Activation of porcine natural killer cells and lysis of foot-and-mouth disease virus infected cells.

Abstract

Natural killer (NK) cells play a vital role in innate response against viral infections and cellular transformation. In vivo modulation of their response may enhance their antiviral function. Here we describe the phenotype of porcine NK cells, test potential proinflammatory cytokines for activation of these cells and assess the capability of porcine NK cells to kill virus-infected or tumor cells in vitro. The CD2+/CD8+/CD3(-) cell compartment contained porcine NK cells, which at the resting stage were minimally cytotoxic toward foot-and-mouth disease virus (FMDV)-infected porcine cells or tumor cell lines. Direct stimulation of NK cells with proinflammatory cytokines induced efficient lysis of FMDV-infected cells with interleukin (IL)-2 or IL-15 showing the highest stimulatory capacity. Lower levels of NK cell activation were induced by IL-12, IL-18, or interferon (IFN)-alpha, however, IL-12 and IL-18 synergistically activated NK cells. Combinations of IL-15 and IL-12 or IL-15 and IL-18 did not further increase the porcine NK cell lytic capability over IL-15 alone. Natural killer cells expressed IFN-gamma regardless of the cytokine used for stimulation while expression of perforin increased modestly. The enhancement of porcine NK cell activity by proinflammatory cytokines offers a promising tool for development of antiviral approaches against virus infection.

Full text

Page 1

179
Activation of Porcine Natural Killer Cells and Lysis of
Foot-and-Mouth Disease Virus Infected Cells
Felix N. Toka,1,2 Charles K. Nfon,1 Harry Dawson,3 D. Mark Estes,4,5 and William T. Golde 1
Natural killer (NK) cells play a vital role in innate response against viral infections and cellular transformation.
In vivo modulation of their response may enhance their antiviral function. Here we describe the phenotype of
porcine NK cells, test potential proinfl ammatory cytokines for activation of these cells and assess the capability
of porcine NK cells to kill virus-infected or tumor cells in vitro. The CD2+/CD8+/CD3− cell compartment con-
tained porcine NK cells, which at the resting stage were minimally cytotoxic toward foot-and-mouth disease
virus (FMDV)-infected porcine cells or tumor cell lines. Direct stimulation of NK cells with proinfl ammatory
cytokines induced effi cient lysis of FMDV-infected cells with interleukin (IL)-2 or IL-15 showing the highest
stimulatory capacity. Lower levels of NK cell activation were induced by IL-12, IL-18, or interferon (IFN)-α, how-
ever, IL-12 and IL-18 synergistically activated NK cells. Combinations of IL-15 and IL-12 or IL-15 and IL-18 did
not further increase the porcine NK cell lytic capability over IL-15 alone. Natural killer cells expressed IFN-γ re-
gardless of the cytokine used for stimulation while expression of perforin increased modestly. The enhancement
of porcine NK cell activity by proinfl ammatory cytokines offers a promising tool for development of antiviral
approaches against virus infection.
JOURNAL OF INTERFERON & CYTOKINE RESEARCH
Volume 29, Number 3, 2009
© Mary Ann Liebert, Inc.
DOI: 10.1089/jir.2008.0058
Introduction
T
among which, the natural killer (NK) cells play a critical
role. Natural killer cells form a small fraction of circulating
lymphocytes that are neither B nor T cells. Natural killer
cells can destroy transformed or infected cells of the host
in a rapid, antigen nonspecifi c manner and there is ample
evidence for their role in immunosurveillance (Klein and
others 1984; Kobayashi 1989) and protection against certain
viral, bacterial, and protozoan infections (Hirahashi and
others 2002; Byrne and others 2004; Feng and others 2006).
