an out-bred population of mice, however they
have the advantage of starting with a defined number of parental
alleles. Heterogeneous stocks of mice have been shown to be a
useful mapping tool because they provide a high level of
recombination and the development of specific mapping software
allows for convenient multipoint linkage analysis [14,15]. This
approach led to the identification of Hectd2, an E3 ubiquitin ligase,
as a quantitative trait gene for prion disease incubation time.
Mouse models are extremely useful for studying human prion
diseases as they faithfully recapitulate many key features of the
disease and indeed rodents are naturally susceptible to prion
diseases. It is expected that susceptibility genes and pathways
identified in mice will also be relevant to human prion diseases. To
test this hypothesis we carried out an association study with
HECTD2 markers and samples from different human prion
PLoS Genetics | www.plosgenetics.org1February 2009 | Volume 5 | Issue 2 | e1000383

Page 2

diseases and successfully found a significant association with two
acquired forms of prion disease: vCJD and kuru.
Results
Identification of Mouse Quantitative Trait Gene
To fine map regions thought to contain quantitative trait loci for
prion disease incubation time we utilised the Northport heteroge-
neous stock [16] (HS) of mice (gift of Robert Hitzemann), which was
produced by semi-randomly mating eight inbred lines of mice (A/J,
AKR/J,BALB/cJ,C3H/HeJ,C57BL/6J,CBA/J,DBA/2J, LP/J).
Approximately 1000 mice were inoculated intracerebrally with
mouse-adapted scrapie prions (Chandler/RML) and incubation
times (in days) were determined as previously described [6,17].
Regions of interest for fine mapping include those identified in
previous crosses [6–10] and also from other studies. In this study we
focus on a region of Mmu19 as a result of an interest in candidate
genes on human chromosome 10 (unpublished data).
Nine microsatellite markers from chromosome 19 (D19Mit86-
D19Mit112 see Table S1) at approximately 1 cM intervals were
genotyped in approximately 400 animals which represent the
extreme 20% of both sides of the incubation time distribution.
Multipoint linkage analysis was carried out using HAPPY (http://
www.well.ox.ac.uk/happy) [18]. A peak of linkage (2logP=5.88)
was seen between D19Mit63 and D19Mit65, a region of
approximately 2.9 Mb (Figure S1A). Significant linkage was taken
as 2logP.3 as defined by a permutation test (n=1000) carried
out by HAPPY. This interval explains 6.9% of the observed
variance therefore as predicted by other QTL mapping studies [6–
10], other loci are expected to contribute to prion disease
incubation time. Trait estimates for each strain are shown in
Table S2.
Twenty seven RefSeq genes were identified within this region
(NCBI build 37), 22 of which were sequenced (Table S3) in the
parental strains of the HS in order to identify polymorphisms.
Sequencing was not exhaustive and focused primarily on the exons
including 59 and 39UTRs, intron/exon boundaries and potential
promoters as defined by the literature for each gene or PROSCAN
(http://www-bimas.cit.nih.gov/molbio/proscan). 177 polymor-
phisms were identified across the region which included single
nucleotide polymorphisms (SNPs), simple repeats and insert/
deletion polymorphisms. Most of the variation was observed in
non-coding regions, however, several non-synonymous changes
were seen (for detail see Table S4). All variants were assessed using
an additional function of HAPPY which assigns a probability that
any polymorphism is a quantitative trait nucleotide (QTN) [19].
This predicts which strain distribution pattern (SDP) most closely
fits the pattern identified by the microsatellites in the HS animals
(Figure S1B, Table S4). The main candidates to emerge from this
analysis are Hectd2, Exoc6, Cyp26c1, Cyp26a1, Plce1 and Lgi1
(Table 1). Some SDPs are broadly conserved across the whole
gene (e.g. 2logP=6.12 Hectd2, 2logP=6.74 Cyp26c1 and Plce1)
whereas others represent single polymorphisms (e.g. 2logP=6.74
Cyp26a1 and Lgi1).
The 2logP values assigned by HAPPY are predictions. We
therefore tested representative polymorphisms from either each
gene, or each strain distribution pattern, by genotyping the HS
(Table 2). The only highly significant SNPs were seen in Hectd2
(P=0.0008, 0.0013 and 0.0022, ANOVA) suggesting that Hectd2 is
the most promising candidate in this region. However, these
analyses are not exhaustive and it is not possible to exclude the
possibility that variation in other genes or intergenic regions also
contribute to prion disease incubation time.
Seven SNPs were identified in the 39UTR of Hectd2 (Table S4),
however, it is not clear whether they would affect regulation. Five
Author Summary
Prion diseases are fatal transmissible neurodegenerative
diseases of animals and humans for which there is no
treatment. They include Bovine Spongiform Encephalop-
athy (BSE), and its human equivalent, variant Creutzfeldt-
Jakob Disease (vCJD). Prion diseases are characterised by a
long, silent incubation period before the disease emerges,
and this time interval varies greatly between individuals.
Differences in our genetic makeup are a key factor in this
variability. We already know that natural variation within
one key gene, the prion protein gene, has a major
influence on incubation time, but it is now clear that a
number of other genes are also important. Using a mouse
model, we have identified one of these genes, Hectd2,
which is thought to be involved in the process that
removes unwanted proteins from the cell. We also show
that HECTD2 is associated with an increased risk of two
human prion diseases—vCJD in the United Kingdom and
kuru in Papua New Guinea. These data will give us a better
understanding of the fundamental processes involved in
these diseases and go some way to explaining why some
individuals exposed to BSE have developed vCJD and
others have not.
Table 1. Most significant strain distribution patterns.
