Aging and cancer-related loss of insulin-like growth factor 2 imprinting in the mouse and human prostate.

Abstract

Loss of imprinting (LOI) is an epigenetic alteration involving loss of parental origin-specific expression at normally imprinted genes. A LOI for Igf2, a paracrine growth factor, is important in cancer progression. Epigenetic modifications may be altered by environmental factors. However, is not known whether changes in imprinting occur with aging in prostate and other tissues susceptible to cancer development. We found a LOI for Igf2 occurs specifically in the mouse prostate associated with increased Igf2 expression during aging. In older animals, expression of the chromatin insulator protein CTCF and its binding to the Igf2-H19 imprint control region was reduced. Forced down-regulation of CTCF leads to Igf2 LOI. We further show that Igf2 LOI occurs with aging in histologically normal human prostate tissues and that this epigenetic alteration was more extensive in men with associated cancer. This finding may contribute to a postulated field of cancer susceptibility that occurs with aging. Moreover, Igf2 LOI may serve as a marker for the presence of prostate cancer.

Full text

Page 1

Aging and Cancer-Related Loss of Insulin-like Growth Factor 2
Imprinting in the Mouse and Human Prostate
Vivian X. Fu,
Rajini Srinivasan,
1Joseph R. Dobosy,
4Mark Berres,
1Joshua A. Desotelle,
3John Svaren,
1,2Nima Almassi,
4,6Richard Weindruch,
1Jonathan A. Ewald,
5,6and David F. Jarrard
1
1,2,6
1Department of Urology,
Health, Departments of
of Medicine and the Veterans Administration Geriatric Research Education and Clinical Center, and
Comprehensive Cancer Center, Madison, Wisconsin
2Environmental and Molecular Toxicology Program, University of Wisconsin School of Medicine and Public
3Genetics,
4Comparative Biosciences, School of Veterinary Medicine, University of Wisconsin,
5Department
6Paul P. Carbone
Abstract
Loss of imprinting (LOI) is an epigenetic alteration involving
loss of parental origin-specific expression at normally
imprinted genes. A LOI for Igf2, a paracrine growth factor,
is important in cancer progression. Epigenetic modifications
may be altered by environmental factors. However, is not
known whether changes in imprinting occur with aging in
prostate and other tissues susceptible to cancer development.
We found a LOI for Igf2 occurs specifically in the mouse
prostate associated with increased Igf2 expression during
aging. In older animals, expression of the chromatin insulator
protein CTCF and its binding to the Igf2-H19 imprint control
region was reduced. Forced down-regulation of CTCF leads to
Igf2 LOI. We further show that Igf2 LOI occurs with aging in
histologically normal human prostate tissues and that this
epigenetic alteration was more extensive in men with
associated cancer. This finding may contribute to a postulated
field of cancer susceptibility that occurs with aging. Moreover,
Igf2 LOI may serve as a marker for the presence of prostate
cancer. [Cancer Res 2008;68(16):6797–802]
Introduction
Our understanding of how aging predisposes to the frequent
development of prostate and other major cancers is limited.
Histologic prostate cancer is found in over 60% of men in their 70s
at autopsy (1). DNA damage accumulates in aging human prostate
tissues that results from multiple exogenous and endogenous
stressors (2). Conversely, it has been proposed that the modifica-
tion of epigenetic factors, defined as heritable changes in
information passed during cellular replication that do not involve
altered DNA sequence, underlie the gene expression changes that
occur with aging (3). Differences in DNA methylation have been
shown when identical twins are compared in older age (4). In the
colon, and recently in the prostate, DNA hypermethylation with
increasing age has been found within various genes (5, 6).
