Isolation, sequence and expression of the gene encoding human keratin 13 [published erratum appears in Gene 1998;221:287]

Department of Craniofacial Development, Guy's Dental School, Floor 28, Guy's Tower, London Bridge, London, SE1 9RT, UK.
Gene (Impact Factor: 2.14). 07/1998; 215(2):269-279. DOI: 10.1016/S0378-1119(98)00297-2


Keratins are a family of highly homologous proteins expressed as pairs of acidic and basic forms which make intermediate filaments in epithelial cells. Keratin 13 (K13) is the major acidic keratin, which together with K4, its basic partner, is expressed in the suprabasal layers of non-cornified stratified epithelia. The mechanism which allows mucosal-specific expression of this keratin remains unknown. To provide insight into the tissue-specific expression, we have isolated the human K13 gene by screening a chromosome 17 library with a specific K13 cRNA probe. Sequence analysis of unidirectional deletions produced by transposon Tn3 has revealed that the gene is 4601 nucleotides long and contains seven introns and eight exons. When driven by the CMV promoter, the gene produced K13 protein in MCF-7 cells, which normally do not express this protein. Two transcription-start sites were identified, the major being at 61 and the minor at 63 nucleotides upstream of ATG. The upstream sequence contained a TATA box and several other putative transcription factor binding sites. A single copy of the K13 gene was detected in the human genome by Southern hybridisation and polymerase chain reaction. K13 mRNA shows differential expression in cultured keratinocytes, and in A431 cells the RNA levels remained independent of calcium concentrations in the culture medium. Characterisation of the human K13 gene will facilitate elucidation of the molecular mechanism regulating K13 expression in mucosal tissues.