Mechanisms engaged by NK cells to eliminate the target
cells, as described for humans and mice, involve exocyto-
sis of cytotoxic granules containing perforin and granzymes
and induction of apoptosis through appropriate receptor–
ligand interactions (Miyaji and others 2002; Grossman and
others 2004; Ochi and others 2004). Besides the cytotoxic
function, NK cells are a major source of interferon-γ (IFN-γ)
he immune system initially controls tumors or invad-
ing pathogens by engaging innate immune mechanisms
(Martin-Fontecha and others 2004; Thale and Kiderlen 2005;
Montoya and others 2006), a cytokine integral to the devel-
opment of the adaptive immune response following infec-
tion. Reactivity of NK cells is highly regulated by an array
of stimulatory and inhibitory receptors on their cell surface
and the balance of signals between these receptors deter-
mines the ultimate reactivity of NK cells [reviewed in Lanier
(2005)]. Little is known about the expression and distribu-
tion profi le of activating and inhibitory receptors on porcine
NK cells.
Natural killer cells are known to “act on demand,” at
least in humans (Price and others 1980). Contrarily in mice
(Fehniger and others 2007) and pigs (Pinto and Ferguson
1988), these cells may require activation to effectively carry
out their function. Several cytokines have been reported
to activate NK cells and most are part of the infl ammatory
response to virus infection. Interferon-α, interleukin (IL)-12,
and IL-18 are well characterized for this function (Lauwerys
and others 2000). Interleukin-12 functions to enhance NK
1Plum Island Animal Disease Center, Agricultural Research Service, US Department of Agriculture, Greenport, New York.
2Department of Preclinical Science, Faculty of Veterinary Medicine, Warsaw University of Life Science, Warsaw, Poland.
3Beltsville Area Research Center, Agricultural Research Service, US Department of Agriculture, Beltsville, Maryland.
4Department of Pediatrics and 5Department of Microbiology and Immunology, Sealy Center for Vaccine Development, University of
Texas Medical Branch, Galveston, Texas.

Page 2

TOKA ET AL.180
cells, lymphocyte-activated killing and cytotoxic T lympho-
cytes (CTLs). Also IL-12 induces production of IFN-γ and
may mediate proliferation of T cells in the presence of a mito-
gen (Gately and others 1991). Interleukin 18 enhances NK cell
activity and promotes Th1 immune responses. Originally, it
was described as an IFN-γ-inducing factor. Recently, IL-15
has also been described to participate in development and
survival of NK cells in mice (Liu and others 2000; Golden-
Mason and others 2004).
Natural killer cells are less characterized in nonrodent
species such as porcine and bovine. The unavailability of
reagents has slowed progress in dissecting the precise phe-
notype, function and mechanisms of activation of NK cells
in large animal species. However, recently a commercially
available antibody against bovine NKp46 (Storset and oth-
ers 2004) has rekindled the interest in further character-
ization of NK cells in the bovine. Recent reports describe
a possible role of bovine NK cells in controlling infections
such as Mycobacteria bovis (Endsley and others 2006) and
possible mechanisms of activation of bovine NK cells have
been reported (Endsley and others 2006).
Denyer and others (2006) recently reported the
classifi cation of porcine T cells based on their expression
of perforin. Porcine NK cells appear to be contained in the
CD2+/CD8+/CD3− cell population, however, CD3+ cells were
also observed to contain perforin and had capacity to lyse
targets in major histocompatibility complex–unrestricted
manner. Therefore, it is likely that porcine NK cells may
share characteristics of a wide range of lymphocytes in-
cluding a small population of CD3+ T cells, possibly NKT
cells. Similarly, a small portion of porcine NK cell activity
likely resides in the CD2+, CD3−, CD4−, CD8a−, LGL popula-
tion as anti-CD8+ complement treatment eliminates most but
not all NK cell activity (Pescovitz and others 1988). Recently
an antibody against porcine NK cells was described that
binds to CD11R1, an integrin that is similar to human CD11b
but has a different expression and distribution pattern in
porcine (Antigenix America, Inc., Huntington Station, NY,
USA). To date no in-depth characterization has been done on
porcine cells expressing CD11R1.