Epigenetic modifications, including histone/chromatin modifica-
tions and genomic imprinting, seem uniquely sensitive to
alterations in the cellular and organismal environment (7, 8).
Degradation of these epigenetic patterns may provide insight into
the susceptibility of cancer that develops with aging.
One manifestation of epigenetic modification is genomic
imprinting, or the allele-specific expression of a gene based on its
parental origin. The insulin-like growth factor 2 (Igf2) gene and its
closely linked 3¶ neighbor, H19, displayimprinting andareexpressed
solely from either the paternal or maternal allele, respectively (9).
The Igf2-H19 imprinted cluster shares enhancers, as well as an
intergenic imprint control region (ICR) that coordinates gene
expression (10). A major element in the control of Igf2 imprinting at
the ICR is the presence and binding of CTCF, a well-characterized
chromatin insulator that is required for repression of the maternal
Igf2 allele (11). CpG methylation at this ICR blocks the binding of
CTCF to DNA and allows the downstream enhancer to stimulate
Igf2 promoter activity across the inert boundary site. Deletion
or hypermethylation of this ICR prevents CTCF binding and results
in a reactivation of the maternal allele and the biallelic expres-
sion of Igf2 (12, 13). Strict imprinting is generally maintained
in normal adult tissues. However, the loss of imprinting (LOI) at
Igf2, a potent autocrine and paracrine growth stimulator, seems to
provide an important early switch in the progression of neoplasia
(14, 15). This has lead to the proposition that an epigenetic loss of
allelic silencing plays a role in cancer progression. In the Apc+/Min
mouse, animals displaying LOI developed twice as many intestinal
tumors as did control littermates (16). Given the plasticity of epi-
genetic controls, we examined whether imprinting of the Igf2 gene
undergoes alteration during aging in the prostate, an organ sus-
ceptible to cancer development.
Materials and Methods
Mice and diet. B6 (cast H19-p57) mice, a congenic strain heterozygous
for distal chromosome 7 sequences from C57BL/6 and Mus castaneus, were
obtained from Dr. Shirley Tilghman (Princeton University, Princeton, NJ).
Male mice homozygous for Mus castaneus alleles (H19-p57) were bred with
female C57BL/6 and male mice from each litter entered randomly into
aging groups. The animals were individually housed in the Veteran’s
Administration and University of Wisconsin Shared Aging Rodent Facility
and fed on an 84 kcal/wk diet (TD91349 [Teklad]), which is f10% less than
the average ad libitum intake, to prevent obesity and maintain health. Ten
animals per time point were euthanized at intervals (every 8 mo) beginning
at ages 3 mo. Tissues were microdissected, including the coagulating glands,
dorsolateral prostate (DLP), and ventral prostate (VP), and placed in RNase-
free PBS and snap frozen in liquid nitrogen. Nonprostate tissues were
treated identically.
cDNA preparation and quantitative PCR. Total RNA was extracted
from frozen tissues using the RNeasy Mini kit (Qiagen) as described by the
manufacturer. Total RNA was treated with DNaseI before reverse tran-
scription. cDNA was made from 1 Ag of total RNA, and oligo (dT), using
Omniscript RT reagents (Qiagen) per the manufacturer’s protocol. Reverse
transcription without reverse transcriptase was carried out to detect
genomic DNA contamination. Quantitative PCR (QPCR) was performedwith
Note: Supplementary data for this article are available at Cancer Research Online
(http://cancerres.aacrjournals.org/).
Requests for reprints: David F. Jarrard, 600 Highland Avenue, K6/530, Madison,
WI 53792. Phone: 608-263-9534; Fax: 608-265-8133; E-mail: jarrard@surgery.wisc.edu.
I2008 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-08-1714
www.aacrjournals.org
6797
Cancer Res 2008; 68: (16). August 15, 2008
Research Article

