Essential role for either TRS1 or IRS1 in human cytomegalovirus replication.

JOURNAL OF VIROLOGY, May 2009, p. 4112–4120 Vol. 83, No. 9
0022-538X/09/$08.00�0 doi:10.1128/JVI.02489-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Essential Role for either TRS1 or IRS1 in Human
Cytomegalovirus Replication�†
Emily E. Marshall,1,4 Craig J. Bierle,3,4 Wolfram Brune,6 and Adam P. Geballe1,2,4,5*
Departments of Microbiology1 and Medicine2 and Program in Molecular and Cellular Biology,3 University of Washington, Seattle,
Washington 98115; Divisions of Human Biology4 and Clinical Research,5 Fred Hutchinson Cancer Research Center, Seattle,
Washington 98109; and Division of Viral Infections, Robert Koch-Institute, Nordufer 20, 13353 Berlin, Germany6
Received 3 December 2008/Accepted 3 February 2009
Viral infections often produce double-stranded RNA (dsRNA), which in turn triggers potent antiviral
responses, including the global repression of protein synthesis mediated by protein kinase R (PKR) and 2�-5�
oligoadenylate synthetase (OAS). As a consequence, many viruses have evolved genes, such as those encoding
dsRNA-binding proteins, which counteract these pathways. Human cytomegalovirus (HCMV) encodes two
related proteins, pTRS1 and pIRS1, which bind dsRNA and can prevent activation of the PKR and OAS
pathways. HCMV mutants lacking either IRS1 or TRS1 replicate at least moderately well in cell culture.
However, as we demonstrate in the present study, an HCMV mutant lacking both IRS1 and TRS1 (HCMV[�I/
�T]) has a severe replication defect. Infection with HCMV[�I/�T] results in a profound inhibition of overall
and viral protein synthesis, as well as increased phosphorylation of eukaryotic initiation factor 2� (eIF2�). The
vaccinia virus E3L gene can substitute for IRS1 or TRS1, enabling HCMV replication. Despite the accumula-
tion of dsRNA in HCMV-infected cells, the OAS pathway remains inactive, even in HCMV[�I/�T]-infected
cells. These results suggest that PKR-mediated phosphorylation of eIF2� is the dominant dsRNA-activated
pathway responsible for inhibition of protein synthesis and HCMV replication in the absence of both IRS1 and
TRS1 and that the requirement for evasion of the PKR pathway likely explains the necessity for IRS1 or TRS1
for productive infection.
Activation of double-stranded RNA (dsRNA)-mediated
pathways contributes to the innate immune response to viral
infection. Among the genes involved in this antiviral response
are several interferon-induced genes, including those encoding
protein kinase R (PKR) and 2�-5� oligoadenylate synthetase
(OAS). After binding to dsRNA, PKR dimerizes, autophos-
phorylates, and then phosphorylates the translation initiation
factor eukaryotic initiation factor 2� (eIF2�). Phosphorylated
eIF2� inhibits guanine nucleotide exchange factor eIF2B, pre-
venting restoration of the eIF2�-tRNAMet-GTP ternary com-
plex and thus halting protein synthesis at the level of initiation
(reviewed in reference 20). OAS catalyzes the synthesis of 2�-5�
oligoadenylates, which activate latent RNase L, resulting in
degradation of single-stranded mRNA and rRNA (reviewed in
reference 44). Together, activation of the PKR and OAS path-
ways results in an antiviral environment by causing a shutdown
of protein synthesis.
Since viral replication requires protein synthesis, many vi-
ruses have had to evolve strategies for evading these dsRNA-
mediated antiviral response pathways (32, 36). For example,
the vaccinia virus (VV) E3L protein binds to dsRNA and
prevents activation of both PKR and OAS (14, 28, 50). VV
lacking E3L (VV�E3L) is sensitive to interferon, has a limited
cellular host range, and is avirulent in mice (5, 9, 51). Repli-
cation of VV�E3L in cell culture can be rescued by dsRNA-
binding proteins (dsRBPs) from other viruses (30). For exam-
ple, the dsRBPs pIRS1 and pTRS1 of human cytomegalovirus
(HCMV) can inhibit eIF2� phosphorylation and RNase L
activation, prevent the shutoff of protein synthesis, and rescue
viral replication in VV�E3L-infected human cells (17). In mu-
rine CMV (MCMV), two US22 family members, pm142 and
pm143, have functions similar to those of pIRS1 and pTRS1 in
that they rescue the replication of VV�E3L in otherwise non-
permissive cells, and together they bind to dsRNA and block
PKR activation (11, 16, 18, 48).
Deletions of individual dsRNA-binding genes have differing
consequences in MCMV and HCMV systems. Deletion of
either m142 or m143 from the MCMV genome eliminates viral
replication and results in the activation of PKR and the inhi-
bition of protein synthesis (48). Thus, both genes are essential
and likely act together as a complex (16, 18). In contrast,
neither TRS1 nor IRS1 is essential for HCMV replication.
Several viruses with deletions of IRS1 have been reported, and
each replicates as well as wild-type virus (6, 21, 31). Deletion of
TRS1 inhibits viral replication, but only by approximately 2 log
units and primarily after low multiplicity of infection (MOI)
(6). TRS1 appears to have a role in viral assembly late in
infection that accounts for the modest replication defect of the
TRS1 deletion mutant (1). Notably, deletion of TRS1 does not
appear to cause a defect in viral protein synthesis (6). There-
fore, unlike MCMV, neither of the two PKR evasion genes of
HCMV is essential.
To determine whether HCMV relies on having at least one
of the two genes, TRS1 or IRS1, for replication and mainte-
nance of protein synthesis, we constructed an HCMV mutant
lacking both genes. This double-deletion virus (HCMV[�I/
* Corresponding author. Mailing address: Division of Human Biol-
ogy, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave. N,
MS C2-023, Seattle, WA 98109-1024. Phone: (206) 667-5122. Fax:
(206) 667-6523. E-mail: ageballe@fhcrc.org.
† Supplemental material for this article may be found at http://jvi
.asm.org/.
� Published ahead of print on 11 February 2009.
4112
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

�T]) did not replicate in human foreskin fibroblasts (HF) and
was unable to prevent the shutdown of protein synthesis during
infection of wild-type HF. Infection with HCMV[�I/�T] re-
sulted in increased phosphorylation of eIF2� but no activation
of RNase L, suggesting that HCMV depends on expression of
at least one of its two known dsRBPs in order to evade the
PKR pathway.