The role of NK cells in controlling viral infections, espe-
cially acute viral infections, is likely very signifi cant. Foot-
and-mouth disease virus (FMDV) is an important pathogen
of cloven hoofed animals, particularly bovine and swine. It
spreads rapidly causing an economically devastating disease
due to highly acute pathology and being extremely conta-
gious. In regions where the virus is endemic, vaccination is
practiced and this vaccine has been shown to work in as little
as 7 days in cattle (Golde and others 2005). However, control
of FMD outbreaks require antiviral treatments that work in
as little as 24 h. Therefore, it is important to understand the
function of NK cells in domestic species and how activation
of these cells may be regulated. Protection of livestock against
this and other acute viral infections may be enhanced by the
use of interventional vaccines designed to activate the innate
response before the adaptive immunity develops.
We propose that rapid acting vaccines against FMDV
should be designed to stimulate innate responses for early
protection against infection while allowing normal or pos-
sibly accelerated development of effective adaptive immune
responses. Here, we have characterized the in vitro cytotoxic
capacity of porcine NK cells and analyzed their response
to stimulation with proinfl ammatory cytokines including
human (h)IL-2, porcine (p)IL-12, pIL-15, pIL-18, and pIFN-α.
Freshly isolated porcine NK cells are less cytotoxic, but a
number of the cytokines tested activate the NK cell function.
These cytokines increased the level of killing, IFN-γ secretion
and perforin expression in porcine NK cells. Interleukin15
was the most potent in activating porcine NK cells, whereas
IL-12 and IL-18 exhibited synergism in inducing cytolytic
activity. These infl ammatory and proinfl ammatory cytok-
ines activated the porcine NK cells most likely through cyto-
kine receptor interaction and not through an intermediary
cell types. Importantly, the cytokines enhanced cytotoxicity
against FMDV-infected SK6 cells. Exogenous proinfl amma-
tory cytokines may likely augment the in vivo function of por-
cine NK cells and molecular methods may be manipulated to
enhance the innate response against infection with FMDV.
Materials and Methods
Animals
Yorkshire pigs aged between 3 and 4 months were pur-
chased from Animal Biotech, Inc. (Danboro, PA, USA) and ac-
climated for 1 week before use in the experiments described
here. All procedures performed on the pigs were approved
by the Institutional Animal Care and Use Committee.
Preparation of peripheral blood mononuclear cells
Assays involving cells from pigs were performed on pe-
ripheral blood mononuclear cells (PBMCs) isolated as fol-
lows. Blood was drawn into heparin-containing vacutainer
tubes, diluted 1:1 with phosphate-buffered saline (PBS), lay-
ered onto Lymphoprep (Axis-Shield, PoC AS, Oslo, Norway)
and spun at 1000g for 20 min at 20ºC. PBMCs were col-
lected from the gradient interface and washed in PBS three
times to remove platelets followed by 1 wash in Rosewell
Park Memorial Institute (RPMI)-1640 medium (Invitrogen,
Carlsbad, CA) and fi nally suspended in RPMI-1640 supple-
mented with 10% fetal bovine serum (FBS, Hyclone, Logan,
UT, USA), 2 mM Hepes, 2 mM l-glutamine, and antibiotic-
antimycotic (Invitrogen, Carlsbad, CA).
Enrichment of porcine NK cells and cell sorting
Natural Killer cells were enriched based on the charac-
terization by Denyer and others (2006). Negative selection
was performed by fi rst removing adherent macrophages
(MΦ), followed by CD172+, CD3+, CD4+, and CD21+ cells.