Page 2

SYBR Green (Applied Biosystems) on a MyiQ QPCR machine (Bio-Rad;
ref.17).Bothcyclophilin andGAPDH wereusedasinternalcontrolsandneither
showed altered expression with aging (data not shown). Primer sequences
for Igf2, H19, p57, CTCF, GAPDH, and cyclophilin are available on request.
Fluorescent primer extension assay. Primer extension assays were
performed as previously described (18). A single nucleotide polymorphism
was identified on Igf2 exon 6 (G/A) and used to identified individual alleles.
A 700-bp intron spanning PCR product was generated from cDNA using
primer sequences CTCTCAGGCCGTACTTCCGGAC (forward) and
GCGCCGAATTAGTTGATTT (reverse). ExoSAP-IT (U.S. Biochemical) was
used to remove excess deoxynucleotide triphosphates (dNTP) and primers
from the PCR reaction. A FAM-labeled fluorescent primer extension assay
(FluPE) primer was generated (5¶-ACCATCGGGCAAGGGGATCTCAGC).
One hudred nanograms of PCR product were added to 10 nmol/L of FAM-
labeled primer, 0.75 U of HotStarTaq Polymerase (Qiagen), 200 Amol/L of
each specific dNTP/ddNTP, 5% of DMSO, and 5 mmol/L of magnesium in a
20 AL volume. Reactions were cycled at 95jC for 15 min, then 25 cycles of
95jC 30 s and 62jC 20 s. The combination of the FluPE primer and specific
dNTP/ddNTPs (dATP,dTTP, ddCTP, and ddGTP) gives either a 2-bp or 5-bp
extension for an imprinted allele or both if imprinting is no longer
maintained. The reaction mix was loaded on ABI PRISM 377 DNA
Sequencer, which performs electrophoresis, laser detection, and imaging.
Quantitation of spectral emissions generated by laser-induced fluorescence
of fluorophore-labeled C57BL/6 and castaneus amplicons was performed as
described by Berres and colleagues (19). Differences in the relative
concentration of C57BL/6 and castaneus alleles in each sample were
determined by calculating the ratio of their respective spectral intensities
[repressed allele (Ai)/active allele (Aa)]. For Igf2, mixing experiments using
purified allelic templates determined background and confirmed the assay
to be linear for the concentration of the products analyzed. Fluorescent
primer extension was used to differentiate allelic expression with high
sensitivity (<5 parts in 100) in the linear range.
DNA methylation analyses. Bisulfite treatment of DNA, cloning, and
sequencing was performed as we have previously described (17). Primers
used to amplify bisulfite treated DNA within the H19 ICR for cloning
included CTCF 3 and CTCF 4 (available upon request). For each region, 10
to 20 colonies were picked and sequenced. Methylation-specific QPCR (MS-
qPCR) was performed as described (20). Briefly, 100 ng of bisulfilte-treated
DNA were placed in a QPCR reaction with primer pairs recognizing only
methylated sequences at CTCF3, CTCF4, and MyoD (control; sequences
available upon request). Bisulfite-treated mouse tail DNA was treated with
SssI methylase and used to generate a standard curve to quantify the
amount of fully methylated sequences in each reaction. The normalized
index of methylation was defined as the ratio of the normalized amount of
methylated template at the gene of interest to the normalized converted
MyoD template (20). Samples were run in triplicate and the mean used for
statistical comparison.
Chromatin immunoprecipitation assays. Fresh tissues were cross-
linked by mincing in 1% Formaldehyde-PBS solution for 20 min. Tissue
samples from 2 mice for each age group were pooled; washed in PBS;
resuspended in 150 mmol/LNaCl, 10% glycerol, and 50 mmol/LTris 8.0 (with
1:200 dilution of Sigma protease inhibitor cocktail); and homogenized using
the Tissue Tearor (Biospec Products). Crosslinked chromatin was prepared,
sonicated, and immunoprecipitated using 2 Ag of anti-CTCF (Upstate), or
normal rabbit IgG control antibody. After the reversal of crosslinks and DNA
purification, QPCR was performed on samples in triplicate. Values are
expressed as percent recovery compared with the input into the immu-
noprecipitation. Primers used included the following: CTCF 2 (Forward,
ACGGCGGCAGTGAAGTCTC; Reverse, CAGTTGCAATCCGTTTCAGGA);
CTCF 3 (Forward, CCCAAATGCTGCCAACTTG; Reverse, CTGGGATATTG-
CTGGGAATGA); CTCF 4 (Forward, GTCTTGCGCCCTTCACGAT; Reverse,
AAATCTGCACAGCGTGGAGAG); and H19 (Forward, AGGCCCTGTCTAAG-
GATTCCA; Reverse, CCAAAGACAGCCTCACCACAA).
Immunofluorescence and quantitation. Frozen prostate tissues from
mice were sectioned and immunostained using fluorescence-conjugated