MATERIALS AND METHODS
Cell lines. All cells were maintained at 37°C in Dulbecco’s modified Eagle
medium supplemented with 10% Nu serum (BD Biosciences) and antibiotics as
previously described (17). The pTRS1-expressing cell lines, HF-TRS1 and HF-
2.7�TRS1, were derived by transduction of HF with retroviral vectors designed
to express pTRS1 under the control of the simian virus 40 (SV40) promoter or
the HCMV 2.7� (TRL4) promoter, respectively. The plasmid vector pEQ944,
used to make HF-TRS1 cells, was constructed by inserting the HindIII fragment
from pEQ876 (25) that contains the TRS1 reading frame into the HindIII site in
LNSX (35). The 2.7� gene promoter from nucleotides �232 (relative to the first
nucleotide of the 2.7� RNA) through �44 was PCR amplified from CMV Towne
genomic DNA using primers 587 (5�-CCTTAGATCTTTCTTTTTTACATTAT
GAACGTGCCT-3�) and 588 (5�-CCTTGGATCCGGGCTTCTGGAGAACGC
CGG-3�), followed by cloning in the TOPO vector pcDNA3.1/V5-His-TOPO
(Invitrogen). The BamHI fragment containing the 2.7� promoter was then in-
serted into BamHI-digested pEQ944, replacing the SV40 promoter and gener-
ating pEQ1122. Retroviral vectors were produced by transfection of pEQ944 or
pEQ1122, along with pLGPS (34) and pMD.G (37), into 293T cells. The super-
natants were used to transduce HF, which were then selected in G418 (0.6 mg/ml,
active weight).
Construction of mutant viruses. All mutant viruses were constructed on the
basis of the AD169 bacterial artificial chromosome (BAC), which contains the
full-length genome of the HCMV AD169 strain (27). Mutagenesis by homolo-
gous recombination was performed in Escherichia coli strain DY380 essentially
as described previously (10). First, a kanamycin resistance gene (kan) flanked by
FLP recombination target (FRT) sites was PCR amplified from plasmid
pSLFRTkn (2) using oligonucleotide primers containing 50-nucleotide homologies
immediately up- and downstream of TRS1 (5�-TGACGCGGGTTTGCTTCCTA
TATAGTGGACGTCGGAGGTGTCCGGCGCCCGTGGATAGCCTTCGAA
TTC-3� and 5�-TTGTAAAACAAGTTTTCGAAACATAACGACAGCTGCAAAA
GAAAACCAGTAGGACGACGACGACAAGTAA-3�) (homologies are shown
in italics). The PCR product was then used to replace the TRS1 gene by homol-
ogous recombination. The kan gene was subsequently removed with FLP recom-
binase as described previously (10). To obtain HCMV[�I/�T] lacking IRS1 and
TRS1, the IRS1 gene was replaced by a zeocin resistance gene in a fashion similar
to that described above for TRS1. The following PCR primers were used: 5�-T
GACGCGGGTTTGCTTCCTATATAGTGGACGTCGGAGGTGTCCGGCGC
CCGAATTCAGTCCTGCTCCTCGGCCA-3� and 5�-CAAGCGGAGAACGAC
AGCACGTCCTGACAACATATGGACTGGAGAGACTTGTTGACAATTAAT
CATCGGCAT-3�. To reinsert TRS1, the FRT-flanked kan gene was excised with
EcoRI from pSLFRTkn and inserted into pcDNA-TRS1-HA (48) behind the
TRS1 open reading frame. TRS1-hemagglutinin (HA) and the kan cassette were
then PCR amplified with primers containing homologies up- and downstream of
TRS1 as described above, and the linear PCR product was used for homologous
recombination. The kan gene was subsequently removed with FLP recombinase.
For construction of the HCMV[E3L] BAC, the VV E3L gene driven by an
HCMV immediate-early (IE) promoter was excised with BglII and NotI from
pCINeo-E3L (23) (kindly provided by Mariano Esteban, Centro Nacional de
Biotecnología, Madrid, Spain) and inserted between the BamHI and NotI sites
of pOri6k-Kan, a 1.6-kb plasmid consisting of a lambda �-dependent R6K origin
of replication, a kan gene, a single FRT site, and a multiple cloning site (7)
(kindly provided by Martin Messerle, Hannover Medical School, Hannover,
Germany). The resulting plasmid, pOri6k-CMVE3L, was electroporated into E.
coli carrying the HCMV[�I/�T] BAC, together with pCP20, a plasmid expressing
FLP recombinase (15). This resulted in a FLP-mediated insertion of the entire
pOri6K-CMVE3L plasmid into the HCMV[�I/�T] BAC.
Virus production. BAC DNA was purified from E. coli using the NucleoBond
BAC maxi kit (BD Biosciences) following the manufacturer’s protocol. Virus was
produced by electroporation into HF or HF-2.7�TRS1. Briefly, confluent
150-mm dishes of cells were trypsinized, pelleted, and resuspended in a 260-�l
total volume of medium containing 100 �g of BAC DNA and 2 �g of a plasmid
encoding Cre (pPGKCrebpA, obtained from J. Cooper, Fred Hutchinson Cancer
Research Center [FHCRC]) and 2 �g of a pp71 expression plasmid (pBJ203,
obtained from Bonita Biegalke, Ohio University). Electroporation was done in
0.4-cm cuvettes using a Bio-Rad Gene Pulser II at 260 V and 950 �F. The cells
were then transferred to 100-mm dishes and split when confluent. Viruses were
subjected to two rounds of plaque purification. HCMV[AD169] (ATCC),
HCMV[TRS1-HA], and HCMV[E3L] were propagated and their titers were
determined in HF. HCMV[�I/�T] was grown and its titer was determined in
HF-TRS1. VVs (VC2) (47) and VV�E3L (4) were propagated in BHK cells.
DNA analyses. BAC DNA was digested with EcoRI, separated on 0.6% aga-
rose gels, and stained with SYBR green II (Molecular Probes). HCMV DNA,
purified from infected HF by lysis with 2% sodium dodecyl sulfate (SDS),
followed by digestion with proteinase K and ethanol precipitation, was digested
with KpnI, separated on 0.5% agarose gels, transferred to nitrocellulose, and
analyzed by Southern blotting with a probe specific to the region downstream of
TRS1. The probe was constructed by PCR of HCMV[AD169] DNA using prim-
ers 688 (GCTCCCGATGGAGAGCCC) and 689 (TCGGACCCATCGCCCC)
to amplify the genomic region from nucleotides 225876 to 226112 (accession no.
NC_001347).
Viral infections. HF or HF-TRS1 were infected with HCMV at MOIs ranging
from 0.1 to 5 PFU/cell, depending on the experiment. Except where otherwise
indicated, infections were done using spin inoculation, in which virus was diluted
in medium sufficient to cover the cells and the plates were centrifuged at 700 g for
30 min at 7°C. The plates were then incubated at 37°C for an additional 30 min,
after which the inoculum was aspirated and fresh medium was added. For viral
production experiments, duplicate wells of HF or HF-TRS1 were infected with-
out spin inoculation, virus in the medium was collected daily, and its titer was
determined using HF-TRS1 cells. For VV infections, HF were infected at an
MOI of 2 as previously described (19).
Immunoblot analyses. At the indicated times postinfection (p.i.), cells were
washed with phosphate-buffered saline (PBS) and lysed with 2% SDS. Cellular
and viral DNAs were sheared in a Bransonic bath sonicator, and protein con-
centrations were determined by fluoraldehyde o-phthalaldehyde (Pierce) assay
(24). Equivalent amounts of lysate were denatured, separated on SDS-poly-
acrylamide gel electrophoresis (PAGE) gels, and transferred to polyvinylidene
difluoride membranes (GE Life Sciences) by electroblotting. Total and phospho-
eIF2� were detected using phosphospecific or total eIF2� rabbit polyclonal
antibodies (no. 9721 and 9722, both at 1:1,000; Cell Signaling Technology) and
the Western Star chemiluminescence detection system (Tropix, Inc.) according
to the manufacturers’ recommendations. Viral protein levels were assessed using
IE1 mouse monoclonal antibody (1:1,000; NEN), UL44 mouse monoclonal an-
tibody (1:15,000; Virusys CA006-100), pp65 mouse monoclonal antibody (1:
20,000; Virusys CA003-100), and pIRS1/pTRS1 rabbit polyclonal antiserum
�p999 directed against amino acids 74 to 248 of TRS1 (1:1,000; see the supple-
mental material). Actin was detected using actin-specific antibody (1:1,000;
Sigma A-2066).