Magnetic-activated cell sorting (MACS) (Miltenyi Biotech,
Bergisch Gladbach, Germany) or the Dynabead cell-sorting
systems (Dynal Biotech ASA, Oslo, Norway) were used to
separate the cells according to the manufacturers’ instruc-
tions. Mouse antibodies against porcine CD3 (clone PPT3),
CD4 (clone 74-12-4), CD21 (clone BB6-11C9.6), and CD172
(clone 74-22-15) were purchased from Southern Biotech
(Burmingham, AL). All antibodies used for cell enrichment
were low endotoxin and azide free as assured by the manu-
facturer. Briefl y, PBMCs were labeled with antibodies for 10
min at 4ºC. Subsequently, cells were bound by microbeads
coated with goat anti-mouse IgG and further incubated
for 15 min at 4ºC. Cells were washed and passed through
a magnetic fi eld for separation. After separation, cells were

Page 3

PORCINE NK CELL ACTIVATION181
Following infection, the cells were washed twice and
resuspended in PBS then labeled with 5 μM of CFSE for 15
min at room temperature. Labeling was stopped by adding
RPMI-1640 supplemented with 10% FBS. Cells were washed
once and allowed to stand for 30 min at 37ºC. Finally, the
labeled cells were washed three times, counted and used as
target cells in the killing assay at appropriate E:T ratios. The
time of incubation with NK cells, data acquisition, and cor-
rection were as described for K562-GFP cells. CFSE-labeling
procedure was also performed on CD2+/CD8+/CD3− cells
that were later stimulated with cytokines for 18–24 h to
determine proliferation of porcine NK cells.
Stimulation of porcine NK cells
To measure the direct stimulatory effect of cytok-
ines on porcine NK cells, hIL-2 (Hemagen Diagnostics,
Inc., Columbia, MD, USA), pIL-12, pIL-18 (R&D Systems,
Minneapolis, MN, USA) pIL-15 (Invitrogen, Carlsbad, CA,
USA), and pIFN-α (in-house preparation as described by
Moraes and others (2007) were used to stimulate the PBMCs
or NK cells. Cytokines were used at a concentration of 20
ng/ml hIL-2, 10 ng/ml for pIL-12, 25 ng/ml for pIL-15, 100
ng/ml for pIL-18, and 500 U for pIFN-α, predetermined in
preliminary experiments. Cells were stimulated for 18–24 h
and later used in NK cell cytotoxicity assay or intracellular
cytokine measurement.
Intracellular staining for IFN-γ and perforin
Cells stimulated as described earlier were placed in
96-well microtiter plates at 1 × 106 cells/well and incubated
for 5–6 h in the presence of GolgiPlug containing brefeldin
A (1 μl/106 cells; BD Bioscience, San Diego CA). Phorbol
myristate acetate and Ionomycin (Sigma, St Louis, MO,
USA) were added to cells designated for positive controls
at 100 ng/ml and 10 ng/ml, respectively. After 5–6 h cells
were stained on the surface for CD2 (clone MSA4, Accurate
Chemicals, Westbury, NY, USA) and CD8 (clone 76-2-11,
Biotin-labeled, Southern Biotech). Secondary antibodies,
anti-mouse IgG2a-FITC was used to detect CD2 and strepta-
vidin-PerCP to detect CD8-biotin. Intracellular staining for
IFN-γ or perforin was performed according to BD Bioscience
intracellular staining protocol. Anti-porcine IFN-γ-PE clone
P2G10 was purchased from BD Bioscience and used at 1 μg/
ml. Perforin was detected with anti-human perforin-PE an-
tibody clone δG9 (BD Biosciences, San Diego, CA, USA) that
cross reacts with porcine perforin at the concentration sug-
gested by the manufacturer. Data were acquired and ana-
lyzed in FACSCalibur HTS and CellQuest Pro, respectively
(BD Biosciences, San Diego, CA, USA).
NK cell proliferation
CD2+/CD8+/CD3− cells were sorted by negative selection
with magnetic bead labeling as described earlier and rested
for 18–24 h in RPMI-1640. Later the cells were washed once
and resuspended in PBS, and labeled with CFSE at 5 μM
for 15 min at room temperature. Labeling was quenched by
addition of RPMI-1640 containing 10% FBS for 3 min then
washed three times and fi nally resuspended in RPMI-1640.