secondary antibodies (21). Briefly, slides were fixed in PBS containing 4%
paraformaldehyde/0.2% Triton X-100/10 mmol/L NaF/1 mmol/L Na3VO4at
room temperature for 15 min. After washing, slides were blocked in PBS
containing 0.1% bovine serum albumin/10% fetal bovine serum/0.2% Triton
X-100/10 mmol/L NaF/1 mmol/L Na3VO4at room temperature for 1 h.
Rabbit polyclonal antibodies to IGF2 (sc-5622; Santa Cruz Biotechnology),
CTCF (Upstate), or mouse monoclonal antibodies to a-tubulin (Ab-1;
Oncogene Research Products) were diluted in blocking buffer at a 1:500
ratio (the linear range of detection) and incubated at 4jC overnight.
Negative controls included no primary antibodies. After washing, Alexa
594–conjugated anti-rabbit (Invitrogen) and FITC-conjugated anti-mouse
(Becton Dickson) secondary antibodies were diluted 1:2,000 in blocking
buffer containing 10 Ag/mL Hoechst 33342 (Molecular Probes) as a DNA
counter stain and incubated at room temperature for 1 h. Sections were
then washed twice in blocking buffer, aspirated, mounted beneath
coverslips, and allowed to dry overnight (21).
Stained tissues were analyzed by quantitative fluorescence microscopy as
described (21, 22). Using an Olympus BX51 microscope, digital images were
acquired using a RT Color digital camera and ProSPOT Advanced software
(Diagnostic Instruments, Inc.). Using identical camera settings, images from
five different random fields were acquired per section and the integrated
density of each whole single-color image was measured using NIH ImageJ.
Each IGF2 measurement was normalized to that of a-tubulin, a
constitutively expressed, cell-associated control.
siRNA transfection. Human prostate epithelial cells (HPEC) and mouse
prostate epithelial cells were harvested and cultured as described (23). Cell
lines were seeded to 50% confluence on collagen-coated 6-well plates
24 h before transfection. One hundred to 200 pmol of CTCF SMARTpool
(DHARMACON, Inc) siRNAs (mouse or human, respectively) were combined
in medium with Lipofectamine 2000 (Invitrogen Life Technologies)
transfection reagent following the manufacture’s protocol. The mixture
was then added dropwise to the cells in complete DMEM medium and
mixed by gentle rocking. Cells were retreated with siRNAs 12 h after the
initial transfection. RNA and protein were harvested at 48 h. Experiments
were performed in duplicate with similar results.
Statistics. Expression ratios were expressed as mean F SE and
compared using Student’s t tests. These were felt to be appropriate because
there were no observed differences in the variability between groups. We
examined the influence of age and cancer on expression ratio using an
ANOVA. P values of <0.05 were considered as significant. All analyses were
performed using SAS statistical software version 9.1, SAS Institute, Inc.
Results
To test whether Igf2 undergoes a LOI during aging in the
prostate, we determined the imprinting status of mouse prostate
tissues using a sensitive primer extension assay. C57BL/6 mice
containing a Mus castaneus Igf2-P57 locus were used to allow
differentiation between the paternal and maternal alleles based on
a polymorphism (G/A) within Igf2 exon 6. Mice have multiple
prostate lobes. The DLP most closely corresponds to the human
peripheral prostate, where prostate cancer regionally develops,
based on anatomic and RNA signature analyses (24). We observed
that DLP tissues from 3-month-old sexually mature mice mostly
retain the imprinted status of Igf2 (Fig. 1A). Igf2 and its closely
linked 3¶ neighbor H19 display imprinting in adult tissues and are
expressed solely from either the paternal or maternal allele
respectively (9). In contrast, we found older cohorts developed
progressively higher average expression from the once inactive Igf2
chromosome. To establish whether the marked LOI for Igf2
observed in the DLP of aging mice is unique to that prostate lobe,
and to the prostate in general, we analyzed VP, liver, and kidney in
aging C57BL/6 (Cast Igf2-P57) cohorts (Fig. 1B). A relaxation of
imprinting was not observed in any of these tissues indicating that
this age-associated LOI was lobe-specific for the mouse DLP.
Relaxation of Igf2 imprinting has been linked to increases in
Igf2 gene expression (12, 25). Igf2 functions as a potent autocrine
Cancer Research
Cancer Res 2008; 68: (16). August 15, 2008
6798
www.aacrjournals.org