Strain distribution pattern Genes
2logPComment
(A, AKR, BALB) (C3H, C57, CBA, DBA, LP)Hectd26.12Promoter, Several intronic and 39UTR
(A, AKR BALB) (C3H, CBA, DBA, LP) (C57)Hectd26.15Single intronic
(A, AKR, BALB, C57, LP) (C3H, CBA, DBA)Exoc66.742 intronic, 1 39UTR
Cyp26c1T18A, Q256R and other synonymous
Cyp26a1G202D
Plce1 Several intronic and synonymous
Lgi1 Single intronic
(A, AKR, BALB, C57) (C3H, CBA, DBA, LP)Hectd2 6.84Single SNP 39UTR
Cyp26a1 Single intronic
2logP values are estimated by HAPPY based on polymorphisms detected in the parental strains of the HS.
doi:10.1371/journal.pgen.1000383.t001
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org2 February 2009 | Volume 5 | Issue 2 | e1000383

Page 3

polymorphisms occur within the predicted promoter (2226 to
+25) one of which affects a potentially functional site. Sequence for
the C57BL6/J allele from 2216 to 2210 is TGGGCGG and the
insertion of6Gs inthe
TGGGGGGGGGCGG. Both variants contain the consensus
sequence for a Sp1 binding site (shown in bold) however the
insertion also generates an overlapping large T antigen binding
site (underlined). It is unclear whether additional mouse proteins
could bind to this sequence or whether Sp1 binding would be
affected. The significant SDPs were spread across the whole of
Hectd2 therefore we cannot exclude any of these closely linked
polymorphisms either individually or collectively from a contri-
bution to the phenotype.
alternative allelegives
Mouse Hectd2 Expression
To determine whether the polymorphisms detected in Hectd2
have an effect on expression, RNA was extracted from whole
brains of 8 week old males from the parental strains of the HS
(except LP). Samples were analysed by real time RT-PCR. To
examine genotype-related differential expression, strains were
grouped according to the major strain distribution pattern seen in
Hectd2 (Group A=A, AKR, BALB; Group B=C3H, C57, CBA,
DBA). Expression was 62.4 greater in group A than group B
(P=2.8561029, unpaired t-test) (Figure 1A). Where incubation
time data are available, the increase in Hectd2 expression is
associated with a shorter incubation time (R2=0.61) [20–22] (See
also Figure S2). A potential role for Hectd2 in prion disease
pathogenesis was explored by comparing the mRNA expression
levels between normal mice and those at the end stage of disease
following infection with Chandler/RML prions. For C57BL/6,
expression was 65.0 greater in the prion infected mice
(P=2.6661028, unpaired t-test) (Figure 1B).
Human Association Study
Our data indicate that Hectd2 influences prion disease
incubation time in mice. We therefore analysed HECTD2 in a
hypothesis-driven association study of human prion disease. We
analysed 834 samples from patients with prion disease or strong
resistance to prion disease and 1162 relevant control population
samples. We tested whether genetic variation at HECTD2 was
associated with a phenotype of variant and sporadic CJD. In
Papua New Guinea (PNG) we genotyped patients who died from
the epidemic prion disease kuru, transmitted by endocannibalism,
and compared these data with elderly women known to have had
multiple exposures to kuru at mortuary feasts prior to the cessation
of endocannibalism in the late 1950’s, but who are long-term
survivors [2,23]. See methods for details of the patient data,
populations, phenotype ascertainment and population stratifica-
tion data.
We initially tested a single SNP, rs12249854(A/T), located in a
HECTD2 intron, and showed that the minor allele (A) was
significantly over-represented in vCJD (n=117, 8.1%) compared
to controls (n=601, 3.9%), P=0.0049, (OR 2.11, 95% CI 1.19–
Table 2. Polymorphism genotyping in HS mice.
Gene Polymorphism Happy 2logP HS p-value (ANOVA)
Hectd2Promoter (G)n 6.12P=0.0008 (n=398)
Intron 3 A/G 6.12P=0.0013 (n=404)
39UTR A/T6.84P=0.0022 (n=359)
Cyp26c1Exon 1 T18A6.74P=0.1512 (n=403)
Cyp26a1Exon 3 G202D6.74P=0.2017 (n=408)
Plce1Exon 6 T/C 6.74 P=0.1556 (n=411)
All polymorphisms were analysed by allele discrimination using a 7500 Fast real
time PCR system (Applied Biosystems) except the Hectd2 promoter
polymorphism which was typed by size using fluorescent primers on a
MegaBACE1000 sequencer (GE Healthcare). For probe details see Table S5.
doi:10.1371/journal.pgen.1000383.t002
Figure 1. Quantitative RT-PCR of Hectd2I. cDNA was prepared from whole brains of uninfected 8 week old male mice or mice at the terminal
stages of disease following intracerebral inoculation with Chandler/RML mouse-adapted scrapie prions. All samples were duplexed for Hectd2 and
GAPDH fluorogenic probes and run in triplicate with n=6 for each mouse strain/group. Mean6s.e.m. Hectd2 mRNA expression level is expressed in
arbitrary units as normalised by the quantity of GAPDH (y-axis). A, Inbred strains are grouped according to the major strain distribution pattern seen in
Hectd2 (Group A=A, AKR, BALB; Group B=C3H, C57, CBA, DBA). Expression was 62.4 greater in group A than group B (P=2.8561029, unpaired t-
test). B, Comparison of Hectd2 expression in normal and RML prion-infected C57BL6 mouse brains. Expression was65.0 greater in the brains of prion-
infected mice, (P=2.6661028, unpaired t-test). C, Expression of HECTD2 in cDNA prepared from lymphocytes of human blood donors (n=140).
Samples were duplexed for HECTD2 and b-actin fluorogenic probes and run four times. Mean6s.e.m. HECTD2 mRNA expression level is expressed in
arbitrary units as normalised by the quantity of b-actin (y-axis). Data are grouped according to genotypes at rs12249854 as determined from genomic
DNA. Expression was 62.3 greater in the heterozygotes (TA) than for the major allele homozygotes (TT) (P=0.0008 Mann-Whitney test).
doi:10.1371/journal.pgen.1000383.g001
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org3 February 2009 | Volume 5 | Issue 2 | e1000383

Page 4

3.77, trend test 1 d.f.), and between sporadic CJD (n=452, 6.3%)
and controls, P=0.012, (OR 1.65, 95% CI 1.11–2.46, trend test 1
d.f.). Given that sample sizes are necessarily small in both sporadic
and variant CJD, these data are consistent with the association of
rs12249854 with risk in both prion disease categories and a large
effect size. We went on to test whether the risk rs12249854 allele
modified the phenotype of human prion disease. Although the age
of onset of sporadic CJD with rs12249854AA was younger than
other genotypes (53.5 years Vs 68.8 years for rs12249854AT and
69.0 years for rs12249854TT, P=0.048 t-test), this genotype was
rare (n=3) and the finding therefore was not robust. There was no
association between vCJD year of presentation, or age of onset
with rs12249854 genotype. Insufficient data were available to look
at any association with duration of illness.