Immunofluorescence. HF were seeded into 12-well plates containing glass
coverslips. The cells were infected at an MOI of 5 as described above. The
coverslips were rinsed with PBS, fixed with 4% formaldehyde in PBS for 30 min
at 4°C, and rinsed three times with PBS. The cells were permeabilized with 0.5%
Triton X-100 (Sigma) in PBS, rinsed, and then blocked using 3% bovine serum
albumin (BSA) in PBS for 30 min at room temperature (RT) and rinsed. The
coverslips were incubated with J2 mouse monoclonal antibody (1:1,000 in 3%
BSA in PBS; English and Scientific Consulting) or isotype-matched �-galactosi-
dase mouse monoclonal antibody (Promega; Z378A) for 30 min at RT and rinsed
three times in PBS before being stained with fluorescein isothiocyanate-labeled
goat anti-mouse antibody (1:1,000 in 3% BSA in PBS) for 30 min at RT. Hoechst
no. 33342 (5 �g/ml; Invitrogen) was used to stain nuclei. RNase treatments were
completed after the blocking step using 8 U/ml ShortCut RNase III (New
England Biolabs; M0245S) in the manufacturer-supplied buffer or 50 �g/ml
RNase A (Sigma; R5503) in either 0.1 SSC (1 SSC is 0.15 M NaCl plus 0.015
M sodium citrate) (low salt) or 2 SSC (high salt). After the addition of RNase,
the coverslips were incubated at 37°C for 1 h before being washed with PBS and
stained with J2 as described above. Ganciclovir (30 �M/ml; Syntex) was added at
1 h p.i. and remained on the cells throughout infection.
RNA analysis. Whole-cell RNA was harvested using TRIzol Reagent (Invitro-
gen), resolved on 1% formaldehyde agarose gels, and transferred to nitrocellu-
lose. Northern blot hybridization was carried out using an 18S rRNA-specific
probe as described previously (17).
Radiolabeling of virus-infected cells. At 2, 24, 48, or 72 h post-HCMV infec-
tion, HF were pulse-labeled with Tran[35S]label (50 �Ci/ml; Perkin-Elmer) in
medium lacking methionine and cysteine for 1 h. The cells were then washed and
lysed in 2% SDS. Equivalent amounts of each lysate were separated by SDS-
PAGE, and the gels were dried and visualized by autoradiography.
VOL. 83, 2009 REQUIREMENT FOR pIRS1 OR pTRS1 IN HCMV REPLICATION 4113
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

RESULTS
Construction of viral mutants. IRS1 and TRS1 encode pro-
teins that bind to dsRNA and PKR, preventing the activation
of PKR and subsequent phosphorylation of eIF2� (17, 26). In
the context of VV infection, either gene can also substitute for
E3L in blocking activation of the RNase L pathway and enable
productive viral infection in human cells (17). Also, they each
can rescue replication of HSV�
34.5 (12). However, these
observations do not clarify which, if any, of the functions as-
sociated with these proteins are important during HCMV rep-
lication. The ability of viruses lacking either IRS1 or TRS1 to
replicate in cell culture without any observed defects in viral-
protein synthesis might be due to functions provided by the
member of the pair that is still present in these single-deletion
mutants. Thus, in order to evaluate the role of the shared
activities of IRS1 and TRS1 during HCMV infection, we
needed to construct an HCMV mutant virus in which both
genes were deleted.
Using the AD169 BAC system (27), we first constructed a
mutant virus genome lacking both IRS1 and TRS1 (HCMV[�I/
�T]) and then a repair virus in which we inserted an HA-
tagged TRS1 gene (HCMV[TRS1-HA]) back into the genome
at the TRS1 locus as described in Materials and Methods (Fig.
1A). We also introduced the E3L gene, under the control of
the HCMV major IE promoter, into the HCMV[�I/�T] BAC
(HCMV[E3L]). To confirm the structures of the various BAC
constructs, we first analyzed EcoRI-digested BAC DNA (Fig.
1B). Consistent with predictions, EcoRI digestion of HCMV
[AD169] BAC DNA resulted in 8.8-kb and 11.3-kb fragments
containing IRS1 and TRS1, respectively (Fig. 1B, lane 1). Re-
FIG. 1. Characterization of viral mutants. (A) Depiction of HCMV genomes used in this study. The HCMV genome contains unique long (UL)
and unique short (US) segments flanked by inverted repeats. A zeocin gene cassette (Zeo), were inserted into the IRS1 locus. HCMV[�I/�T],
constructed from an AD169 BAC, was used to construct repair viruses encoding TRS1 (HCMV[TRS1-HA]) and E3L (HCMV[E3L]), as described
in Materials and Methods. Relevant KpnI sites are indicated, and the position of the probe (Pb; double line) used in panel C is shown. Also shown
are FRT sites (arrowheads), the HCMV major IE promoter (Pr), and the R6K plasmid origin and kan sequences (rk). (B) BAC DNA was digested
with EcoRI, electrophoretically separated, and detected using SYBR green to confirm the genomic structures. (C) Viral DNA was purified from
infected HF or HF-TRS1 (HCMV[�I/�T]), digested with KpnI, separated by gel electrophoresis, and examined by Southern blotting using a
32P-labeled probe specific for the genomic region downstream of TRS1 (marked in panel A). (D) Lysates from mock-infected or HCMV-infected
HF (MOI � 3) were prepared at 6 and 48 h p.i., separated by SDS-PAGE, and immunoblotted using �p999 antiserum specific for pIRS1 and
pTRS1 (top) and for pp65 (bottom).
4114 MARSHALL ET AL. J. VIROL.
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

placement of IRS1 with the zeocin cassette containing an
EcoRI site resulted in loss of the 8.8-kb band and generation of
two bands at 4.3 kb and 2.5 kb. Deletion of TRS1 in HCMV[�I/
�T] and reintroduction of the E3L gene in HCMV[E3L] were
predicted to eliminate an 11.3-kb band and produce new bands
at �4.0 kb and �4.5 kb, respectively. These bands were not
clearly resolved from other bands in the same size range. Other
than these expected alterations, the EcoRI fragments ap-
peared the same among the various BAC DNAs, as expected.
We transfected BAC DNA into HF to reconstitute the in-
fectious viruses. The wild-type AD169 virus used in these ex-
periments was obtained from the ATCC (VR-538) and was not
BAC derived. For the mutants, we electroporated HF with
BAC DNA, along with plasmids encoding Cre (to excise the
bacterial sequences) and HCMV pp71 (pUL82, to enhance
infectivity of viral DNA) (3). We were unsuccessful at produc-
ing infectious HCMV[�I/�T] following transfection into wild-
type HF, so we constructed complementing cell lines by trans-
ducing HF with either of two retroviral vectors designed to
express pTRS1 from the SV40 promoter or the HCMV 2.7�
(TRL4) promoter. Using the latter cells, we succeeded in gen-
erating virus from the HCMV[�I/�T] BAC. However, since
the HF-2.7�TRS1 cell line did not grow well, we used the SV40
promoter-driven pTRS1-expressing HF (HF-TRS1) for subse-
quent preparation of viral stocks and experiments.