Page 3

and paracrine growth stimulator (15) and is important in the
progression to neoplasia (14). We used qPCR initially to detect
and quantify mRNA levels in the 3-, 11-, 19-, and 24-month cohorts.
We observed age-associated increases in Igf2 mRNA levels in
DLP tissues (Fig. 2A). H19 cDNA expression decreased and ap-
proached significance (P = 0.07) with aging. Both results are
consistent with coordinate regulation from the H19 ICR (10). In
the aging cohorts, Igf2 protein expression was evaluated in the
DLP using quantitative immunofluorescence. DLP tissues from
24-month-old mice express significantly more Igf2 (30%; P = 0.01)
when compared with 3-month-old mice (Fig. 2B). The prostate
and other tissues examined did not show macroscopic morpho-
logic changes or tumors (Supplementary Fig. S1A). However,
histologic analysis of the DLP revealed both epithelial and stromal
hyperplasia within the individual glands, as well as rare glandular
atrophy. Inflammation, as assessed by CD45 a marker of lympho-
cytes (26), was minimally increased in older mouse prostate tissues
on this moderate caloric restriction protocol used to engender
longevity and health (Supplementary Fig. S1B).
To understand the mechanism involved in the relaxation of Igf2
imprinting seen in the prostate, we assessed CpG methylation at
multiple CTCF binding sites within the H19 ICR (Fig. 3A). Previous
studies in mice showed that methylation or deletion of the ICR
results in re-expression of the maternal allele and biallelic Igf2
expression (12, 13). Utilizing MS-qPCR after bisulfite treatment of
DNA, we found no significant change in methylation at CTCF
binding sites between young (3 months) and old (24 months) DLP
tissues. These results were additionally confirmed by sequencing
after bisulfite treatment. Other regions, such as the H19 promoter,
show increased methylation in the older cohort (28% F 4% versus
Figure 2. Igf2 expression increases in aging mouse DLP. A, QPCR was used
to measure Igf2 expression levels in the mouse DLP of the 3-, 11-, 19-, and
24-mo-old cohorts (n = 6; **, P < 0.01; *, P < 0.05). B and C, mouse DLP
sections were analyzed using immunofluorescence for Igf2 and a-tubulin
(control). Images from five different random fields were acquired per section
(n = 3) and the integrated density of each whole single-color image was
measured with NIH ImageJ as described. Igf2 measurements were then
normalized to that of a-tubulin. The older 24-mo cohort expresses significantly
higher levels of Igf2 protein (P < 0.01) when compared with the 3-mo group.
Figure 1. Re-expression of inactive Igf2 allele in aging mouse tissues. A, DLP
tissues were microdissected from aging mice (3, 11, 19, and 24 mo) and the
maternal and paternal allelic expression was measured using FluPE. The ratio
of the inactive allele (Ai) to active allele (Aa) was calculated for each aging cohort
(n = 6). All DLP samples in the 11-, 19-, and 24-month cohorts have significantly
higher Ai/Aaratios when compared with the 3-mo-old cohort (**, P < 0.01;
*, P < 0.05). B, Igf2 imprinting is maintained with aging in the VP and other
mouse tissues. Allelic expression from the liver, kidney, and VP was determined
using FluPE. Tissues from 3- and 19-mo-old cohorts (n = 6) were compared
and no age-associated relaxation of Igf2 imprinting was seen.
Loss of Imprinting during Aging in the Prostate
www.aacrjournals.org
6799
Cancer Res 2008; 68: (16). August 15, 2008