Before setting up the assays, cells were counted and viability
washed twice and resuspended in RPMI-1640 supplemented
with 10% FBS. Enrichment usually reached 85–90% of CD2+/
CD8+/CD3− cells containing the majority of porcine NK
cells. Adherent monocyte/macrophages were isolated by in-
cubating PBMCs in plastic fl asks for 2 h at 37ºC followed by
removal of nonadherent cells. The fl asks were then washed
once and cell dissociation solution (Sigma, St. Louis, MO,
USA) was added and fl asks incubated at 37ºC for 5–10 min.
Detached cells were washed in RPMI-1640 and used in the
assays. CD3+, CD4+, CD21+, and CD172+ cells were positively
selected using MACS (see above) and rested for 18–24 h be-
fore performing any assays on them. This sorting procedure
did not cause changes in reactivity of cells.
NK cell cytotoxicity assay
A fl ow cytometry technique was used to assess the NK
cell lytic activity. YAC-1 (Moloney murine leukemia virus
induced lymphoma) and K562 (human erythroleukemia
cell line) tumor cell lines were obtained from the American
Type Culture Collection (Manassas, VA, USA). K562 tumor
cells stably transfected with the green fl uorescent protein
(GFP), referred to here as K562-GFP, were provided by Dr.
Mike Olin (University of Minnesota, School of Veterinary
Medicine, St. Paul, MN, USA). Bulk PBMCs or CD2+/CD8+/
CD3− enriched cells from pigs were added to target cells
harvested from cultures in exponential growth. Cells were
distributed in 96-well microtiter plates at effector:target (E:T)
ratios of 50:1, 25:1, 12:1, and 6:1 followed by addition of 5 μl/
well 7AAD (0.25 μg, dead/live discriminating dye, 7 amino-
actinomycin D, BD Bioscience, San Diego CA, USA). Cells
were mixed, spun for 1 min at 500g and incubated at 37ºC in
5% CO 2 for 4 h. When YAC-1 cells were used as target cells,
carboxy fl uorescein succinimidyl ester (CFSE) was used as a
tracking dye. Labeling of YAC-1 cells was performed as de-
scribed for SK6 cells in the next section. Data were acquired
using a FACSCalibur fl ow cytometer with a high throughput
system (HTS) and later analyzed in CellQuest Pro software
(BD Biosciences, San Jose, CA, USA) by establishing a gate on
K562-GFP to display the double-positive (GFP+7AAD) cells
representing the killed population. The lysis level was de-
termined by the formula R1/(R1+R2) × 100 = %Lysis, where;
R1 = double-positive cells; R2 = GFP-positive cells. Natural
killer cells were further analyzed by fl ow cytometry for de-
granulation by staining with mouse anti-porcine CD107a
(Serotec, Raliegh, NC).
NK cell cytotoxicity assay for FMDV-infected
SK6 cells
To determine the capability of porcine NK cells to lyse
virus-infected target cells, SK6 cells (porcine kidney fi bro-
blast cell line) were infected with an attenuated strain of
FMD, LL-KGE, at a multiplicity of infection of 10 for 4 h.
LL-KGE is a FMDV O1 Campos structural proteins (icoseh-
edral capsid) inserted into the strain A12 backbone with a
positive charge mutation, and another mutation in the re-
ceptor binding (RGD) sequence to KGE to allow for binding
of the heparan sulfate receptor. This allows infection of all
cell types rather than only cells expressing the physiological
receptor for FMDV. Additionally, this contruct has no leader
protease that determines the in vitro attenuation.

Page 4

TOKA ET AL.182
mouse anti-porcine CD107a, a lysosomal-associated mem-
brane protein (LAMP-1) expressed mainly in endosome-lys-
osome membranes of cells. CD107a has been described as a
marker for CTL or NK cell degranulation (Alter and others
2004). PBMCs have a low expression of CD107a (Fig. 1C), but
upon culture with K562 cells for 4 h the expression of CD107a
increases considerably (Fig. 1D). Addition of CHQ inhib-
ited further expression CD107a on the cell surface (Fig. 1E).