We purified viral DNA from infected cells and performed
Southern blotting to confirm the genomic structure (Fig. 1C).
Probing for sequences just downstream from the TRS1 coding
sequence yielded the expected KpnI 8.4-kb band from AD169
and HCMV[TRS1-HA] DNA. HCMV[�I/�T] virus produced
a band of 6 kb, consistent with the removal of approximately
2.5 kb during the deletion of TRS1. HCMV[E3L] yielded the
expected band of about 800 bp due to an additional KpnI site
introduced with the E3L gene. We also examined the region
around IRS1 by PCR to further confirm the viral structure
(data not shown).
Using a rabbit antiserum directed against an identical region
in the N terminus of pTRS1 and pIRS1, we tested for expres-
sion of these proteins in cells infected for 6 and 48 h with the
various viruses. As expected, wild-type HCMV produced
both pTRS1 and pIRS1, while HCMV[TRS1-HA] produced
only pTRS1 (Fig. 1D). We detected no expression of pIRS1 or
pTRS1 in cells infected with HCMV[�I/�T] or HCMV[E3L],
although the antiserum detected a faint background band even
in mock-infected HF. As a control to verify that each of the
viruses infected the cells in this experiment, we also monitored
pp65 (UL83) expression by immunoblot assay of the same
lysates. pp65 was detected in each of the infected cell lysates at
6 h p.i., reflecting its delivery to cells by virions. In combina-
tion, these studies indicated that the viruses had the expected
genomic structures.
Growth characteristics of HCMV[�I/�T]. We next investi-
gated the growth properties of the wild-type and mutant vi-
ruses in cell culture. We infected both HF and HF-TRS1 at a
low MOI (0.1 PFU/cell) and analyzed virus production over
time by determining the titer of the virus in the medium using
HF-TRS1 (Fig. 2). We detected no infectious HCMV[�I/�T]
at any time during 7 days of infection of HF. The repair virus,
HCMV[TRS1-HA], grew to titers similar to those of wild-type
AD169, indicating that pTRS1 expression is sufficient for wild-
type replication properties, consistent with previous reports of
wild-type growth of several IRS1-only deletion viruses (6, 21,
31). Interestingly, the VV E3L gene could substitute for dele-
tion of IRS1 and TRS1. However, HCMV[E3L] production
was slightly lower than that of wild-type AD169 at 5 to 7 days
p.i., suggesting that pE3L may not be sufficient for full-scale
virus production. The restoration of replication in HCMV[TRS1-
HA] and HCMV[E3L] also argues that the replication defect
of HCMV[�I/�T] is due to the deletion of the TRS1 and IRS1
genes and not to an undetected second-site mutation.
HCMV[�I/�T] did replicate in HF-TRS1 (Fig. 2B) but pro-
duced several log units less progeny than the other viruses.
Among the possible explanations was that the pTRS1 ex-
pressed in these cells was not very active in blocking PKR-
mediated translational repression. However, VV�E3L replica-
tion was enhanced �30-fold in these cells compared to
wild-type HF (data not shown), indicating that the pTRS1
expressed in HF-TRS1 was efficient at blocking the PKR re-
sponse against VV�E3L, at least. An alternative explanation
for the low level of HCMV[�I/�T] replication was that the
abundance of pTRS1 in the complementing cells may be lower
than the levels produced during wild-type virus infections. In-
vestigation of this possibility by immunoblot assay revealed
that pTRS1 abundance in HF-TRS1 was generally less than
that present late after wild-type HCMV infection of HF (data
not shown). However, these results were somewhat variable,
and we do not yet know whether the abundance of pTRS1 or
another parameter, such as the timing of its expression or
FIG. 2. Replication of viral mutants. HF (A) or HF-TRS1 (B) were
infected with wild-type AD169 HCMV or mutant viruses (MOI � 0.1).
The mean (
SD) virus titer in the medium was determined on HF-
TRS1. Infections were done in duplicate and are representative of
three experiments. ND, none detected in 0.2 ml.
VOL. 83, 2009 REQUIREMENT FOR pIRS1 OR pTRS1 IN HCMV REPLICATION 4115
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

localization in the complementing cells, is suboptimal for full-
scale viral production of HCMV[�I/�T] in HF-TRS1.
dsRNA accumulation during HCMV infection. The obser-
vation that deletion of both known dsRBP genes of HCMV
eliminated viral replication in wild-type HF suggests that either
IRS1 or TRS1 is necessary to block dsRNA-activated antiviral
pathways. To test the prediction of this hypothesis that dsRNA
is in fact produced during HCMV infection, we infected HF
with HCMV[AD169] and tested for dsRNA by immunofluo-
rescence assays using a well-characterized dsRNA-specific
monoclonal antibody, J2 (11, 46, 49), as described in Materials
and Methods. As shown in Fig. 3A, we detected J2 reactivity in
infected cells by 24 h p.i. In contrast, we observed only a small
amount of background fluorescence in mock-infected cells or
in infected cells stained with an isotype-matched control anti-
body. Consistent with the absence of detectable dsRNA at 7 h
p.i. (Fig. 3A), we did not detect any dsRNA after infection in
the presence of cycloheximide (data not shown), suggesting
that it is not delivered with virions or produced by IE tran-
scription. The intensity of the immunofluorescence was not
substantially altered by ganciclovir treatment, indicating that
late-gene expression is not required for dsRNA production.
We used RNase III and RNase A digestions to evaluate the
specificity of the J2 antibody for dsRNA in this setting (Fig.
3B). RNase III eliminated most of the immunofluorescence
signal, consistent with its being primarily due to the presence
of dsRNA. RNase A is generally considered to be a single-
strand-specific RNase, but it can digest dsRNA under low-salt
conditions (38). Thus, the loss of immunofluorescence signal
under low-salt but not high-salt RNase A conditions further
supports the conclusion that HCMV infection generates
dsRNA. A similar pattern of accumulation of dsRNA was
detected in cells infected with HCMV[�I/�T] (Fig. 3C). These
data demonstrate that dsRNA is produced by 24 h post-
HCMV infection, and its presence may explain the require-
ment for the dsRBPs pTRS1 and pIRS1 for HCMV replica-
tion.
Protein synthesis shutdown during HCMV[�I/�T] infec-
tion. Since dsRNA is produced during HCMV infection, we
next investigated the hypothesis that the severe growth defect
of HCMV[�I/�T] might be due to unopposed activation of
dsRNA-activated pathways, resulting in inhibition of global
protein synthesis. Therefore, we infected HF at an MOI of 3
and labeled newly made proteins with [35S]methionine at sev-
eral time points (Fig. 4). We detected a nearly complete shut-
down of protein synthesis between 24 and 48 h p.i. in HF
infected with HCMV[�I/�T]. In contrast, protein synthesis was
maintained in cells infected with HCMV[AD169], as well as
HCMV[TRS1-HA], albeit at somewhat lower levels than in
mock-infected cells. Additionally, protein synthesis continued
in HF infected with HCMV[E3L] at levels similar to those
infected with HCMV[AD169] (data not shown).