Page 4

38% F 2%; P = 0.04) consistent with the hypothesis of aging-related
regional DNA hypermethylation (6).
We next examined the extent to which CTCF protein binding is
altered by aging at binding sites 2, 3, and 4 within the H19 ICR in
DLP tissues. CTCF acts as an insulator by binding to the H19 ICR
and preventing enhancer binding to and expression of the Igf2
promoter (10). Using chromatin immunoprecipitation (ChIP)
assays, a significant age-associated decrease in binding was
observed at both CTCF 3 (41%; P = 0.01) and CTCF 4 (40%;
P = 0.01; Fig. 3B). No alteration in binding was seen at CTCF 2,
a site that does not regulate Igf2 promoter activity (27). In VP
tissue from the same animals, which does not show an age-related
LOI, no alteration in CTCF binding was found (Fig. 3C).
This decrease in CTCF binding to the ICR directed us to inquire
whether CTCF expression levels change in mouse DLP tissues with
aging and whether they modulate Igf2 imprinting. Expression
analyses showed an age-associated decrease of CTCF mRNA as well
as protein levels in mouse DLPs (Supplementary Fig. S2A). To
determine the effect of CTCF expression on Igf2 imprinting, we
knocked down CTCF levels in mouse prostate epithelial cells
cultured from the DLP, and HPECs using siRNA. CTCF protein
expression was reduced 30% to 50% in transfected cell lines using
pooled CTCF siRNAs specific for the human or mouse gene
(Supplementary Fig. S2B). After 48 h, no morphologic changes were
noted in the transfected cells. QPCR showed a f30% to 70%
silencing of CTCF RNA expression in siRNA-transfected mouse and
human cultures when compared with controls (data not shown).
Increased expression (Ai/Ae= 8–18%) of the silenced/imprinted Igf2
allele was reproducibly shown after siRNA transfection using FluPE
(Supplementary Fig. S2). Hence, a loss of CTCF expression and
binding to the H19 ICR resulted in biallelic Igf2 expression. To
understand better the implications of this prostate-specific epige-
netic change, we next focused on determining whether Igf2 imprint-
ing alterations occur in the peripheral prostate of aging men.
Prostate tissues from men ages 17 to 81 years old with and
without associated prostate cancer were analyzed. Given the pre-
dilection of human prostate cancer for the peripheral zone, we
focused our analysis on this region. Using FluPE, a polymorphism
(G to C) within the Igf2 coding sequence was used to quantitate
allele-specific expression. Overall, a significant trend toward LOI
with aging was seen when all samples were included and
statistically analyzed in a linear fashion (P = 0.02; Fig. 4A). We
then analyzed only those samples without associated prostate
cancer. The imprint status of peripheral prostate tissue from a
cohort of older men (55–81 years; mean, 64 years) without cancer
(Ai/Aa= 28%) was suggestively more relaxed than from younger
(18–40 years; mean, 27 years) patients (Ai/Aa= 24%; P = 0.2). When
the allelic expression ratios were compared for older men with
associated cancer to the age-matched group without prostate
cancer (60% versus 28%), a significant difference (P < 0.001) was
seen. Thus, we find a more extensive relaxation in imprinting
develops in the prostates of men who have associated cancer.
Discussion
Our findings confirm that the Igf2 imprint is not stable in adult
mammals, but rather undergoes degradation with aging. Further-
more, in humans, it is associated with a ‘‘field effect’’ that develops
in the peripheral prostate containing cancer. Several factors
implicated in aging may play a role in this LOI including oxidative
stress, diet, hormones, and environmental toxicants (7, 8, 28). There
is remarkable variation in the rate of epigenetic degradation within
and among organs with aging. Although the extent of this LOI with
aging in the mouse prostate is extensive (>60%), we do not show a
significant change in the kidney or liver. Minor changes in Igf2
imprinting (<6%), not linked to expression, have been recognized in
the heart tissue from aging mice (18). We also find that Igf2 LOI
with aging extensively involves the DLP of mice but not the VP.
This is of interest, owing to the anatomic homology of the DLP to
the peripheral prostate in the human (24, 29), the region where
prostate cancer most commonly develops. One observation that has
Figure 3. Decrease of CTCF binding in aging mouse DLP. A, schematic of
the Igf2-H19 genomic region showing the ICR containing four CTCF binding
sites. Methylation analysis using Methylation-sensitive PCR and bisulfite cloning
of CTCF binding sites 3 (63% F 6% versus 52% F 3%; P = 0.16) and 4
(58% F 5% versus 47% F 5%; P = 0.26) did not show any differences when
young and old animals were compared (n = 5). CTCF 3 and 4 represent the
major target sites for CTCF binding in this region, whereas CTCF 2 does not
display nuclease hypersensitivity. B, ChIP assay was performed to examine
CTCF protein binding alterations at CTCF binding sites 2, 3, and 4 within the
H19 ICR in aging mouse DLP. A significant decrease in binding is noted in
older (24 mo) versus younger (3 mo) cohorts at both CTCF 4 and CTCF 3
(**, P < 0.01; n = 6). No alteration in CTCF 2 binding (a site that does not
regulate Igf2 promoter activity) is seen. C, no significant change in CTCF binding
is seen when the older cohort is compared with younger in the VP, a tissue found
to retain imprinting. Binding to IgG was used as a nonspecific control for the
experiments.
Cancer Research
Cancer Res 2008; 68: (16). August 15, 2008
6800
www.aacrjournals.org

