Analysis of Flavivirus NS5 Methyltransferase Cap Binding

Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523, USA.
Journal of Molecular Biology (Impact Factor: 4.33). 02/2009; 385(5):1643-54. DOI: 10.1016/j.jmb.2008.11.058
Source: PubMed


The flavivirus 2'-O-nucleoside N-terminal RNA methyltransferase (MTase) enzyme is responsible for methylating the viral RNA cap structure. To increase our understanding of the mechanism of viral RNA cap binding we performed a detailed structural and biochemical characterization of the guanosine cap-binding pocket of the dengue (DEN) and yellow fever (YF) virus MTase enzymes. We solved an improved 2.1 A resolution crystal structure of DEN2 Mtase, new 1.5 A resolution crystal structures of the YF virus MTase domain in apo form, and a new 1.45 A structure in complex with guanosine triphosphate and RNA cap analog. Our structures clarify the previously reported DEN MTase structure, suggest novel protein-cap interactions, and provide a detailed view of guanine specificity. Furthermore, the structures of the DEN and YF proteins are essentially identical, indicating a large degree of structural conservation amongst the flavivirus MTases. Guanosine triphosphate analog competition assays and mutagenesis analysis, performed to analyze the biochemical characteristics of cap binding, determined that the major interaction points are (i) guanine ring via pi-pi stacking with Phe24, N1 hydrogen interaction with the Leu19 backbone carbonyl via a water bridge, and C2 amine interaction with Leu16 and Leu19 backbone carbonyls; (ii) ribose 2' hydroxyl interaction with Lys13 and Asn17; and (iii) alpha-phosphate interactions with Lys28 and Ser215. Based on our mutational and analog studies, the guanine ring and alpha-phosphate interactions provide most of the energy for cap binding, while the combination of the water bridge between the guanine N1 and Leu19 carbonyl and the hydrogen bonds between the C2 amine and Leu16/Leu19 carbonyl groups provide for specific guanine recognition. A detailed model of how the flavivirus MTase protein binds RNA cap structures is presented.

Download full-text


Available from: Susan Keenan,
  • Source
    • "391 NS3 DENV Hel and NS5 DENV MTase domains have been readily 392 crystallized as a monomeric free enzyme (Luo et al., 2008) and as 393 a dimeric complex with AdoMet (Lim et al., 2011), respectively, 394 yielding high-resolution X-ray diffraction data. Presence of AdoMet 395 co-purified with MTases from the bacterial lysates has already 396 been widely described (Benarroch et al., 2004; Egloff et al., 2002, 397 2007; Geiss et al., 2009; Lim et al., 2011; Yap et al., 2010). Since 398 one of the objectives of FBDD is to find new binding sites, we did 399 not attempt to exclude AdoMet from its binding pocket. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0 Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2’-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180 μM to 9 mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites.
    Antiviral research 06/2014; 106(1). DOI:10.1016/j.antiviral.2014.03.013 · 3.94 Impact Factor
  • Source
    • "To facilite stable crystallization, a shorter version of the DENV2 MTase (aa 1-265) was cloned into the the pET26b vector (EMD Biosciences) at the NdeI and HindIII sites using a pair of primers GCGGATCCCATATGACGGGAAACATAGGAGAGACGCTTGGAGAG and CCCAAGCTTCTAATGGTGGTGATGATGGTGTGAGCTTGATCCGATGTTGCGGGTTCCG (restriction sites were underlined). The shorter DENV2 MTase (aa 1-265) contained additional C-terminal SSSHHHHHH sequence according to the reported crystal structure [38] and was used throughout this manuscript. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The methyltransferase enzyme (MTase), which catalyzes the transfer of a methyl group from S-adenosyl-methionine (AdoMet) to viral RNA, and generates S-adenosyl-homocysteine (AdoHcy) as a by-product, is essential for the life cycle of many significant human pathogen flaviviruses. Here we investigated inhibition of the flavivirus MTase by several AdoHcy-derivatives. Unexpectedly we found that AdoHcy itself barely inhibits the flavivirus MTase activities, even at high concentrations. AdoHcy was also shown to not inhibit virus growth in cell-culture. Binding studies confirmed that AdoHcy has a much lower binding affinity for the MTase than either the AdoMet co-factor, or the natural AdoMet analog inhibitor sinefungin (SIN). While AdoMet is a positively charged molecule, SIN is similar to AdoHcy in being uncharged, and only has an additional amine group that can make extra electrostatic contacts with the MTase. Molecular Mechanics Poisson-Boltzmann Sovation Area analysis on AdoHcy and SIN binding to the MTase suggests that the stronger binding of SIN may not be directly due to interactions of this amine group, but due to distributed differences in SIN binding resulting from its presence. The results suggest that better MTase inhibitors could be designed by using SIN as a scaffold rather than AdoHcy.
    PLoS ONE 10/2013; 8(10):e76900. DOI:10.1371/journal.pone.0076900 · 3.23 Impact Factor
  • Source
    • "The 5′ end of the dengue RNA has a type 1 cap structure (me7-GpppA-me2), whose formation requires NS3 and NS5 enzymatic reactions [13]. NS5 MTase methylates the guanosine cap at the N7 position by transferring a methyl group from S-adenosyl-L-methionine (SAM) followed by methylation of the 2′-OH position of the first ribose nucleotide [14]. A side product, S-adenosyl-L-homocysteine (SAH), is produced from N7 and 2′-O methylations [15]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The dengue virus is the most significant arthropod-borne human pathogen, and an increasing number of cases have been reported over the last few decades. Currently neither vaccines nor drugs against the dengue virus are available. NS5 methyltransferase (MTase), which is located on the surface of the dengue virus and assists in viral attachment to the host cell, is a promising antiviral target. In order to search for novel inhibitors of NS5 MTase, we performed a computer-aided virtual screening of more than 5 million commercially available chemical compounds using two approaches: i) structure-based screening using the crystal structure of NS5 MTase and ii) ligand-based screening using active ligands of NS5 MTase. Structure-based screening was performed using the LIDAEUS (LIgand Discovery At Edinburgh UniverSity) program. The ligand-based screening was carried out using the EDULISS (EDinburgh University LIgand Selection System) program. The selection of potential inhibitors of dengue NS5 MTase was based on two criteria: the compounds must bind to NS5 MTase with a higher affinity than that of active NS5 MTase ligands, such as ribavirin triphosphate (RTP) and S-adenosyl-L-homocysteine (SAH); and the compounds must interact with residues that are catalytically important for the function of NS5 MTase. We found several compounds that bind strongly to the RNA cap site and the S-adenosyl-L-methionine (SAM) binding site of NS5 MTase with better binding affinities than that of RTP and SAH. We analyzed the mode of binding for each compound to its binding site, and our results suggest that all compounds bind to their respective binding sites by interacting with, and thus blocking, residues that are vital for maintaining the catalytic activity of NS5 MTase. We discovered several potential compounds that are active against dengue virus NS5 MTase through virtual screening using structure-based and ligand-based methods. These compounds were predicted to bind into the SAM binding site and the RNA cap site with higher affinities than SAH and RTP. These compounds are commercially available and can be purchased for further biological activity tests.
    BMC Bioinformatics 11/2011; 12 Suppl 13(Suppl 13):S24. DOI:10.1186/1471-2105-12-S13-S24 · 2.58 Impact Factor
Show more