We went on to analyse a further seven SNPs in HECTD2
selected to capture global genetic diversity based on Hapmap
(http://hapmap.org) [24] data (Table S6). In the United Kingdom
(UK), we found strong linkage disequilibrium (LD) and a simple
haplotype structure across the entire gene (Table 3). Three
haplotypes were .1% frequency, the most common two
haplotypes (1 and 2) differed at all SNPs, a third haplotype (3)
was distinguished from the most common haplotype (1) by a single
SNP upstream of HECTD2. Increased risk of vCJD was associated
with haplotype 2, possessing rs12249854A, but the extensive LD
prevented us from identifying the functional SNP. In PNG,
however, we found considerably more diversity with four common
haplotypes, 1, 2 and two novel haplotypes 4 and 5 (see methods for
haplotype inference). Haplotype 2, most significantly associated
with vCJD (haplotype association test, P=0.006), showed no
significance between kuru and the elderly female survivors of
mortuary feasts. Rather, in PNG we found that a population
specific haplotype (designated 4) was strongly associated with kuru
(P=0.0009). Haplotype 4 differs from haplotype 2 at a single SNP,
rs12247672, which itself is significant in vCJD (P=0.0039) but not
at all in kuru (P=0.6138). Our data suggest that there is evidence
for HECTD2 association in both vCJD and kuru however the
functional polymorphisms are likely to be different. This is not
necessarily surprising given the distinct evolutionary history and
consequent genetic differences that exist between the UK and
PNG populations. It should also be noted that although vCJD and
kuru are both acquired human prion diseases that share many
characteristics they are also derived from different sources and
caused by distinct prion strains [25,26] therefore the mechanism of
HECTD2 involvement may also be different.
HECTD2 Sequencing
We sequenced the ORF and promoter of HECTD2 in 16 vCJD,
multi kuru-exposure survivors, and both UK and PNG controls.
Three polymorphisms were found, of which only one is potentially
functional (Table 4). rs7081363 occurs in the promoter (2247) and
the minor allele is predicted to remove an Sp1 binding site
(GGCG/AGG). rs7081363 was genotyped in our samples and
shown to be in complete LD with rs12249854 in the UK
population (vCJD P=0.0012; sporadic CJD P=0.0065). We were
unable to genotype the kuru samples due to poor DNA quality,
however, analysis of all other samples suggest that rs7081363 is
unlikely to be significant in PNG.
Human HECTD2 Expression
To determine whether the susceptibility alleles in the UK
population are associated with differential mRNA expression,
HECTD2 expression levels in blood lymphocytes (n=140, UK
blood donors) were quantified by real-time RT-PCR. Samples
were grouped according to rs12249854 genotype, however, due to
the low frequency of the minor allele (A), no homozygotes (AA)
were seen. The mean expression level was 62.3 greater in the
heterozygotes than for the major allele homozygotes (TT)
(P=0.0008 Mann-Whitney test, Figure 1C). This suggests that a
higher level of HECTD2 mRNA expression may be linked with
vCJD in the UK population.
Discussion
Our data show that HECTD2 is linked to prion disease
incubation time in mouse and is associated with sporadic and
variant CJD and kuru in humans and an increase in expression is
associated with a susceptibility genotype and disease pathogenesis.
In mouse, we cannot exclude the possibility of other nearby genes
or intergenic regions also being implicated as our sequencing
studies were not exhaustive. However, in human, the LD block,
based on HapMap [24] data, includes only HECTD2 and does not
extend into the neighbouring genes suggesting that the association
observed stems from HECTD2 and not any other gene in the area.
In mouse, the promoter, 39UTR polymorphisms and the
associated differential expression suggest a mechanism by which
Hectd2 may influence the incubation time phenotype. Similarly, in
the UK population a promoter polymorphism is also associated
with a susceptibility phenotype and a resulting increase in
expression level. This suggests that the mode of HECTD2 action
in prion disease may be independent of host and prion strain. Due
to lack of available material it has not been possible to replicate
these experiments in our kuru samples, however, our haplotype
study suggest that a different polymorphism is likely to be
functional in the PNG population. This does not rule out the
possibility that differential expression is also important in PNG,
through an alternative polymorphism, although this may be
difficult to determine. Our expression analysis in terminally sick
mice suggest that HECTD2 is upregulated during the course of
infection therefore we can speculate that a higher base line of
expression reduces the time taken to reach a threshold level
thereby reducing the incubation time.
The ubiquitin-proteosome system has been implicated in the
pathogenesis of several neurodegenerative diseases which show an
accumulation of an abnormally folded protein including prion
disease, Parkinson’s disease and Alzheimer’s disease [27–29]. By
homology to other family members, HECTD2 is an E3 ubiquitin
Table 3. Most common HECTD2 haplotype frequencies.
UK
Haplotype NamevCJDControl P-value
2222222210.951 0.9120.02
1111111120.026 0.0610.006
122222223 0.023 0.0270.73
Papua New Guinea
Haplotype Name
Multiple
exposureKuru P-value
222222221 0.641 0.743 0.014
111111112 0.1460.123 0.45
121111114 0.1730.076961024
2222221150.0400.0580.36
1=minor allele; 2=major allele.
doi:10.1371/journal.pgen.1000383.t003
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org4February 2009 | Volume 5 | Issue 2 | e1000383

Page 5

ligase suggesting that common pathways are involved in the
neurodegenerative processes of these different diseases. Specifical-
ly, the mouse mahoganoid coat-colour mutation is found in the gene
Mahogunin which is an E3 ubiquitin ligase [30]. A null mutation of
Mahogunin causes an age-related progressive neurodegenerative
phenotype characterised by spongiform degeneration, neuronal
loss and astrocytosis. The phenotype resembles that of prion
disease however there is no PrPScaccumulation. Mutations in the
E3 ubiquitin ligase parkin are associated with autosomal recessive
juvenile parkinsonism and loss of ubiquitin-protein ligase activity
in patients has been shown to be associated with protein
accumulation [31]. E3 ubiquitin ligases have also been implicated
in the pathogenesis of polyglutamine diseases in particular it has
been shown that mutations in the E6-AP ubiquitin ligase reduces
the frequency of nuclear inclusions in mice expressing mutant
ataxin-1 while accelerating the Purkinje cell pathology [32].