Although we observed a generalized shutoff of protein syn-
thesis in HCMV[�I/�T]-infected cells, it remained possible
that viral protein synthesis was relatively preserved. Many
other viruses repress overall protein synthesis but divert the
remaining translational capacity toward making viral proteins
at the expense of cellular proteins. Therefore, we analyzed
expression of a subset of HCMV proteins of differing kinetic
classes after infection with our wild-type and mutant viruses
(Fig. 5). First, we monitored viral entry by assessing the intra-
cellular abundance of the tegument protein pp65 by immuno-
blot assay. Similar to the results shown in Fig. 1D, all infected
cells contained similar levels of pp65 at 2 h p.i., suggesting that
each of the viruses, including HCMV[�I/�T], entered cells
with comparable efficiencies (Fig. 5A). The abundance of the
IE transcriptional activator IE1 (pUL123) was slightly lower in
cells infected with HCMV[�I/�T] than in those infected with
HCMV[AD169] and HCMV[TRS1-HA] at 24 h p.i. and re-
mained lower at 48 h p.i. Consistent with the major reduction
in overall protein synthesis between 24 and 48 h (Fig. 4),
during which time early-late proteins accumulate, we detected
substantially less of the early-late protein pUL44 in cells in-
fected with HCMV[�I/�T] at 48 h but not at 24 h p.i. Also,
note that pp65 accumulation was markedly reduced by 48 h p.i.
with HCMV[�I/�T] (Fig. 1D). Thus, synthesis of both viral
and cellular proteins is markedly inhibited when neither pIRS1
nor pTRS1 is present, consistent with there being a critical role
for these dsRBPs in maintaining protein synthesis during
HCMV infection.
Phosphorylation of eIF2� during HCMV[�I/�T] infection.
The shutoff of protein synthesis after HCMV[�I�T] infection
FIG. 3. dsRNA production during HCMV infection. HF were
mock infected or infected with HCMV at an MOI of 5 without (A and
B) or with (C) spin inoculation and stained with the dsRNA-specific J2
antibody or an isotype control antibody, as described in Materials
and Methods. Nuclei were stained using Hoechst no. 33342.
(A) HCMV[AD169]-infected HF were stained using J2 at 7, 24, or 48 h
p.i. (top rows) or an isotype control antibody (bottom row). Mock-
infected and infected cells were also treated with ganciclovir, prevent-
ing viral late protein synthesis, and stained at 48 h p.i. (right). (B) HF
infected with HCMV[AD169] for 48 h were digested with dsRNA-
specific RNase III (left) or RNase A under low-salt (center) and
high-salt (right) conditions before being stained with J2. RNase A is
specific for single-stranded RNA under high-salt conditions (38).
(C) HF were mock infected or infected with HCMV[AD169] (center)
or HCMV[�I/�T] (right) and stained with J2 at 48 h p.i.
4116 MARSHALL ET AL. J. VIROL.
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

could be the result of dsRNA activation of the PKR pathway,
the OAS pathway, or both. In the context of VV infection,
pTRS1 and pIRS1 are capable of blocking both pathways (17),
but those observations do not reveal whether both, one, or
neither of the pathways is targeted in the context of HCMV
infection.
We first investigated whether HCMV[�I/�T] infection acti-
vates the PKR pathway by monitoring the level of eIF2� phos-
phorylation. By immunoblot assay, we observed increased lev-
els of eIF2� phosphorylation in cells infected with HCMV[�I/
�T] by 24 h p.i. and continuing until at least 48 h p.i. (Fig. 5).
The levels of phospho-eIF2� in HCMV[AD169]- and HCMV
[TRS1-HA]-infected cells were similar to those in mock-in-
fected cells, and total eIF2� levels were similar in all lysates.
The phosphorylation of eIF2� by 24 h p.i. in HCMV[�I/�T]-
infected cells is consistent with the shutoff of protein synthesis
we observed beginning between 24 and 48 h p.i. Thus, is seems
likely that eIF2� phosphorylation contributes to the shutdown
of translation after infection with HCMV[�I/�T] and that
pTRS1 is able to prevent this outcome.
Prevention of RNase L-mediated RNA degradation does not
require pTRS1 expression. The detection of elevated levels of
eIF2� phosphorylation does not exclude a possible contribu-
tory role for the OAS/RNase L pathway in the shutoff of
protein synthesis in cells infected with HCMV[�I/�T]. Infec-
tion with VV�E3L results in activation of RNase L, and coin-
fection with HCMV or expression of pE3L, pTRS1, or pIRS1
eliminates this phenotype (17, 19), thus revealing that these
HCMV dsRBPs are able to block activation of the OAS/RNase
L pathway.
To evaluate the role of RNase L in the protein-synthetic
defect in cells infected with HCMV[�I/�T], we assessed the
integrity of the 18S rRNA by Northern blot assay of RNA
isolated from mock-infected and virus-infected cells (Fig. 6).
Consistent with previous results using HCMV Towne (19), 18S
rRNA remained intact in mock-infected cells and cells infected
for 48 h with HCMV[AD169], HCMV[TRS1-HA], and
HCMV[E3L]. Interestingly, the 18S rRNA also remained in-
FIG. 4. Protein synthesis in HF infected with HCMV mutants. HF were mock infected or infected with the indicated virus (MOI � 3) and
labeled for 1 h with [35S]methionine at the indicated times p.i. Cell extracts were prepared as described in Materials and Methods and analyzed
by SDS-PAGE and autoradiography. Molecular mass markers (kDa) are shown on the left.
FIG. 5. Specific protein synthesis is affected during HCMV[�I/�T]
infection. HF were mock infected or infected (MOI � 3) with HCMV
[AD169], HCMV[TRS1-HA], or HCMV[�I/�T], and lysates were pre-
pared at 2, 24, and 48 h p.i., as shown, and analyzed by immunoblot-
ting. (A) To confirm viral entry, lysates were analyzed at 2 h p.i. using
pp65. (B) Levels of other viral and cellular proteins were analyzed at
24 and 48 h p.i. eIF2�-P, phosphorylated eIF2�.
VOL. 83, 2009 REQUIREMENT FOR pIRS1 OR pTRS1 IN HCMV REPLICATION 4117
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

tact in HCMV[�I/�T]-infected cells. Thus, at a time when
overall protein synthesis is markedly inhibited due to lack of
TRS1 and IRS1 and when dsRNA has been produced, RNase
L remains inactive.
DISCUSSION
To counteract viral infection, cells activate a variety of an-
tiviral responses. One of the major arms of the innate immune
response is the interferon system, induction of which results in
the expression of multiple antiviral genes and creation of an
environment hostile to viral replication. Two of these antiviral
genes, PKR and OAS, produce proteins that are activated by
binding to dsRNA and trigger pathways that shut down general
protein synthesis and viral replication. Since viral replication
depends on continued protein synthesis, many viruses have
evolved genes that inhibit the PKR and OAS pathways. In fact,
these viral evasion factors appear to have exerted intense evo-
lutionary pressure on the host antiviral genes, as illustrated by
a remarkably strong signature of positive selection in the PKR
gene among vertebrates (22, 42).