These data indicate that the low cytotoxicity observed is due
to degranulation of the NK cells, further confi rming that
freshly isolated porcine NK cells have reduced cytotoxicity
against tumor cells lines.
Although the bulk assay indicated a low level of lytic ac-
tivity of freshly isolated PBMCs we sought to localize the
effector function to a particular cell type. Thus, PBMCs
were sorted into CD2+/CD8+, CD3+, CD4+, CD21+ (B cells),
CD172+ cells, and adherent MΦ and then tested for cytotox-
icity against K562-GFP cells. Residual killing was preserved
at very low levels in CD3+, but not in B cells, CD172+ cells
and MΦ (Fig. 1F). However, the highest cytolytic potential
was detected in the CD2+/CD8+/CD3− cell fraction only and
the difference was signifi cant compared to CD3+ cells (p ≤
0.05). Thus, we have demonstrated that the NK cell pheno-
type in the porcine likely resides in the CD2+/CD8+/CD3-
cell population.
Proinfl ammatory cytokines activate
porcine NK cells
The relatively low level of lytic activity of NK cells against
sensitive targets suggested that porcine NK cells require ac-
tivation before engagement in target cell recognition and
lysis. During infection with certain viruses, cytokines such
as IFN-α, IL-12, IL-15, and IL-18 are abundantly secreted, and
activation of NK cells by these cytokines has been reported
in humans and mice (Naume and others 1992; Perussia and
others 1992; Lauwerys and others 2000). Therefore, we in-
vestigated whether direct cytokine stimulation of porcine
NK cells from freshly isolated PBMCs infl uenced their lytic
capability. Human IL-2, pIL-12, pIL-15, pIL-18, or pIFN-α
were added to cultures of PBMCs or enriched NK cells as
described in Material and Methods for 18 h and then NK
capacity was tested. Four of the proinfl ammatory cytokines
tested enhanced porcine NK cells lytic activity of CD2+/
CD8+/CD3− cells or bulk PBMCs against K562-GFP cells com-
pared to nonstimulated NK cells (Fig. 2A and B). The only
cytokine that did not increase the NK cell lytic activity was
IL-12, although addition of excess amounts, (three times the
concentration recommended to achieve biological response
by the manufacturer) enhanced NK cell lytic activity (data
not shown). The difference in lytic activity between stimu-
lated and nonstimulated cells was statistically signifi cant (p
≤ 0.05), apart from cells stimulated with pIL-12. However,
there were no signifi cant differences between hIL-2, pIL-15,
pIL-18, and pIFN-α. IL-2, whose activating infl uence on
human and mouse T cells is known, and IL-15 activate por-
cine NK cells to a 5- and 4-fold increase, respectively, in per-
centage of K562-GFP cell lysis compared to nonstimulated
cells. The pattern of NK cell reactivity in both PBMCs and
CD2+/CD8+/CD3− cells was similar, which indicates that the
cytokines activated the same effector cells. Thus, similar to
human and mice, the cytokines tested induced porcine NK
cells to kill sensitive tumor cell targets.
assessed by trypan blue exclusion. 1 × 105 cells were plated per
well and cytokines added to the cells at the same concentra-
tion as used previously and incubated for 18 or 72 h. Dilution
of CFSE was monitored by fl ow cytometry (FACSCalibur,
CellQuest Pro, BD Biosciences, San Diego, CA, USA).
Quantitative real-time RT-PCR
The CD3+ cells were selected positively and rested for
18–24 h before RNA isolation as described earlier. RNA
was isolated from non-stimulated or cytokine-stimulated
CD2+/CD8+/CD3- cells, treated with DNAse then tran-
scribed into cDNA using the following reaction mixture; 5x
reaction buffer, 10 mM dNTP, 50 ng/μl Random Primers, 0.1
M DTT, 40 U RNAse inhibitor and 200 U M-MLV RT. The
cDNA templates were later used in the Quantitative real-
time reverse transcriptase polymerase chain reaction (qrRT-
PCR). The reactions were done in duplicate. TaqMan RT-PCR
system was used for amplifi cation. Primers and probes were
designed at the Beltsville Human Nutrition Research Center
(Beltsville, ARS USDA, http://www.ars.usda.gov/Services/
docs.htm?docid=6065) and sequences are provided in Table 1.