Further, HECTD2 maps to a region of human chromosome 10q
previously linked with Alzheimer’s disease [33] suggesting that
HECTD2 may also be a susceptibility factor for Alzheimer’s
disease and other neurodegenerative disorders.
Group sizes for vCJD, kuru and elderly female survivors of
mortuary feasts are of necessity small, however we believe that the
combined weight of data from the mouse genetic studies,
expression analyses and our association study of independent
human prion diseases from different populations provide sufficient
evidence to support a role for HECTD2 in prion disease. This
supports a significant role for the ubiquitin-proteasome system in
prion pathogenesis [27,34,35] and will contribute to modelling
and understanding genetic risk of developing prion disease
following BSE and secondary human prion exposure.
Materials and Methods
Human Samples
The clinical and laboratory studies were approved by the local
research ethics committee of University College London Institute
of Neurology and National Hospital for Neurology and Neuro-
surgery and by the Medical Research Advisory Committee of the
Government of PNG. Full participation of the PNG communities
involved was established and maintained through discussions with
village leaders, communities, families and individuals.
vCJD.
118 probable or definite vCJD patients, according to
established criteria (http://www.advisorybodies.doh.gov.uk/acdp/
tseguidance/tseguidance_annexb.pdf),wererecruited bythe
National Prion Clinic (NPC), London or the National CJD
Surveillance Unit (NCJDSU), Edinburgh from 1995 to 2005.
Iatrogenic vCJD, acquired through blood transfusion was not
included in this panel. Genomic DNA was usually extracted from
peripheralblood; braintissuewasusedasa sourceforsome patients.
Amplified DNA, using either multiple displacement amplification
(Geneservice, Cambridge, UK) or fragmentation-PCR methods
(Genomeplex, Sigma), was used for a small number ,10% of
samples. Samples were checked for degradation on 1% agarose gel
and stored at 50 ng/ml in low concentration Tris-EDTA buffer. All
patients were thought to have acquired the disease in the UK and
wereof white-British ethnicity; 60% weremale. Mean(range) age of
onset of disease onset was 29 years (13–62).
Sporadic CJD.
458 probable or definite sporadic CJD
patients, according to WHO criteria, were recruited by the
National Prion Clinic (NPC), London or the National CJD
Surveillance Unit (NCJDSU), Edinburgh, or numerous other
referrers in the UK. DNA was sourced and amplified as for vCJD.
All patients were of UK or northern European origin. Although
the vast majority of patients were of white-British ethnicity, and all
patients of known non-white ethnicity were excluded, this
information was based on name and geography for some
samples. DNA preparation and storage was similar to vCJD.
Over 60% had pathologically confirmed sCJD, the remainder had
a diagnosis of probable sCJD according to published WHO
criteria with a high specificity [36]. Mean (range) age of onset of
disease was 62 years (15–87).
Kuru/elderly women resistant to kuru.
kuru surveillance was conducted by many different investigators
(Gajdusek, Zigas, Baker, Alpers, Hornabrook, Moir and others)
and from 1987 to 1995 solely by the Kuru Surveillance Team of
the Papua New Guinea Institute of Medical Research. From 1996
onwards, kuru surveillance was strengthened and a field base and
basic laboratory for sample processing and storage was established
in the village of Waisa in the South Fore [37]. The kuru collection
(n=151) comprises young children, adolescents and adults from
around the peak of the epidemic and elderly recent kuru cases with
long incubation times. They resided in the South Fore (53), North
Fore (40), Gimi (3), Keiagana (10), or other linguistic groups (11) of
the kuru-affected region of the Eastern Highlands Province of
Papua New Guinea; in 34 cases the linguistic group within the
region was not recorded.
Elderly exposed women were defined as aged over 50 years in
2000 from a kuru-exposed region (n=115). These women were
Prior to 1987,
Table 4. HECTD2 polymorphisms.
LocationID UK GenotypingPNG Genotyping
Promoter (2247) rs7081363 (G/A) vCJD (n=114), P=0.0012Multiexposure (n=93)
sCJD (n=425), P=0.0065 Unexposed Fore (n=128), P=0.9969
Controls (n=616) Unexposed PNG (n=275), P=0.2836
Kuru - ND
Promoter (2184) C/AND ND
Exon 4rs7920604 (G/A) NDND
Sequencing of the open reading frame and putative promoter was carried out in 16 vCJD samples, 16 multiple exposure unaffected elderly women from PNG, 16 UK
controls and 16 controls from PNG.
rs7081363 was genotyped by allelic discrimination on a Real Time PCR machine (Applied Biosystems). It was not possible to genotype the kuru sample due to the quality
of the DNA. The minor allele is in linkage disequilibrium (LD) with rs12249854 in the UK but not in PNG. The minor allele (A) eliminates an Sp1 binding site on the
negative strand (2250 to 2245).
Based on the sequencing results the minor allele at promoter polymorphism at 2184 and rs7920604 appear to be in LD with rs12249854 in both the UK and PNG.
PNG – Papua New Guinea, ND – not done.
doi:10.1371/journal.pgen.1000383.t004
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org5 February 2009 | Volume 5 | Issue 2 | e1000383

Page 6

unaffected at the time of sampling but were thought to have been
exposed to kuru prions in childhood. Although these women may
not be truly ‘‘resistant’’ to kuru prions they would have incubation
times in excess of 40 years. Additional controls were obtained
from the young modern day healthy population that has not been
exposed to kuru but came from villages in the exposed region by
matching each elderly woman (‘‘resistant’’) to at least two current
residents of the same village aged less than 50 in 2000. These
largely came from the South Fore, but with a significant number
from the North Fore and a small number of individuals from
Gimi, Keiagana and Yagaria linguistic groups. Further controls
were obtained from young unexposed people from areas of PNG
where no kuru has been recorded. Where identified by either
genealogical data or microsatellite analysis, first degree relatives
were excluded from these groups. DNA from degraded archival
kuru sera, obtained from the NIH collection, was isolated by
QIAGEN QIAamp Blood DNA minikit followed by whole
genome amplification either through using a W29 protocol
(Geneservice), or GenomePlex Complete Whole Genome Ampli-
fication Kit (WGA2) (Sigma).