Viral genes involved in evading innate immune responses
are known to target a variety of steps in these pathways. In the
case of the PKR pathway, one common viral strategy is the
expression of proteins that bind to dsRNA and to PKR and
thereby interfere with PKR homodimerization or kinase activ-
ity. Among herpesviruses, the Us11 gene of herpes simplex
virus type 1 (HSV-1) (39, 40), TRS1 and IRS1 of HCMV (25,
26), and the combination of m142 and m143 in MCMV (11, 16,
18) act in this fashion. Less is known about viral inhibitors of
the OAS pathway, but direct binding to dsRNA and OAS may
be important, at least for HSV Us11 function (43).
That HCMV IRS1 and TRS1 share several functions is not
surprising, since they are found in the inverted repeats flanking
the unique short region of the genome and are identical over
their N-terminal 549 codons. The C-terminal regions diverge,
but even these regions are �35% identical. The first reported
activity of these genes was the ability of each to act as a
coactivator of reporter gene expression in transfection assays
when combined with transcriptional activators IE1 and IE2
(41, 45). We showed that their dsRNA-binding activities map
to a region within the identical N-termini (25), with PKR
binding dependent on divergent C-terminal sequences (26).
Each protein binds to PKR, blocks activation of the PKR and
OAS/RNase L pathways resulting from infection by VV�E3L,
and causes relocalization of PKR to the nucleus (17, 26). Both
genes can also rescue replication of VV�E3L and of HSV-1
lacking
34.5 (13).
In contrast to these shared activities, TRS1 and IRS1 have
been reported to have properties distinct from each other.
Romanowski and Shenk described a carboxy-terminal 263-
amino-acid product of IRS1 that represses the reporter gene-
activating function (41). Deletion of TRS1 attenuates viral
growth, particularly during low-MOI infection, a phenotype
associated with a late assembly defect (1, 6); this phenotype is
not detected with IRS1 deletion viruses. Other than these dif-
ferences, the significance of HCMV containing two highly re-
lated genes with many redundant functions is not yet known.
We hypothesized that the ability of HCMV containing single
deletions of either IRS1 or TRS1 to replicate without any
apparent defects in protein-synthetic capacity might be due to
the ability of the remaining member of the pair to block one or
more of the dsRNA-activated pathways. To test this hypothe-
sis, we constructed a virus lacking both proteins. After our
initial attempts to produce HCMV[�I/�T] from the corre-
sponding BAC by transfection into normal HF or complement-
ing HF transduced with a retrovirus expressing TRS1 under the
control of the SV40 promoter were unsuccessful, we generated
an HF line transduced with a retroviral vector in which the
strong HCMV 2.7� promoter regulated TRS1 expression, hop-
ing that we might avoid potential toxicity from constitutive
expression of pTRS1 but achieve a high level of induction of
TRS1 in infected cells. Although this strategy proved to be
successful for reconstituting HCMV[�I/�T], immunoblot as-
says suggested that the level of pTRS1 expression in the 2.7�-
TRS1 cells was not substantially different from that in the
SV40-TRS1 cells (data not shown). Thus, our data are incon-
clusive about whether use of the 2.7� promoter might be a
generally applicable tool for complementing HCMV mutants
in trans.
The complementing cells, HF-TRS1, supported the replica-
tion of HCMV[�I/�T] but did not completely rescue its rep-
lication to wild-type levels. HF-TRS1 cells infected with
HCMV[�I/�T] synthesized proteins at a rate similar to those
infected with HCVM[AD169] at least as late as 72 h p.i. (data
not shown), suggesting that the pTRS1 produced in the HF-
TRS1 was sufficient to prevent the shutdown of protein syn-
thesis at least up to that time point. We suspect that altered
abundance, kinetics of expression, and/or subcellular localiza-
tion of pTRS1 in the infected complementing cells is not op-
timal for the virion assembly function of pTRS1.
HCMV[�I/�T] does not replicate at all in wild-type HF,
likely as a result of the profound shutoff of protein synthesis
that is most evident in comparisons of metabolically labeled
cells at 24 and 48 h p.i. (Fig. 4). This timing is quite consistent
with our observation that dsRNA accumulates and eIF2� be-
comes phosphorylated in HCMV-infected cells by 24 h p.i.
(Fig. 3 and 5). A similar pattern of dsRNA accumulation and
eIF2� phosphorylation occurs during infection with MCMV
lacking either m142 or m143 or both (11, 48). Although the
FIG. 6. RNase L is not activated during HCMV infection. HF were
mock infected or infected with HCMV (MOI � 5) or VV (MOI � 2).
At 24 h p.i. (VV) or 48 h p.i. (HCMV), RNA was harvested, and 1 �g
of each sample was analyzed by Northern blot hybridization using a
32P-labeled 18S rRNA-specific probe.
4118 MARSHALL ET AL. J. VIROL.
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

nature of the dsRNAs expressed during infections by these and
other large DNA viruses is not yet known, it has been postu-
lated that polyadenylation at the normal sites becomes ineffi-
cient at late times p.i. and results in long transcripts from both
strands of the genome that can anneal and trigger dsRNA-
activated pathways (reviewed in reference 29). Our data are
consistent with this idea, except that we found that the accu-
mulation of dsRNA occurs even in the presence of ganciclovir,
suggesting that late-gene expression is not essential. Alterna-
tively, in the case of viruses like HCMV that have GC-rich
genomes, normal viral transcripts may assume enough second-
ary structure to mimic dsRNA and activate the antiviral re-
sponse pathways.
Our analyses of HCMV[E3L] bolster the conclusion that the
requirement that HCMV contain either TRS1 or IRS1 is ex-
plained by the need to block cytoplasmic dsRNA-activated
antiviral response pathways. The observation that HCMV lack-
ing TRS1 but containing IRS1 has only a modest replication
defect (6) might be explained by pIRS1 being able to comple-
ment in part an essential role for pTRS1 in virion assembly.
However, it seems quite unlikely that pE3L functions directly
in HCMV assembly. Rather, the well-established role of pE3L
in blocking dsRNA-activated pathways is the more plausible
explanation for its rescuing replication of HCMV[�I/�T]. In
previous studies, we showed that pIRS1 and pTRS1, but not
pE3L, cause PKR accumulation in the nucleus (26). The ability
of HCMV[E3L] to replicate quite efficiently therefore suggests
that nuclear accumulation of PKR is not critical for HCMV
replication, although additional experiments need to be done
to evaluate the localization of PKR after infection with
HCMV[E3L].
Beside the PKR-mediated response, another major arm of
the dsRNA-mediated antiviral response is the activation of
OAS, leading to activation of RNase L and subsequent cleav-
age of mRNA and rRNA. OAS is strongly induced immedi-
ately upon HCMV infection; in fact, binding of the viral en-
velope protein glycoprotein B is sufficient to induce OAS
expression (8). Since wild-type HCMV infection did not result
in RNase L activation and pTRS1 or pIRS1 is able to block
RNase L activation by VV�E3L infection, we expected that
blocking the OAS pathway might be another important func-
tion of pTRS1 and pIRS1. However, our data demonstrate that
even after infection with HCMV[�I/�T], RNase L is not acti-
vated. This result might be due to expression of another inhib-
itor of the pathway. Other members of the US22 gene family
bind dsRNA (reference 18 and unpublished data), and one of
them might block OAS/RNase L activation during HCMV[�I/
�T] infection. Similarly, MCMV infection does not result in
RNase L activation, regardless of whether it contains its
dsRBP genes, m142 and m143, suggesting that the dsRNAs
produced during infection by CMVs may not be sufficiently
abundant or correctly localized to activate this pathway (11).