Polymerase chain reactions were run in the 7700 ABI Prism
Sequence Detector (Applied Biosystems, Foster City, CA,
USA) with the following cycling parameters: hold at 50ºC for
2 min, hold at 95ºC for 10 min and then run 40 cycles at 95ºC
for 15 s (denature), and 60ºC for 1 min (anneal). Ubiquitin
or peptidylprolyl isomerase A were used as reference genes
to normalize each gene expression. Relative expression was
calculated using REST2005 version 1.9.12 (http://www.gene-
quantifi cation.de) and is expressed as ratios relative to the
calibrator (purifi ed CD3+ T cells or nonstimulated CD2+/
CD8+/CD3− cells).
Statistical evaluation
Where appropriate, a test of signifi cance in differences
between means of treatment groups was performed by a
t-test for paired sample means. A p value of ≤0.05 was con-
sidered signifi cant.
Results
Resting porcine NK cells have low cytotoxicity
We determined the resting lytic activity of porcine NK
cells by a fl ow cytometry based cytotoxicity assay. Data pre-
sented in Figure 1A and B show that resting porcine NK cells
are capable of killing K562-GFP or YAC-1 cells, respectively,
albeit at a very low level when a standard incubation time
of 4 h was used. Low or even complete lack of lytic activity
of porcine NK cells has been reported previously (Pinto and
Ferguson 1988) and may be associated with the breed of pigs
being analyzed. Because relatively low cytotoxicity could
easily be interpreted as lack of killing capability, we treated
a set of cells with chloroquine, a lysosomotropic agent
that raises the pH of perforin granule compartment block-
ing the maturation of perforin thus inhibiting cytotoxicity.
Treatment with chloroquine diminished the cytotoxicity
against both target cell lines (Fig. 1A and B). Additionally, to
show whether this low-level cytotoxicity involved exocytosis
of cytotoxicity granules, PBMCs were cultured with K562
cells lacking GFP expression, with addition of FITC-labeled

Page 5

PORCINE NK CELL ACTIVATION 183
Table 1. Primers and Probes Used in the qrRT-PCR Assay
GenePrimers and probes
IL-12 receptor-β
p-IL12RB2-2136F: GGCCAGGAAAGGGACAAAG
p-IL12RB2-2272R: CCCCAGCACCTTGTACAGATC
p-IL12RB2-2203T: AAGTCCACCACCTCCAAGGGCTCTCAC
p-IL15RA-360F: GCTGGGTTCAAGCGGAAAG
p-IL15RA-430R: GCCACGTTCATGGTCTCGTT
p-IL15RA-409 revT: AACACGCACTCCGTCAGGCTGGA