UK controls.
116 individuals were recruited from the
National Blood Service (NBS). Information was collected about
gender, age, ethnicity and birthplace divided into 12 regions.
Samples were very similar to vCJD for white-British ethnicity,
birthplace (by 12 regions in UK) and gender. DNA was extracted
from whole blood. PAXgene blood RNA samples were also
collected (Preanalytix). Mean (range) of age at sampling was
34 years (18–64); 56% were male. Further UK control samples
(n=480) were purchased from the European Collection of Cell
Cultures (ECACC) Human Random control (HRC) DNA panels
consisting of randomly selected, non-related UK Caucasian blood
donors. Total number of UK controls was n=596.
Population structure.
Population structure was considered
with identity by state (IBS) clustering (implemented by PLINK
(http://pngu.mgh.harvard.edu/,purcell/plink/index.shtml), and
principalcomponents analysis
EIGENSTRAT package [38]. Genome-wide data (manuscript in
preparation) with high stringency filtering was used to compare
vCJD and UK controls with both PLINK or EIGENSTRAT (no
significant eigenvectors were detected using default procedures).
For other groups of patients and PNG groups genotypes were
generated for 1325 SNPs in 344 randomly selected, non-related
UK Caucasian blood donors provided by the European Collection
of Cell Cultures (see above, methods), 458 sCJD patients, 143 kuru
patients, 115 elderly women resistant to kuru born before 1950,
and 282 young individuals from the kuru region matched to the
village of residence of the elderly women. We used the Illumina
Goldengate platform at the St. Bartholomew’s Hospital Genome
Centre. SNPs were filtered for association with vCJD by
comparison with UK controls by best permuted P,0.001 from
any of 4 genetic models (allelic, trend, genotypic or recessive).
Genotyping quality was assessed by Hardy-Weinberg equilibrium
(excluding those by exact test P,0.001) and visual inspection of all
genotype clusters with Beadstudio v3.1. Overall genotype call rate
was 99.7%, concordance of duplicate samples was .99.7%. All
autosomes were equally represented with a median intermarker
distance of 1.3 MB. For EIGENSTRAT 10 eigenvectors were
generated using default procedures and outlier detection (6 PNG
samples were removed). No significant eigenvectors (P.0.01) were
identified between sCJD, iatrogenic CJD and UK controls, or
between kuru patients, elderly women resistant to kuru and
healthy young Fore (total 5 comparisons).
Statistical analysis of human data.
association and permutation testing. The primary analysis was a
(implemented bythe
PLINK was used for
trend model chi-squared test. Haplotype inference was made with
PLINK and Haploview using standard expectation-maximisation
algorithms. The haplotype association test was implemented
through PLINK.
Animals
28 pairs of Northport HS mice were obtained from R.
Hitzemann (Portland, Oregon, USA) at generation 35. Offspring
from these pairs were randomly mated to produce a total of 49
pairs. 1000 offspring (generation 37) were used for inoculation. All
other inbred lines were obtained from Harlan, UK. Mice were
identified by individual transponder tags (Trovan) and tail biopsies
were obtained for DNA extraction. Mice were anaesthetized with
isofluorane/O2 and inoculated intra-cerebrally into the right
parietal lobe with 30 ml Chandler/RML prions as previously
described [6]. Incubation time was calculated retrospectively after
a definite diagnosis of scrapie had been made and defined as the
number of days from inoculation to the onset of clinical signs [17].
All procedures were conducted in accordance with UK regulations
(Local ethics approval and Home Office regulation) and
international standards on animal welfare.
Genotyping.
Microsatellites were selected (Table S1) from
the UCSC Mouse Genome Browser http://genome.ucsc.edu and
Mouse Genome Informatics web site (www.informatics.jax.org).
For the HS cross nine microsatellite markers from chromosome 19
(D19Mit86-D19Mit112
seeTable
approximately 400 animals which represent the extreme 20% of
both sides of the incubation time distribution. Fluorescently
labelled and standard oligonucleotides were synthesized by Sigma-
Genosys. PCR reactions were all carried out in 5 ml on 96-well
plates using MegaMix Blue (Microzone Ltd) according to the
manufacturer’s instructions using 5pmoles of each primer. PCR
conditions were determined empirically but in general cycling
conditions using a PTC-225 (MJ Research) thermal cycler were as
follows: 94uC for 10 min; 94uC 30 s, 55uC 30 s, 72uC 30 s for 35
cycles; 72uC for 5 min. Products of appropriate size and
fluorochrome were pooled before further processing. Reactions
were ethanol precipitated, washed in 70% ethanol and re-
suspended in a total of 10 ml including 5.8 ml MegaBACE
loading solution (GE Healthcare) and 0.2 ml MegaBACE
ET400-R size standard (GE Healthcare). 1/10 dilution in
MegaBACE loading solution was used for analysis. Fragments
were heat denatured at 94uC for 2 min before loading onto a
MegaBACE1000 capillary sequencer (GE Healthcare). Samples
were injected at 3 KV for 45 s and run at 10 KV for 60 minutes.
Fragment sizes were analysed using Genetic Profiler v1.1 (GE
Healthcare). Multipoint linkage analysis was carried out using
HAPPY. Mouse family structure was not taken into consideration
for this analysis, therefore, the effect size calculated by HAPPY
(http://www.well.ox.ac.uk/happy) [18] for each strain (Table S2)
may be overestimated. Novel methods are under development for
including family structure and more accurate estimates of effect
size (personal communication Richard Mott).
Sequencing.
