The Drosophila Neurally Altered Carbohydrate Mutant Has a Defective Golgi GDP-Fucose Transporter

Abstract

Studying genetic disorders in model organisms can provide insights into heritable human diseases. The Drosophila neurally altered carbohydrate (nac) mutant is deficient for neural expression of the HRP epitope, which consists of N-glycans with core α1,3-linked fucose residues. Here, we show that a conserved serine residue in the Golgi GDP-fucose transporter (GFR) is substituted by leucine in nac1 flies, which abolishes GDP-fucose transport in vivo and in vitro. This loss of function is due to a biochemical defect, not to destabilization or mis-targeting of the mutant GFR protein. Mass spectrometry and HPLC analysis showed that nac1 mutants lack not only core α1,3-linked, but also core α1,6-linked fucose residues on their N-glycans. Thus, the nac1 Gfr mutation produces a previously unrecognized general defect in N-glycan core fucosylation. Transgenic expression of a wild-type Gfr gene restored the HRP epitope in neural tissues, directly demonstrating that the Gfr mutation is solely responsible for the neural HRP epitope deficiency in the nac1 mutant. These results validate the Drosophila nac1 mutant as a model for the human congenital disorder of glycosylation, CDG-IIc (also known as LAD-II), which is also the result of a GFR deficiency.

Full text

Page 1

The Drosophila Neurally Altered Carbohydrate Mutant Has a
Defective Golgi GDP-fucose Transporter*
Receivedforpublication,May8,2012,andinrevisedform,June21,2012 Published,JBCPapersinPress,June27,2012,DOI10.1074/jbc.M112.379313
Christoph Geisler‡, Varshika Kotu§, Mary Sharrow§, Dubravko Rendic ´¶, Gerald Pöltl¶, Michael Tiemeyer§,
Iain B. H. Wilson¶, and Donald L. Jarvis‡1
Fromthe‡DepartmentofMolecularBiology,UniversityofWyoming,Laramie,Wyoming82071,the§ComplexCarbohydrate
ResearchCenter,UniversityofGeorgia,Athens,Georgia30602,andthe¶DepartmentfürChemie,UniversitätfürBodenkultur,
A-1190 Wien, Austria
Background: The defect underlying reduced HRP epitope expression in Drosophila nac1mutants has not been identified.
Results: nac1flies have a defective GDP-fucose transporter.
Conclusion:Thedefectivenac1transportercannotsupportnormalN-glycancorefucosylation,leadingtoreducedHRPepitope
expression.
Significance: nac1flies are a valid model for the human congenital disorder of glycosylation, CDG-IIc, which is caused by a
similar molecular defect.
Studying genetic disorders in model organisms can provide
insightsintoheritablehumandiseases.TheDrosophilaneurally
alteredcarbohydrate(nac)mutantisdeficientforneuralexpres-
sion of the HRP epitope, which consists of N-glycans with core
?1,3-linkedfucoseresidues.Here,weshowthataconservedser-
ineresidueintheGolgiGDP-fucosetransporter(GFR)issubsti-
tutedbyleucineinnac1flies,whichabolishesGDP-fucosetrans-
port in vivo and in vitro. This loss of function is due to a
biochemicaldefect,nottodestabilizationormistargetingofthe
mutant GFR protein. Mass spectrometry and HPLC analysis
showed that nac1mutants lack not only core ?1,3-linked, but
also core ?1,6-linked fucose residues on their N-glycans. Thus,
the nac1Gfr mutation produces a previously unrecognized gen-
eraldefectinN-glycancorefucosylation.Transgenicexpression
of a wild-type Gfr gene restored the HRP epitope in neural tis-
sues, directly demonstrating that the Gfr mutation is solely
responsible for the neural HRP epitope deficiency in the nac1
mutant. These results validate the Drosophila nac1mutant as a
model for the human congenital disorder of glycosylation,
CDG-IIc (also known as LAD-II), which is also the result of a
GFR deficiency.
Congenital disorders of glycosylation (CDGs)2are a pheno-
typically diverse group of heritable diseases caused by muta-
tionsingenesfunctioninginglycosylation(recentlyreviewedin
Refs. 1–3). The first congenital disorders that were recognized
to have altered glycosylation patterns were identified in
humans(4–7).Thesedisorderswerelaterfoundtoinvolvedefi-
ciencies in N-glycan biosynthesis and processing (8–11) that
were caused by mutations in genes encoding those functions
(12–15).
The first CDG reported in a non-human organism was nac
(neurally altered carbohydrate), which was identified in Dro-
sophila. nac mutants have reduced levels of a neural carbohy-
drate epitope that is produced by ?1,3-linkage of a fucose resi-
due to the N-glycan core (16–18). Due to its identification as a
dominant epitope in the plant glycoprotein horseradish perox-
idase, this core ?1,3-fucosylated N-glycan is also known as the
horseradish peroxidase (HRP) epitope (19, 20).
In Drosophila, the HRP epitope is expressed mainly in the
central nervous system (CNS) (21–23), where it is produced by
a fucosyltransferase designated FucTA (24–26). FucTA is a
Golgi-resident enzyme that transfers fucose from the donor
substrate GDP-fucose to the proximal N-acetylglucosamine
residue of N-glycans (Fig. 1A). GDP-fucose is produced in the
cytoplasm (27) and transported into the Golgi apparatus by
GFR, a specific GDP-fucose transporter, in exchange for GMP
(Fig.1A)(28,29).TheDrosophilaGfrgeneishomologoustothe
human GFR gene, which is defective in a congenital disorder of
glycosylation known as CDG-IIc and also known as Type II
leukocyte adhesion deficiency (LAD-II) (30, 31) or SLC35C1-
CDG (32).
The original nac mutant, which was later redesignated nac1
to distinguish it from other alleles, has a temperature-insensi-
tive loss of the neural HRP epitope associated with other cold-
sensitive phenotypes expressed at 18 °C but not 25 °C (33, 34).
Katz et al. (33) cytogenetically mapped the nac1mutation to
the region between 84F4 and 84F11-12, which includes
about 32 genes. Subsequent work showed that the Gfr gene,
which encodes a Golgi GDP-fucose transporter, is located in
this region (28). This finding hinted that a Gfr mutation
might be responsible for nac1because a defect in the ability
to transport GDP-fucose into the Golgi apparatus could
account for the reduced neural HRP epitope in the nac1fly.
This speculation was strengthened by data showing that
homozygous Gfr knock-out flies have temperature-sensitive
* This work was supported, in whole or in part, by National Institutes of
Health, NIGMS, Grants R01GM072839 (to M. T.) and R01GM49734 (to
D. L. J.).ThisworkwasalsosupportedbyAustrianFondszurFörderungder
Wissenschaftlichen Forschung Grant P17681 (to I. B. H. W.).
1To whom correspondence should be addressed. Tel.: 307-766-4282; Fax:
307-766-5098; E-mail: dljarvis@uwyo.edu.
2The abbreviations used are: CDG, congenital disorder of glycosylation; ER,
endoplasmicreticulum;ESI,electrosprayionization;NST,nucleotidesugar
transporter; RP-HPLC, reverse phase HPLC; eGFP, enhanced GFP; UAS,
upstream activating sequence.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 35, pp. 29599–29609, August 24, 2012
© 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29599
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 2