Although TRS1 and IRS1 appear not to be needed to block
RNase L under the conditions we used here, it remains possi-
ble that their ability to block the pathway plays a role in other
cell types or under other conditions.
Many viruses encode multiple proteins for evading the
dsRNA-mediated antiviral response, but HCMV is unusual in
that the genes appear to be redundant in this respect. In the
most closely related virus studied thus far, MCMV, two genes
are also present, but they act together, and deletion of either
one blocks viral replication (18, 48). VV and HSV-1 each also
have at least two genes involved in evading the dsRNA re-
sponses, but in both cases, the genes act at different steps in the
PKR pathway (36). In the case of VV, the two genes may be
functionally important in alternative cell types (33). Regard-
less, our research has now established that HCMV depends on
having at least one of two dsRNA-binding, PKR-binding pro-
teins that can prevent eIF2� phosphorylation and maintain
protein synthesis. By analogy to genes with similar functions in
other viruses, it is very likely that these proteins play a vital role
in pathogenesis during infection of humans, and understanding
the mechanism may have implications for new antiviral strat-
egies and vaccine design.
ACKNOWLEDGMENTS
We thank Katherine DeNiro, Morgan Hakki, and the Genomics
Core Facility of the Fred Hutchinson Cancer Research Center for
technical assistance. We are grateful to Bonita Biegalke (Ohio Uni-
versity), Jon Cooper (FHCRC), Dusty Miller (FHCRC), Martin Mes-
serle (MHH Hannover), and Mariano Esteban (CNB Madrid) for
plasmids and to Bertram Jacobs (Arizona State University) for vac-
cinia viruses.
This work was supported by NIH grant AI26672 (to A.P.G.) and
DFG grant BR 1730/3-1 (to W.B.). E.E.M. was supported by NIH
grant T32 CA09929.
REFERENCES
1. Adamo, J. E., J. Schroer, and T. Shenk. 2004. Human cytomegalovirus TRS1
protein is required for efficient assembly of DNA-containing capsids. J. Vi-
rol. 78:10221–10229.
2. Atalay, R., A. Zimmermann, M. Wagner, E. Borst, C. Benz, M. Messerle, and
H. Hengel. 2002. Identification and expression of human cytomegalovirus
transcription units coding for two distinct Fc
receptor homologs. J. Virol.
76:8596–8608.
3. Baldick, C. J., Jr., A. Marchini, C. E. Patterson, and T. Shenk. 1997. Human
cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity
of viral DNA and accelerates the infectious cycle. J. Virol. 71:4400–4408.
4. Beattie, E., K. L. Denzler, J. Tartaglia, M. E. Perkus, E. Paoletti, and B. L.
Jacobs. 1995. Reversal of the interferon-sensitive phenotype of a vaccinia
virus lacking E3L by expression of the reovirus S4 gene. J. Virol. 69:499–505.
5. Beattie, E., E. B. Kauffman, H. Martinez, M. E. Perkus, B. L. Jacobs, E.
Paoletti, and J. Tartaglia. 1996. Host-range restriction of vaccinia virus
E3L-specific deletion mutants. Virus Genes 12:89–94.
6. Blankenship, C. A., and T. Shenk. 2002. Mutant human cytomegalovirus
lacking the immediate-early TRS1 coding region exhibits a late defect. J. Vi-
rol. 76:12290–12299.
7. Borst, E. M., and M. Messerle. 2005. Analysis of human cytomegalovirus
oriLyt sequence requirements in the context of the viral genome. J. Virol.
79:3615–3626.
8. Boyle, K. A., R. L. Pietropaolo, and T. Compton. 1999. Engagement of the
cellular receptor for glycoprotein B of human cytomegalovirus activates the
interferon-responsive pathway. Mol. Cell. Biol. 19:3607–3613.
9. Brandt, T. A., and B. L. Jacobs. 2001. Both carboxy- and amino-terminal
domains of the vaccinia virus interferon resistance gene, E3L, are required
for pathogenesis in a mouse model. J. Virol. 75:850–856.
10. Brune, W., M. Nevels, and T. Shenk. 2003. Murine cytomegalovirus m41
open reading frame encodes a Golgi-localized antiapoptotic protein. J. Virol.
77:11633–11643.
11. Budt, M., L. Niederstadt, R. S. Valchanova, S. Jonjic, and W. Brune. 2009.
Specific inhibition of the PKR-mediated antiviral response by the murine
cytomegalovirus proteins m142 and m143. J. Virol. 83:1260–1270.
12. Cassady, K. A. 2005. Human cytomegalovirus TRS1 and IRS1 gene products
block the double-stranded-RNA-activated host protein shutoff response in-
duced by herpes simplex virus type 1 infection. J. Virol. 79:8707–8715.
13. Cassady, K. A., M. Gross, and B. Roizman. 1998. The herpes simplex virus
US11 protein effectively compensates for the
1(34.5) gene if present before
activation of protein kinase R by precluding its phosphorylation and that of
the alpha subunit of eukaryotic translation initiation factor 2. J. Virol. 72:
8620–8626.
14. Chang, H. W., J. C. Watson, and B. L. Jacobs. 1992. The E3L gene of
vaccinia virus encodes an inhibitor of the interferon-induced, double-
stranded RNA-dependent protein kinase. Proc. Natl. Acad. Sci. USA 89:
4825–4829.
VOL. 83, 2009 REQUIREMENT FOR pIRS1 OR pTRS1 IN HCMV REPLICATION 4119
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from

15. Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Esche-
richia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision
of the antibiotic-resistance determinant. Gene 158:9–14.
16. Child, S. J., and A. P. Geballe. 2009. Binding and relocalization of PKR by
murine cytomegalovirus. J. Virol. 83:1790–1799.
17. Child, S. J., M. Hakki, K. L. De Niro, and A. P. Geballe. 2004. Evasion of
cellular antiviral responses by human cytomegalovirus TRS1 and IRS1. J. Vi-
rol. 78:197–205.
18. Child, S. J., L. K. Hanson, C. E. Brown, D. M. Janzen, and A. P. Geballe.
2006. Double-stranded RNA binding by a heterodimeric complex of murine
cytomegalovirus m142 and m143 proteins. J. Virol. 80:10173–10180.
19. Child, S. J., S. Jarrahian, V. M. Harper, and A. P. Geballe. 2002. Comple-
mentation of vaccinia virus lacking the double-stranded RNA-binding pro-
tein gene E3L by human cytomegalovirus. J. Virol. 76:4912–4918.
20. Dever, T. E., A. C. Dar, and F. Sicheri. 2007. The eIF2� kinases, p. 319–344.
In M. B. Matthews, N. Sonenberg, and J. W. B. Hershey (ed.), Translational
control in biology and medicine. Cold Spring Harbor Press, Cold Spring
Harbor, NY.