Page 5

led to the development of the hypothesis that tissue-specific imprint-
ingdegradeswith aging wasour findingthatIgf2 LOIislimited to the
peripheral zone of human prostates, and not found in the transition
zone where benign prostatic hyperplasia occurs (30).
A number of factors are involved in Igf2 imprinting control,
including DNA methylation, the covalent modification of histone
proteins, and the binding of the insulator protein CTCF (10, 11).
One target of this observed loss of epigenetic control is the
chromatin-associated protein CTCF, a zinc finger binding protein.
We show that a forced decrease in CTCF expression in both human
and mouse prostate epithelial cells leads to a re-expression of the
paternal Igf2 allele. In the mouse prostate, a decrease in CTCF
expression with aging was associated with a loss of CTCF binding
at the H19 ICR. This decrease in CTCF expression has also been
recognized in vitro with the development of cellular senescence
(17). Our finding that substantial changes Igf2 imprinting occur in
the absence of significant methylation changes at the H19 ICR, an
observation seen in other human genitourinary tissues (31),
challenge the central dogma that DNA methylation solely controls
Igf2 imprinting in the human (13). Imprinting in Wilms’ tumors
may also be maintained in the presence of aberrant methylation at
CTCF core sites within the H19 ICR (32). It has been also found
that polycomb group proteins expressed from the maternal
genome, not DNA methylation, control paternal MEAEA silencing
(33). These data emphasize the emerging importance of chromatin
factors, including CTCF, in the regulation of imprinting.
Histologic prostate cancer is pervasive in aging men (1). Our
finding of a significantly greater relaxation of Igf2 imprinting in
histologically normal tissues from men with associated prostate
cancer compared with men without the disease suggests a role for
Igf2 LOI in the postulated field effect encompassing prostate
tissues and influencing them to develop cancer (Fig. 4B). Further
support for this field effect is evidenced by the typical finding of
5 separate foci of cancer in found in human prostates removed for
malignancy (34). Other gene expression alterations may mark this
global tissue defect in the peripheral prostate (35). The finding that
Apc+Min mice that biallelically express Igf2 have enhanced
intestinal tumor development compared with monoallelic expres-
sion suggests LOI is a risk factor for tumor development in the
susceptible organ (16). We anticipate this epigenetic alteration
involving LOI may find use as a marker for patients with prostate
cancer. Furthermore, it is likely that men who are better able to
maintain Igf2 imprinting status with aging have a decreased risk of
prostate cancer development.
Disclosure of Potential Conflicts of Interest
R. Weindruch is a founder of LifeGen Technologies, LLC. The other authors
disclosed no potential conflicts of interest.
Acknowledgments
Received 5/6/2008; revised 6/9/2008; accepted 6/16/2008.
Grant support: NIH (R01CA97131), the University of Wisconsin George M. O’Brien
Urology Research Center (1P50DK065303), the John Livesey endowment, the
Department of Defense Prostate Cancer Research Program (DAMD17-02-1-0163),
NIH training grant T32 AG000213-16 to the Biology of Aging and Age-related Diseases
Training Program (J.R. Dobosy), and T32 CA009681 to the University of Wisconsin
McArdle Laboratory Cancer Biology Training Progarm (J.A. Ewald).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Raj Dhir and Dr. Joel B. Nelson at the University of Pittsburgh for their
contribution of samples used in this work, Dr. William Dove for his review and helpful
comments, Dr. Terry Oberley for interpretation of the mouse prostate histology, and
Dr. Glen Leverson for the statistical support.
Figure 4. Relaxation of Igf2 imprinting in aging histologically normal human prostate tissues with and without associated cancer. A, prostate tissues from donors
of various ages were analyzed using FluPE. The imprint status from younger patients ages <40 y (mean, 27 y) was significantly (P = 0.02) more imprinted when
compared with a cohort of tissues from patients older than 55 y (mean, 64 y). Histologically normal peripheral prostate tissues from men with associated prostate cancer
(mean, 63 y) showed a greater associated LOI (60%) than an age-matched noncancer associated cohorts (**, P < 0.01). Interestingly, variations in Ai/Aaratios
within groups of younger men even without associated cancer are seen. These were not associated with the presence of inflammation on histology. B, model of
epigenetic changes in the prostate with aging. The imprinting of Igf2 (expression of single allele depicted in cell) is maintained in prostate tissues from young mammals.
In rodents, who poorly maintain epigenetic patterns, and in humans with associated cancer, a marked loss of Igf2 imprinting (LOI) occurs. This LOI generates a
‘‘field effect’’ throughout the peripheral zone of the prostate that is associated with the development of prostate cancer in multiple areas. Other genetic and epigenetic
factors are required for the development of malignancy. Igf2 imprinting patterns are generally maintained and cancer risk is lower in individuals who maintain Igf2
imprinting.
Loss of Imprinting during Aging in the Prostate
www.aacrjournals.org
6801
Cancer Res 2008; 68: (16). August 15, 2008