p-IL18RAP-482F: CTCCTCGCCACCGTCATG
p-IL18RAP-596R: GCGTCTCATCCTTGCTCTGGTA
p-IL18RAP-511T: TGTGCTGACCACAGGTGCTCTCCTCT
p-IFNAR1-304F: AAAAATTAAATTGCGTATAAGAGCAGAA
p-IFNAR1-385R: TTGAAATGGTATAAACGGCTCAAC
p-IFNAR1-332T: ACAGGAAACAGCACTTCTCCGTGGTATGA
p-TNFSF10-277F: TGTGAGAAAGATGATTTTGAGAACCT
p-TNFSF10-380R: CTCTCTGTGGACCTTTTTCTCTTTCTA
p-TNFSF10-326T: TCAGAAAAGCAACAAGGCATTCCTCACCT
p-UBC-47F: GCGCACCCTGTCTGACTACA
p-UBC -126R: AGATCTGCATCCCACCTCTGA
p-UBC-79T: AGTCCACCCTGCACCTGGTCCTCC
p/h-PPIA-463F: GCCATGGAGCGCTTTGG
p-PPIA-540R: TTATTAGATTTGTCCACAGTCAGCAAT
p/h-PPIA-511 revT: TGATCTTCTTGCTGGTCTTGCCATTCCT
p-NCR1-1F: CCTTTGACCAGGAGCTTCACA
p-NCR1-71R: AGATGTTTTGGCTCCTACAACAAG
p-NCR1-23T: GCTCACTGGGGAAAGACCATGCGT
p-NCR3-197F: TGATCAGGGTCCATCCAGGAT
p-NCR3-268R: TGCCCTCCTGAGTACAGATCTCA
p/h-NCR3-219T: CTGTGCTCTCTGGGTGTCCCAGCC
p-KLRF1-43F: GATTGGACTTAACTTTACCTTCCAGAA
p-KLRF1-165R: TCTTTGATGGTAGCACAGCTATTTTC
p-KLRF1-95 revT: AACCATCCACCCAGGTCCATGTCCT
p-GZMA-279F: GGAGCTCACTCGATAACCAAGAAA
p-GZMA-396R: GCTTTAGAAGTTTAAGGTCACCCTCAT
p-GZMA-341T: TCCTTATCCATGCTTTGACCAGGACACAC
p-GZMB-546F: TCTCCTATGGAAGAAAGGATGGAA
p-GZMB-615R: ATCCAGGGCAGGAAACTTGA
p/h-GZMB-572T: CCTCCACGAGCCTGCACCAAAGTCT
p-PERF1-241F: TTCGCGGCCCAGAAGAC
p-PERF1-311R: CTGTAGAAGCGACACTCCACTGA
p-PERF1-259T: CACCAGGACCAGTACCGCTTCAGCC
p-KLRK1-381F: TCTCAAAATTCCAGTCTTCTGAAGATATA
p-KLRK1-492R: AGGATCTGTTTGTTGGAATTTGTACTA
p-KLRK1-463 revT: CCCATCCAATGATATGACTTCACCAATTTGA
p-KLRB1-377F: TTTATAAACACTGGAATGACAGTCTAGCT
p-KLRB1-470R: TGTATGAGTCTCAATTCCTCATTATCTTG
p-KLRB1-408T: CTGTTCCACAAAAGAATCCAGTCTGCTGC
p-KLRC1-390F: GTAATTGTCCAAAGGAATGGTTTACA
p-KLRC1-507R: CGAAGTAGAGTAGAATTCCGTGAAGC
p-KLRC1-482 revT: CACAGGCCATCAAACTCTCATTCCATGTC
p-SH2D1B-191F: TGTTAAGGGACAGCGAGTCCAT
p-SH2D1B-273R: GAAGATTCGGTATGTGTAGACAAAATTT
p/h-SH2D1B-215T: CAGGAGTCCTGTGCCTCTGTGTCTCGTTTA
p-KLRA1-185F: TGGCAAGACTGATGAAAAAGAGTT
p-KLRA1-257R: GAAACAGAGGATCCCAAGAATCAC
p-KLRA1-211T: CAGTGCTCTGGCATCGCATTGCA
IL-15 receptor-α
IL-18 receptor-α
IFN-α receptor 1
Tumor necrosis factor (ligand)
subfamily member 10—TRAIL
Ubiquitin—house-keeping gene
Peptidylprolyl isomerase A—house-
keeping gene
NCR1 (NKp46)
NCR3 (NKp30)
KLRF1 (NKp80)
Granzyme A
Granzyme B
Perforin
KLRK1 (NKG2D)
KLRB1 (CD161)
KLRC1 (NKG2A)
SH2 domain containing 1B
KLRA1 (Ly49)
Probes are indicated in bold.