Genomic DNA for the parental strains were
obtained from the Jackson Laboratory (Bar Harbor, Maine, USA)
to minimize any differences with the HS mice due to sub strain
variations. PCR products were designed to cover the open reading
frame, 59 and 39 untranslated region, intron-exon boundaries and
potential promoter sequences as defined by the literature for each
gene or as predicted by PROSCAN. PCR products were
generated in 25 ml reactions using MegaMix Blue (Microzone
Ltd) according to the manufacturer’s instructions with 10pmole of
each primer. Cycling conditions were determined empirically but
in general were 94uC for 10 min; 94uC 30 s, 60uC 45 s, 72uC 60 s
S1)were genotyped in
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org6February 2009 | Volume 5 | Issue 2 | e1000383

Page 7

for 40 cycles; 72uC for 5 min. PCR products were cleaned using
Microclean (Microzone Ltd) according to the manufacturer’s
instructions and re-suspended in H2O. 100–200 ng PCR product
was added to a 15 ml sequencing reaction including 5pmoles of
either the forward or reverse primer, 1 ml BigDye Terminator v1.1
Cycle Sequencing Kit (Applied Biosystems) and 5 ml Better Buffer
(Microzone Ltd). Cycling conditions were: 95u 30 s, 50u 15 s, 60u
120 s, for 30 cycles. Reactions were ethanol precipitated, washed
in 70% ethanol and re-suspended in 10 ml MegaBACE loading
solution (GEHealthcare). Products
MegaBACE1000 capillary sequencer (GE Healthcare). Samples
were injected at 3 KV for 40 s and run at 9 KV for 100 minutes.
were detected ona
RNA Extraction and Quantitative RT-PCR
Mouse brain.
RNA was extracted from whole brains from
either uninfected or RML terminally sick mice. For the HS parental
lines samples were obtained for A, AKR, BALB/c C3H, C57BL/6,
CBA and DBA/2 strains but not LP. Eight week old adult male mice
were used for all normal brains. Tissue was homogenized using a
Ribolyser according to the manufacturer’s instructions. RNA was
prepared using either RNeasy Maxi (Qiagen) kit or TRIreagent
(Ambion) according to the manufacturer’s instructions. Samples were
treated with DNaseI (Qiagen) and purified further using RNeasy
Mini (Qiagen) columns according to the manufacturer’s instructions.
4 mg total RNA was reversed transcribed with AMV reverse
transcriptase and random primers from the Reverse Transcription
System (Promega) according to the manufacturer’s instructions.
Reactions with no reverse-transcription werealso carried out foreach
sample to ensure no genomic DNA contamination. Hectd2 real-time
PCR was carried out on a 7500 Fast Real-time PCRSystem (Applied
Biosystems) in a total volumeof 15 ml using 1 ml cDNA (200–300 ng)
and QuantiTect probe PCR kit (Qiagen) according to the
manufacturer’s instructions. Primers (6 pmoles) F- 59-CCCC-
TGAGCTAGGCATTTCC-39, R-59 –GAGTTACTGCACCCT-
TGAATTCTG-39
andprobe
CGCTGTGCTTTCTGCACCCAACTamra-39
using PrimerExpress software (Applied Biosystems) and supplied by
Sigma Genosys. Rodent GAPDH or b-actin (data not shown)
(Applied Biosystems) was duplexed within the reaction as an
endogenous control according to the manufacturer’s instructions.
All reactions were carried out in triplicate using the following cycling
conditions: 95uC 15 mins; 95uC 15 s, 60uC 60 s for 40 cycles.
Human blood.
2.5 ml of blood was collected into PAXgene
Blood RNA tubes (PreAnalytix) and RNA was extracted using the
PAXgene 96 Blood RNA kit (PreAnalytix) according to the
manufacturer’s instructions.
1–2 mg of RNA was used to synthesize cDNA in a 20 ml
reaction using Omniscript Reverse Transcriptase (Qiagen), 0.5 mg
random hexamers (Promega) and 40 u RNasin Plus (Promega).
Samples were incubated at room temperature for 10 min followed
by 1 hour at 37uC and 65uC for 5 mins. cDNA was diluted 1/2 in
H20 for use in downstream PCR reactions. For real-time reactions
human
HECTD2
primers(6
TACCGTGGACGACTT -39, R-59 – CTTCAACATTGCCTT-
CATGTGATAA -39 and probe (3 pmoles) 59-Fam CAAAT-
TATGCCTGAGTTGGCCCATGGAT Tamra-39 were designed
using PrimerExpress software (Applied Biosystems) and supplied
by Sigma Genosys. Reactions were carried out on a 7500 Fast
Real-time PCR System (Applied Biosystems) in a total volume of
15 ml using 1 ml cDNA and ROXMegaMix Gold (Microzone Ltd)
according to the manufacturer’s instructions. Human b-actin or
PGK-1 (Applied Biosystems) (data not shown) was duplexed within
the reaction as an endogenous control according to the
manufacturer’s instructions. Four replicates were carried out for
(3pmoles)59-FamTGT-
weredesigned
pmoles) F-59-GCAATGT-
all samples using the following cycling conditions: 95uC 5 mins;
95uC 15 s, 60uC 60 s for 45 cycles.
For both mouse and human samples, standard curves were
constructed for both target and endogenous controls and used to
calculate the quantities of both transcripts. Hectd2 values were
normalized by dividing with the quantity of endogenous control.
SNP genotyping.
Primers and probes for mouse genotyping
(TableS5)weredesignedusingcriteriadefinedbyAppliedBiosystems
and PrimerExpress software (Applied Biosystems). MGB probes
labelled with either Vic or Fam were purchased from Applied
Biosystems and primers for amplification were obtained from Sigma-
Genosys. For human SNPs pre-designed allelic discrimination assays
were purchased from Applied Biosystems and used according to the
manufacturer’s instructions. 2.5pmole of each primer and 1pmole of
eachprobewasusedformousegenotyping.Allreactionswerecarried
out in 5 ml on a 7500 Fast Real-time PCR System (Applied
Biosystems) using either RoxMegaMix Gold (Microzone Ltd) or
QuantiTect probe PCR kit (Qiagen). Cycling conditions were the
same for both enzymes (95uC 15 s, 60uC 60 s for 40 cycles) however
RoxMegaMixGold andQuantiTectenzyme required5and 15 mins
initial heating at 95uC respectively. For marker rs7081363 primers
were designed as above. F primer (CCCGACCCGCGACG), R
primer (CCCACAGGTCCCACAGGTTT),
(CCTCCCCCGCCC – Vic/MGB), Probe allele T (CCTC-
CCCTGCCC – Fam/MGB). 10 ml reactions were carried out as
aboveexceptthat 1 MBetaine(Sigma)wasadded tothereactionand
the annealing temperature was 58uC.