21. Dunn, W., C. Chou, H. Li, R. Hai, D. Patterson, V. Stolc, H. Zhu, and F. Liu.
2003. Functional profiling of a human cytomegalovirus genome. Proc. Natl.
Acad. Sci. USA 100:14223–14228.
22. Elde, N. C., S. J. Child, A. P. Geballe, and H. Malik. 2009. Protein kinase R
reveals an evolutionary model for defeating viral mimicry. Nature 457:485–
499.
23. Garcia, M. A., S. Guerra, J. Gil, V. Jimenez, and M. Esteban. 2002. Anti-
apoptotic and oncogenic properties of the dsRNA-binding protein of
vaccinia virus, E3L. Oncogene 21:8379–8387.
24. Geballe, A. P., and E. S. Mocarski. 1988. Translational control of cytomeg-
alovirus gene expression is mediated by upstream AUG codons. J. Virol.
62:3334–3340.
25. Hakki, M., and A. P. Geballe. 2005. Double-stranded RNA binding by
human cytomegalovirus pTRS1. J. Virol. 79:7311–7318.
26. Hakki, M., E. E. Marshall, K. L. De Niro, and A. P. Geballe. 2006. Binding
and nuclear relocalization of protein kinase R by human cytomegalovirus
TRS1. J. Virol. 80:11817–11826.
27. Hobom, U., W. Brune, M. Messerle, G. Hahn, and U. H. Koszinowski. 2000.
Fast screening procedures for random transposon libraries of cloned her-
pesvirus genomes: mutational analysis of human cytomegalovirus envelope
glycoprotein genes. J. Virol. 74:7720–7729.
28. Jacobs, B. L. 2000. Translational control in poxvirus-infected cells, p. 951–
971. In W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Transla-
tional control. Cold Spring Harbor Press, Cold Spring Harbor, NY.
29. Jacobs, B. L., and J. O. Langland. 1996. When two strands are better than
one: the mediators and modulators of the cellular responses to double-
stranded RNA. Virology 219:339–349.
30. Jacobs, B. L., J. O. Langland, and T. Brandt. 1998. Characterization of viral
double-stranded RNA-binding proteins. Methods 15:225–232.
31. Jones, T. R., and V. P. Muzithras. 1992. A cluster of dispensable genes within
the human cytomegalovirus genome short component: IRS1, US1 through
US5, and the US6 family. J. Virol. 66:2541–2546.
32. Langland, J. O., J. M. Cameron, M. C. Heck, J. K. Jancovich, and B. L.
Jacobs. 2006. Inhibition of PKR by RNA and DNA viruses. Virus Res.
119:100–110.
33. Langland, J. O., and B. L. Jacobs. 2002. The role of the PKR-inhibitory
genes, E3L and K3L, in determining vaccinia virus host range. Virology
299:133–141.
34. Miller, A. D., J. V. Garcia, N. von Suhr, C. M. Lynch, C. Wilson, and M. V.
Eiden. 1991. Construction and properties of retrovirus packaging cells based
on gibbon ape leukemia virus. J. Virol. 65:2220–2224.
35. Miller, A. D., and G. J. Rosman. 1989. Improved retroviral vectors for gene
transfer and expression. BioTechniques 7:980–982, 984–986, 989–990.
36. Mohr, I. J., T. Pe’ery, and M. B. Mathews. 2007. Protein synthesis and
translational control during viral infection, p. 545–599. In M. B. Matthews,
N. Sonenberg, and J. W. B. Hershey (ed.), Translational control in biology
and medicine. Cold Spring Harbor Press, Cold Spring Harbor, NY.
37. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M.
Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of
nondividing cells by a lentiviral vector. Science 272:263–267.
38. Nichols, N. M., and D. Yue. 2008. Ribonucleases, p. 3.13.1–3.13.8. In F. M.
Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith,
and K. Struhl (ed.), Current topics in molecular biology. John Wiley and
Sons, New York, NY.
39. Peters, G. A., D. Khoo, I. Mohr, and G. C. Sen. 2002. Inhibition of PACT-
mediated activation of PKR by the herpes simplex virus type 1 Us11 protein.
J. Virol. 76:11054–11064.
40. Poppers, J., M. Mulvey, D. Khoo, and I. Mohr. 2000. Inhibition of PKR
activation by the proline-rich RNA binding domain of the herpes simplex
virus type 1 Us11 protein. J. Virol. 74:11215–11221.
41. Romanowski, M. J., and T. Shenk. 1997. Characterization of the human
cytomegalovirus irs1 and trs1 genes: a second immediate-early transcription
unit within irs1 whose product antagonizes transcriptional activation. J. Vi-
rol. 71:1485–1496.
42. Rothenburg, S., E. J. Seo, J. S. Gil, T. E. Dever, and K. Dittmar. 2009. Rapid
evolution of protein kinase PKR alters sensitivity to viral inhibitors. Nat.
Struct. Mol. Biol. 16:63–70.
43. Sanchez, R., and I. Mohr. 2007. Inhibition of cellular 2�-5� oligoadenylate
synthetase by the herpes simplex virus type 1 Us11 protein. J. Virol. 81:3455–
3464.
44. Silverman, R. H. 2007. Viral encounters with 2�,5�-oligoadenylate synthetase
and RNase L during the interferon antiviral response. J. Virol. 81:12720–
12729.
45. Stasiak, P. C., and E. S. Mocarski. 1992. Transactivation of the cytomega-
lovirus ICP36 gene promoter requires the alpha gene product TRS1 in
addition to IE1 and IE2. J. Virol. 66:1050–1058.
46. Targett-Adams, P., S. Boulant, and J. McLauchlan. 2008. Visualization of
double-stranded RNA in cells supporting hepatitis C virus RNA replication.
J. Virol. 82:2182–2195.
47. Tartaglia, J., M. E. Perkus, J. Taylor, E. K. Norton, J. C. Audonnet, W. I.
Cox, S. W. Davis, J. van der Hoeven, B. Meignier, M. Riviere, et al. 1992.
NYVAC: a highly attenuated strain of vaccinia virus. Virology 188:217–232.
48. Valchanova, R. S., M. Picard-Maureau, M. Budt, and W. Brune. 2006.
Murine cytomegalovirus m142 and m143 are both required to block protein
kinase R-mediated shutdown of protein synthesis. J. Virol. 80:10181–10190.
49. Weber, F., V. Wagner, S. B. Rasmussen, R. Hartmann, and S. R. Paludan.
2006. Double-stranded RNA is produced by positive-strand RNA viruses
and DNA viruses but not in detectable amounts by negative-strand RNA
viruses. J. Virol. 80:5059–5064.
50. Whitaker-Dowling, P., and J. S. Youngner. 1984. Characterization of a spe-
cific kinase inhibitory factor produced by vaccinia virus which inhibits the
interferon-induced protein kinase. Virology 137:171–181.
51. Xiang, Y., R. C. Condit, S. Vijaysri, B. Jacobs, B. R. Williams, and R. H.
Silverman. 2002. Blockade of interferon induction and action by the E3L
double-stranded RNA binding proteins of vaccinia virus. J. Virol. 76:5251–
5259.
4120 MARSHALL ET AL. J. VIROL.
at RO
BERT KO
CH-INSTITUT on O
ctober 13, 2009
jvi.asm.org
D
ow
nloaded from