Page 6

Cancer Research
Cancer Res 2008; 68: (16). August 15, 2008
6802
www.aacrjournals.org
References
1. Sakr WA, Grignon DJ, Crissman JD, et al. High grade
prostatic intraepithelial neoplasia (HGPIN) and prostatic
adenocarcinoma between the ages of 20–69: an autopsy
study of 249 cases. In Vivo 1994;8:439–43.
2. Malins DC, Johnson PM, Wheeler TM, et al. Age-
related radical-induced DNA damage is linked to
prostate cancer. Cancer Res 2001;61:6025–8.
3. Bandyopadhyay D, Medrano EE. The emerging role of
epigenetics in cellular and organismal aging. Exp
Gerontol 2003;38:1299–307.
4. Fraga MF, Ballestar E, Paz MF, et al. Epigenetic
differences arise during the lifetime of monozygotic
twins. Proc Natl Acad Sci U S A 2005;102:10604–9.
5. Ahuja N, Li Q, Mohan AL, Baylin SB, Issa JP. Aging and
DNA methylation in colorectal mucosa and cancer.
Cancer Res 1998;58:5489–94.
6. Kwabi-Addo B, Chung W, Shen L, et al. Age-related
DNA methylation changes in normal human prostate
tissues. Clin Cancer Res 2007;13:3796–802.
7. Thompson SL, Konfortova G, Gregory RI, et al.
Environmental effects on genomic imprinting in mam-
mals. Toxicol Lett 2001;120:143–50.
8. McLachlan JA, Burow M, Chiang TC, Li SF. Gene
imprinting in developmental toxicology: a possible
interface between physiology and pathology. Toxicol
Lett 2001;120:161–4.
9. Giannoukakis N, Deal C, Paquette J, Goodyer CG,
Polychronakos C. Parental genomic imprinting of the
human IGF2 gene. Nat Genet 1993;4:98–101.
10. Lewis A, Reik W. How imprinting centres work.
Cytogenet Genome Res 2006;113:81–9.
11. Kanduri C, Pant V, Loukinov D, et al. Functional
association of CTCF with the insulator upstream of the
H19 gene is parent of origin-specific and methylation-
sensitive. Curr Biol 2000;10:853–6.
12. Thorvaldsen JL, Duran KL, Bartolomei MS. Deletion
of the H19 differentially methylated domain results in
loss of imprinted expression of H19 and Igf2. Genes Dev
1998;12:3693–702.
13. Bell AC, Felsenfeld G. Methylation of a CTCF-
dependent boundary controls imprinted expression of
the Igf2 gene.[comment]. Nature 2000;405:482–5.
14. Christofori G, Naik P, Hanahan D. A second signal
supplied by insulin-like growth factor II in oncogene-
induced tumorigenesis. Nature 1994;369:414–8.
15. Rogler CE, Yang D, Rossetti L, et al. Altered body
composition and increased frequency of diverse malig-
nancies in insulin-like growth factor-II transgenic mice.
J Biol Chem 1994;269:13779–84.
16. Sakatani T, Kaneda A, Iacobuzio-Donahue CA, et al.
Loss of imprinting of Igf2 alters intestinal maturation
and tumorigenesis in mice. Science 2005;307:1976–8.
17. Fu VX, Schwarze SR, Kenowski ML, et al. A loss of
insulin-like growth factor-2 imprinting is modulated by
CCCTC-binding factor down-regulation at senescence in
human epithelial cells. J Biol Chem 2004;279:52218–26.
18. Bennett-Baker PE, Wilkowski J, Burke DT. Age-
associated activation of epigenetically repressed genes
in the mouse. Genetics 2003;165:2055–62.
19. Berres MR, Engels WR, Kirsch JAW. A method for
genotyping ostensibly dominant markers in AFLP
fingerprints. Genetics. In press, 2008.
20. Yegnasubramanian S, Kowalski J, Gonzalgo ML, et al.
Hypermethylation of CpG islands in primary and
metastatic human prostate cancer. Cancer Res 2004;64:
1975–86.
21. Inman CF, Rees LE, Barker E, et al. Validation of
computer-assisted, pixel-based analysis of multiple-
colour immunofluorescence histology. J Immunol Meth-
ods 2005;302:156–67.
22. Smith PD, McLean KJ, Murphy MA, et al. A
brightness-area-product-based protocol for the quanti-
tative assessment of antigen abundance in fluorescent
immunohistochemistry. Brain Res Brain Res Protoc
2005;15:21–9.
23. Jarrard DF, Sarkar S, Shi Y, et al. p16/pRb pathway
alterations are required for bypassing senescence in
human prostate epithelial cells. Cancer Res 1999;59:
2957–64.
24. Berquin IM, Min Y, Wu R, Wu H, Chen YQ.
Expression signature of the mouse prostate. J Biol
Chem 2005;280:36442–51.
25. Szabo PE, Mann JR. Allele-specific expression
and total expression levels of imprinted genes
during early mouse development: implications
for imprinting mechanisms. Genes Dev 1995;9:3097–108.
26. Baur JA, Pearson KJ, Price NL, et al. Resveratrol
improves health and survival of mice on a high-calorie
diet. Nature 2006;444:337–42.
27. Kanduri C, Holmgren C, Pilartz M, et al. The 5¶ flank
of mouse H19 in an unusual chromatin conformation
unidirectionally blocks enhancer-promoter communica-
tion. Curr Biol 2000;10:449–57.
28. Waterland RA, Jirtle RL. Transposable elements:
targets for early nutritional effects on epigenetic gene
regulation. Mol Cell Biol 2003;23:5293–300.
29. Price D. Comparative aspects of development and
structure in the prostate. Natl Cancer Inst Monogr 1963;
12:1–27.
30. Jarrard DF, Bussemakers MJ, Bova GS, Isaacs WB.
Regional loss of imprinting of the insulin-like growth
factor II gene occurs in human prostate tissues. Clin
Cancer Res 1995;1:1471–8.
31. Byun HM, Wong HL, Birnstein EA, et al. Examination
of IGF2 and H19 loss of imprinting in bladder cancer.
Cancer Res 2007;67:10753–8.
32. Cui H, Niemitz EL, Ravenel JD, et al. Loss of
imprinting of insulin-like growth factor-II in Wilms’
tumor commonly involves altered methylation but not
mutations of CTCF or its binding site. Cancer Res 2001;
61:4947–50.
33. Gehring M, Huh JH, Hsieh TF, et al. DEMETER DNA
glycosylase establishes MEDEA polycomb gene self-
imprinting by allele-specific demethylation. Cell 2006;
124:495–506.
34. Epstein JI, Carmichael MJ, Partin AW, Walsh PC.
Small high grade adenocarcinoma of the prostate in
radical prostatectomy specimens performed for non-
palpable disease: pathogenetic and clinical implications.
J Urol 1994;151:1587–92.
35. Chandran UR, Dhir R, Ma C, et al. Differences in gene
expression in prostate cancer, normal appearing pros-
tate tissue adjacent to cancer and prostate tissue from
cancer free organ donors. BMC Cancer 2005;5:45.