Probe alleleC
Supporting Information
Figure S1
Results are displayed on the y-axis as 2log of the P value with
cM or Mb distance along Mmu19 on the x-axis. A, Log probability
plot (additive model) for microsatellites between D19Mit86 and
D19Mit112. The peak of linkage is seen for the interval D19Mit63-
D19Mit65. For details of intervals see Table S1. B, Linkage analysis
for all polymorphisms detected in genes in the interval D19Mit63-
D19Mit65. Details for individual SNPs are given in Table S4.
Found at: doi:10.1371/journal.pgen.1000383.s001 (0.06 MB
DOC)
HAPPY multipoint linkage analysis for Mmu19.
Figure S2
strains. cDNA was prepared from whole brains of uninfected 8
week old male mice or mice at the terminal stages of disease
following intracerebral inoculation with Chandler/RML mouse-
adapted scrapie prions. All samples were duplexed for Hectd2 and
GAPDH fluorogenic probes and run in triplicate with n=6 for
each mouse strain/group. Mean6s.e.m. Hectd2 mRNA expression
level is expressed in arbitrary units as normalised by the quantity
of GAPDH (y-axis). All mouse strains carry the Prnpaallele.
Published incubation times with Chandler/RML are: AKR
12364; BALB/c 124611; C3H 13264; DBA/2 13463,
C57BL/6 13760 or 14364; CBA 140610 [20–22]. Incubation
times with RML prions are unknown for mouse strains A and LP.
Found at: doi:10.1371/journal.pgen.1000383.s002 (0.02 MB
DOC)
Quantitative RT-PCR of Hectd2 for individual mouse
Table S1
Found at: doi:10.1371/journal.pgen.1000383.s003 (0.03 MB
DOC)
Linkage analysis for microsatellite markers Mmu19.
Table S2
D19Mit65.
Found at: doi:10.1371/journal.pgen.1000383.s004 (0.03 MB
DOC)
Trait estimates for HS parental strains D19Mit63-
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org7 February 2009 | Volume 5 | Issue 2 | e1000383

Page 8

Table S3
D19Mit65.
Found at: doi:10.1371/journal.pgen.1000383.s005 (0.03 MB
DOC)
Sequenced RefSeq genes from interval D19Mit63-
Table S4
Found at: doi:10.1371/journal.pgen.1000383.s006 (0.3 MB DOC)
Analysis of polymorphisms from D19Mit63-D19Mit65.
Table S5
genotyping.
Found at: doi:10.1371/journal.pgen.1000383.s007 (0.04 MB
DOC)
Primer and probe sequences for mouse polymorphism
Table S6
Found at: doi:10.1371/journal.pgen.1000383.s008 (0.04 MB
DOC)
Genotyping results for HECTD2 tagging SNPs.
Acknowledgments
This study would not have been possible without the generous support of
patients, their families and carers, UK neurologists and other referring
physicians, co-workers at the National Prion Clinic, our colleagues at the
National Creutzfeldt-Jakob Disease Surveillance Unit, Edinburgh, and the
Fore communities in Papua New Guinea. We gratefully acknowledge the
help of Carleton Gajdusek, Joseph Gibbs and their associates from the
Laboratory of Central Nervous System Studies of the National Institutes of
Health, Bethesda, USA for archiving and sharing old kuru samples. We are
also grateful to the UK National Blood Service for access to UK blood
donors. We also thank Robert Hitzemann (Department of Behavioural
Neuroscience, Oregon Health Sciences University, Portland, Oregon,
USA) for the kind gift of the Northport Heterogeneous Stock of mice; Mark
Poulter for preparation and maintenance of human DNA and RNA stocks;
David Key and his staff for Biological Services and Ray Young for
preparation of figures.
Author Contributions
Conceived and designed the experiments: SEL JC. Performed the
experiments: SEL EGM HP JG EM JU. Analyzed the data: SEL HH
SM. Contributed reagents/materials/analysis tools: JW MPA. Wrote the
paper: SEL JC.
References
1. Collinge J (1999) Variant Creutzfeldt-Jakob disease. Lancet 354: 317–323.
2. Collinge J, Whitfield J, McKintosh E, Beck J, Mead S, et al. (2006) Kuru in the
21st century–an acquired human prion disease with very long incubation
periods. Lancet 367: 2068–2074.
3. Collinge J, Whitfield J, McKintosh E, Frosh A, Mead S, et al. (2008) A clinical
study of kuru patients with long incubation periods at the end of the epidemic in
Papua New Guinea. Philos Trans R Soc Lond B Biol Sci 363: 3725–3739.
4. Carlson GA, Westaway D, Prusiner SB (1992) The Genetics of Prion
Susceptibility in the Mouse. In: Prusiner SB, Collinge J, Powell J, Anderton B,
eds. Prion Diseases in Humans and Animals. London: Ellis Horwood.
5. Lloyd S, Collinge J (2005) Genetic Susceptibility to Prion Diseases in Humans
and Mice. Current Genomics 6: 1–11.
6. Lloyd S, Onwuazor ON, Beck J, Mallinson G, Farrall M, et al. (2001)
Identification of multiple quantitative trait loci linked to prion disease incubation
period in mice. Proc Natl Acad Sci USA 98: 6279–6283.
7. Lloyd S, Uphill JB, Targonski PV, Fisher E, Collinge J (2002) Identification of
genetic loci affecting mouse-adapted bovine spongiform encephalopathy
incubation time in mice. Neurogenetics 4: 77–81.
8. Stephenson DA, Chiotti K, Ebeling C, Groth D, DeArmond SJ, et al. (2000)
Quantitative trait loci affecting prion incubation time in mice. Genomics 69:
47–53.
