Article

A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection.

The Wistar Institute, Philadelphia, PA, USA.
The EMBO Journal (Impact Factor: 10.75). 09/2012; DOI: 10.1038/emboj.2012.266
Source: PubMed

ABSTRACT The contribution of human subtelomeric DNA and chromatin organization to telomere integrity and chromosome end protection is not yet understood in molecular detail. Here, we show by ChIP-Seq that most human subtelomeres contain a CTCF- and cohesin-binding site within ∼1-2 kb of the TTAGGG repeat tract and adjacent to a CpG-islands implicated in TERRA transcription control. ChIP-Seq also revealed that RNA polymerase II (RNAPII) was enriched at sites adjacent to the CTCF sites and extending towards the telomere repeat tracts. Mutation of CTCF-binding sites in plasmid-borne promoters reduced transcriptional activity in an orientation-dependent manner. Depletion of CTCF by shRNA led to a decrease in TERRA transcription, and a loss of cohesin and RNAPII binding to the subtelomeres. Depletion of either CTCF or cohesin subunit Rad21 caused telomere-induced DNA damage foci (TIF) formation, and destabilized TRF1 and TRF2 binding to the TTAGGG proximal subtelomere DNA. These findings indicate that CTCF and cohesin are integral components of most human subtelomeres, and important for the regulation of TERRA transcription and telomere end protection.

0 Bookmarks
 · 
235 Views
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: OBJECTIVE: To study whether the telomere structure of germ cells from idiopathic infertile men is altered and if this impairment is influenced by meiotic recombination and telomere length. DESIGN: We performed a detailed analysis of both telomeric repeat-containing RNA (TERRA) and telomerase distribution in testis cell spreads by combining immunofluorescence and RNA fluorescent in situ hybridization. In addition we analyzed meiotic recombination between homologous chromosomes by immunofluorescence and telomere length by quantitative fluorescent in situ hybridization. SETTING: University. PATIENT(S): Men consulting for fertility problems. INTERVENTION(S): Unilateral testicular biopsies. MAIN OUTCOME MEASURE(S): We observed that TERRA levels and its nuclear distribution were compromised in infertile patients. In addition, the presence of the protein component of telomerase at telomeres decreased in the affected patients. However, neither telomerase-TERRA association nor telomere length was altered in spermatocytes I of infertile samples compared with control individuals. In addition, we observed that meiotic recombination was reduced in infertile individuals. RESULT(S): Telomere homeostasis is impaired in infertile patients, and this was translated into a decrease in TERRA levels together with an alteration of the TERRA-protein component of telomerase telomeric association in primary spermatocytes. CONCLUSION(S): This study demonstrates for the first time that telomere structure and homeostasis in germ cells is compromised in infertile individuals. In the light of our results we propose that the analysis of telomeric structure (i.e., TERRA levels and telomere association with TERRA and telomerase) would provide new tools for our understanding of the origin of human infertility.
    Fertility and Sterility 07/2014; · 4.30 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Telomeres are ribonucleoprotein structures at the end of chromosomes composed of telomeric DNA, specific-binding proteins and noncoding RNA (TERRA). Despite their importance in preventing chromosome instability, little is known about the crosstalk between these three elements during the formation of the germ line. Here, we provide evidence that both TERRA and the telomerase enzymatic subunit (TERT) are components of telomeres in mammalian germ cells. We found that TERRA co-localizes with telomeres during mammalian meiosis and that its expression progressively increases during spermatogenesis, until the beginning of spermiogenesis. While both TERRA levels and distribution would be regulated in a gender-specific manner, telomere-TERT co-localization appears to be regulated based on species-specific characteristics of the telomeric structure. Moreover, we found that TERT localization at telomeres is maintained all through spermatogenesis as a structural component without affecting telomere elongation. Our results represent the first evidences of co-localization between telomerase and telomeres during mammalian gametogenesis.
    Biology of Reproduction 04/2014; · 3.45 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate early (IE), early (E) and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by shRNA results in an increase in the major IE (MIE) and early gene expression and about 50-fold increase of HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of MIE gene that directly interacts with CTCF. Deletion of this CTCF binding site led to an increase in MIE gene expression in both transient transfection and infection assays. Deletion of the CTCF binding site in the HCMV BACmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of cytmegalovirs (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. First, it is, for the first time that a chromatin-organizing factor CTCF has been discovered to facilitate human CMV (HCMV) gene expression that leads to affecting viral replication. Second, the we identified a CTCF-binding motif in the first intron (also called intron A)that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.
    Journal of Virology 04/2014; · 4.65 Impact Factor

Full-text

Download
61 Downloads
Available from
May 21, 2014