Download full-text


Available from: Bilal Dogan, Jan 05, 2015
9 Reads
  • Source
    • "K13, a major acidic keratin, is expressed in the suprabasal layers of non-cornified stratified epithelia and is mucosa-specific [21]. In addition, K13 is present in the suprabasal layers of most stratified squamous epithelia, such as mucosal epithelia and regenerating epidermis [22,23]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: To evaluate the expression patterns of cytokeratin (K) 12, 13, and 19 in normal epithelium of the human ocular surface to determine whether K13 could be used as a marker for conjunctival epithelium. Total RNA was isolated from the human conjunctiva and central cornea. Those transcripts that had threefolds or higher expression levels in the conjunctiva than the cornea were identified using microarray technique. Expression levels of three known signature genes and of two conjunctival genes, K13 and K19 were confirmed by using quantitative real-time PCR (qRT-PCR). Protein expression of K12, K13, and K19 was confirmed by immunostaining with specific antibodies on histologic sections of human sclerocornea that contained the conjunctiva, limbus, and cornea and on impression cytology (IC) specimens of the cornea and conjunctiva from normal donors. Double staining of K13/K12 and K19/K12 on histologic sections and IC specimens was performed. There were 337 transcripts that were preferentially expressed in the conjunctiva. K13 and K19 were among the top twenty transcripts in the conjunctiva and this preferential expression pattern of K13 and K19 was confirmed by qRT-PCR. Immunohistochemical studies showed that K13 was expressed at the posterior limbal epithelium and conjunctival epithelium but was totally absent in the cornea. K12 was expressed in the corneal and anterior limbal epithelia except for the basal layer and was absent from the conjunctiva. In contrast, K19 was detected in the corneal, limbal and conjunctival epithelia. Immunostaining of the IC specimens showed K12(+) epithelial cells in the corneal region, K13(+) cells in the conjunctival area, and K19(+) cells in the corneal and conjunctival specimens. Expression of K13 and K12 on the ocular surface was mutually exclusive on both the histologic and IC samples using double immunostaining. K13 is more specific to the conjunctival epithelial cells than K19 and potentially could be used as a marker to identify conjunctival epithelial cells in limbal stem cell deficiency.
    Molecular vision 06/2011; 17:1652-61. · 1.99 Impact Factor
  • Source
    • "mucosa). Keratin 13 expression is known to be regulated by calcium and nuclear receptor ligands such as retinoids and 1α,25-dihydroxyvitamin D3, but little is known about KRT13 regulation by estrogens or SERMs (Waseem et al., 1998). Olson et al. showed that keratin 13 was up-regulated in human luminal epithelial cells of secretory phase endometrium, suggesting that KRT13 might play a role in preparation for the implantation process (Olson et al., 2002). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Expression of the Keratin 13 (KRT13) gene, which encodes a cytoskeletal protein thought to play important roles in breast cancer growth and metastasis, is differentially regulated by estradiol (E2) and the selective estrogen receptor modulators (SERMs) tamoxifen and raloxifene. While stimulation of KRT13 by tamoxifen is robust and prolonged, stimulation by E2 is more transient and raloxifene has virtually no effect. To investigate the mechanistic basis for the differential ligand regulation of KRT13, we have defined the regulatory regions of KRT13, compared gene expression by E2 and SERMs, and explored the magnitudes and time courses of estrogen receptor (ER) and cofactor recruitment patterns on these regions. Using a ChIP scanning approach and reporter transactivation assays, we identified a 2.5 kb upstream ER-binding regulatory region for KRT13. Directed composite mutations in this region revealed that three estrogen response elements and three Sp1 sites were involved in its ligand-dependent regulation. Differential recruitment of ERalpha and cofactors to the KRT13 regulatory sites paralleled the different time course and magnitude of regulation by these ligands: there was almost no ERalpha or cofactor recruitment with raloxifene, whereas there was strong, prolonged ER recruitment and histone acetylation with tamoxifen, and an early and more transient recruitment with E2. Taken together, our results suggest that the different ligand regulations of KRT13 are due to ligand-differential recruitment of ER and coactivators, and they provide insight into the mechanisms responsible for the different agonistic activities and differential gene regulation by estradiol and the SERMs tamoxifen and raloxifene.
    Molecular and Cellular Endocrinology 11/2008; 296(1-2):1-9. DOI:10.1016/j.mce.2008.09.022 · 4.41 Impact Factor
  • Source
    • "The K14 fragment was prepared by PCR amplification using a forward (AGGACGGAATTCTCTCCTCCTCCC- AGT) and a reverse (GAGCGGGGAAGCTTAGCCTCAGTTCTTGG) primer from the 3Ј end of K14 cDNA (Marchuk et al, 1985). The K15 cDNA was synthesized by Superscript reverse transcriptase (GibcoBRL/ Life Tech, Glasgow, U.K.) with total RNA purified from A-431 cells and a K15 specific primer (CTTGCTCCAAAGAAGGTGGGG) following the protocol described previously (Waseem et al, 1990, 1998). Using the reverse transcriptase reaction mixture as a source of cDNA, the K15 fragment was amplified using a forward (AGAAATCTGAATTCCTATTGCAGGAGA) and a reverse (CCCTGAAAGCTTAGACCGAGGGACCCT) primer. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Keratin 15 (K15) is a type I keratin without a defined type II partner whose expression in epidermal diseases has not been investigated. In this study we have used LHK15, a monoclonal antibody raised against the last 17 amino acids of the K15 polypeptide, to show that K15 is expressed primarily in the basal keratinocytes of stratified tissues, including the fetal epidermis and fetal nail. Although K15 in normal hair follicles was virtually absent from hair bulbs, it was expressed by a subset of keratinocytes in the outer root sheath. By comparison, K14 expression was found throughout the outer root sheath of hair follicles; however, when both K14 alleles were naturally ablated, the expression of K15 was also observed throughout the outer root sheath of the follicles. Expression of K15 mRNA was assessed by in situ hybridization and corroborated the data from immunostaining. An increase in K15 mRNA and protein expression in hair follicles from the K14 ablated epidermis suggested an upregulation of the K15 gene in the absence of the K14 protein. In organotypical cultures where differentiating keratinocytes expressed markers of activated phenotype, i.e., K6 and K16, expression of K15 was undetectable. The expression of K15 mRNA and protein was also downregulated in two hyperproliferating situations, psoriasis and hypertrophic scars. Because keratinocytes in psoriasis and hypertrophic scars are activated, we conclude that K15 expression is not compatible with keratinocyte activation and the K15 gene is downregulated to maintain the activated phenotype.
    Journal of Investigative Dermatology 04/1999; 112(3):362-9. DOI:10.1046/j.1523-1747.1999.00535.x · 7.22 Impact Factor
Show more