9. Manolakou K, Beaton J, McConnell I, Farquar C, Manson J, et al. (2001)
Genetic and environmental factors modify bovine spongiform encephalopathy
incubation period in mice. Proc Natl Acad Sci U S A 98: 7402–7407.
10. Moreno CR, Lantier F, Lantier I, Sarradin P, Elsen JM (2003) Detection of new
quantitative trait loci for susceptibility to transmissible spongiform encephalop-
athies in mice. Genetics 165: 2085–2091.
11. Abiola O, Angel JM, Avner P, Bachmanov AA, Belknap JK, et al. (2003) The
nature and identification of quantitative trait loci: a community’s view. Nat Rev
Genet 4: 911–916.
12. Darvasi A (2005) Dissecting complex traits: the geneticists’ - ’Around the world
in 80 days’. Trends Genet 21: 373–376.
13. Flint J, Valdar W, Shifman S, Mott R (2005) Strategies for mapping and cloning
quantitative trait genes in rodents. Nat Rev Genet 6: 271–286.
14. Valdar W, Solberg LC, Gauguier D, Burnett S, Klenerman P, et al. (2006)
Genome-wide genetic association of complex traits in heterogeneous stock mice.
Nat Genet 38: 879–887.
15. Talbot CJ, Nicod A, Cherny SS, Fulker DW, Collins AC, et al. (1999) High-
resolution mapping of quantitative trait loci in outbred mice. Nat Genet 21:
305–308.
16. Hitzemann B, Dains K, Kanes S, Hitzemann R (1994) Further-Studies on the
Relationship Between Dopamine Cell-Density and Haloperidol-Induced
Catalepsy. J Pharm Exp Therap 271: 969–976.
17. Carlson GA, Kingsbury DT, Goodman PA, Coleman S, Marshall ST, et al.
(1986) Linkage of prion protein and scrapie incubation time genes. Cell 46:
503–511.
18. Mott R, Talbot CJ, Turri MG, Collins AC, Flint J (2000) A method for fine
mappingquantitativetraitlociinoutbredanimalstocks.ProcNatlAcadSciUSA
97: 12649–12654.
19. Yalcin B, Flint J, Mott R (2005) Using progenitor strain information to identify
quantitative trait nucleotides in outbred mice. Genetics 171: 673–681.
20. Kingsbury DT, Kasper KC, Stites DP, Watson JD, Hogan RN, et al. (1983)
Genetic control of scrapie and Creutzfeldt-Jakob disease in mice. J Immunol
131: 491–496.
21. Westaway D, Goodman PA, Mirenda CA, McKinley MP, Carlson GA, et al.
(1987) Distinct prion proteins in short and long scrapie incubation period mice.
Cell 51: 651–662.
22. Carlson GA, DeArmond SJ, Torchia M, Westaway D, Prusiner SB (1994)
Genetics of prion diseases and prion diversity in mice. Philos Trans R Soc Lond
[Biol ] 343: 363–369.
23. Mead S, Stumpf MP, Whitfield J, Beck J, Poulter M, et al. (2003) Balancing
selection at the prion protein gene consistent with prehistoric kuru-like
epidemics. Science 300: 640–643.
24. The International HapMap Project (2003) Nature 426: 789–796.
25. Wadsworth JD, Joiner S, Linehan JM, Asante EA, Brandner S, et al. (2008)
Review. The origin of the prion agent of kuru: molecular and biological strain
typing. Philos Trans R Soc Lond B Biol Sci 363: 3747–3753.
26. Wadsworth JD, Joiner S, Linehan JM, Desbruslais M, Fox K, et al. (2008) Kuru
prions and sporadic Creutzfeldt-Jakob disease prions have equivalent transmis-
sion properties in transgenic and wild-type mice. Proc Natl Acad Sci U S A 105:
3885–3890.
27. Ciechanover A, Brundin P (2003) The ubiquitin proteasome system in
neurodegenerative diseases. Sometimes the chicken, sometimes the egg. Neuron
40: 427–446.
28. Lim KL (2007) Ubiquitin-proteasome system dysfunction in Parkinson’s disease:
current evidence and controversies. Expert Rev Proeomics 4: 769–781.
29. Hegde AN, Upadhya SC (2007) The ubiquitin-proteasome pathway in health
and disease of the nervous system. Trends Neurosci 30: 587–595.
30. He L, Lu XY, Jolly AF, Eldridge AG, Watson SJ, et al. (2003) Spongiform
degeneration in mahoganoid mutant mice. Science 299: 710–712.
31. Shimura H, Hattori N, Kubo S, Mizuno Y, Asakawa S, et al. (2000) Familial
Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nat Genet
25: 302–305.
32. Cummings CJ, Reinstein E, Sun YL, Antalffy B, Jiang YH, et al. (1999)
Mutation of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency
while accelerating polyglutamine-induced pathology in SCA1 mice. Neuron 24:
879–892.
33. Bertram L, Blacker D, Mullin K, Keeney D, Jones J, et al. (2000) Evidence for
genetic linkage of Alzheimer’s disease to chromosome 10q. Science 290: 2302.
34. Kristiansen M, Messenger MJ, Klohn P, Brandner S, Wadsworth JD, et al.
(2005) Disease-related prion protein forms aggresomes in neuronal cells leading
to caspase-activation and apoptosis. J Biol Chem 280: 38851–38861.
35. Goldberg AL (2007) On prions, proteasomes, and mad cows. N Engl J Med 357:
1150–1152.
36. Poser S, Mollenhauer B, Krauss A, Zerr I, Steinhoff BJ, et al. (1999) How to
improve the clinical diagnosis of Creutzfeldt-Jakob disease. Brain 122:
2345–2351.
37. Collinge J (2008) Review. Lessons of kuru research: background to recent studies
with some personal reflections. Philos Trans R Soc Lond B Biol Sci 363:
3689–3696.
38. Price AL, Patterson NJ, Plenge RM, Weinblatt ME, Shadick NA, et al. (2006)
Principal components analysis corrects for stratification in genome-wide
association studies. Nat Genet 38: 904–909.
HECTD2 in Prion Disease
PLoS Genetics | www.plosgenetics.org8 February 2009 | Volume 5 | Issue 2 | e1000383