Notch-like wing phenotypes (35), which are similar to the
temperature-sensitivescallopedwingphenotypeobservedin
the nac1mutant (34). However, neither the gene(s) mutated
in nac1flies nor the precise nature of the mutation have been
elucidated. Thus, we examined the Gfr gene in the Drosoph-
ila nac1mutant and found that nac1flies have a mutant Gfr
gene, which encodes a defective Golgi GDP-fucose trans-
porter that is solely responsible for its neural HRP epitope
deficiency.
EXPERIMENTAL PROCEDURES
Genomic DNA Analysis—nac1homozygous flies were
obtainedfromtheBloomingtonDrosophilaStockCenter(Indi-
ana University) and maintained at 28 °C. Genomic DNA was
extracted from a single adult fly, as described previously (36).
Briefly, the fly was homogenized in a lysis buffer containing
RNase A, and the homogenate was incubated at 55 °C for 1 h.
The lysate was briefly centrifuged to remove debris, and the
DNA was precipitated. The DNA was dissolved in TE buffer
and extracted once with phenol/chloroform, and 1 ?l of the
resulting DNA preparation was used as the template for a PCR
with primers that flanked the Gfr gene transcript (AAGGGA-
TGGGGCCAAGAAGC and AATCCACCCCCGCACTC-
AAC). All PCRs were performed using PhusionTMDNA
polymerase (New England Biolabs). Agarose gel electrophore-
sis showed that the PCR yielded a single major amplification
product of the expected size, which was gel-purified using the
Qiaquick gel purification kit (Qiagen) and directly sequenced
with the primers used for the PCR.
Expression Plasmids and Baculoviruses—All plasmid con-
structs derived directly from PCRs were sequence verified and
amplimers for TOPO cloning were gel-purified and then
treated with TaqDNA polymerase (New England Biolabs).
Total RNA was isolated from the Drosophila WT Canton-S
strain using TRIzol? reagent (Invitrogen), and cDNA was syn-
thesized using SuperScript? III RT (Invitrogen) and oligo(dT).
ThecDNAwasusedasthetemplatetoamplifytheWTGfrORF
(primers TCAGGCCTTCTGGGTGGCGGTGCT and CAC-
CATGTACAAGAATCTGGAGGAGCAC), which was cloned
into pcDNATM3.1/V5-His-TOPO? (Invitrogen), and a se-
quence-verified clone was designated pcDNA-DmGFR-WT.
This plasmid was used as the template for PCR mutagenesis
withtheadditionalprimersGTGCACCTTGATATTGACGG-
TATTCG and GTCAATATCAAGGTGCACCAGTAGAGC
toproducethenac1GfrORFbyoverlapPCR.Theamplimerwas
clonedintopcDNATM3.1/V5-His-TOPO?,andacloneencoding
thenac1mutantGfrwasdesignatedpcDNA-DmGFR-nac.
Baculovirus transfer plasmids were produced by cloning the
BamHI-NotI fragment encoding the WT or nac1mutant Gfr
gene from pcDNA-DmGFR-WT and pcDNA-DmGFR-nac,
respectively, into the BglII-NotI sites of pAcp(?)IE1TV3 (37),
resulting in production of the pAcp(?)DmGFR-WT and
pAcp(?)DmGFR-nac transfer plasmids, respectively.
Plasmids encoding C-terminally eGFP-tagged GFR proteins
were constructed by PCR overlap extension. The WT or nac1
mutantGfrORFsminustheirstopcodonswerePCR-amplified
using the respective pcDNA plasmids as the template, respec-
tively, with the primers CACCATGTACAAGAATCTGGAG-
GAGCAC and GCTCACCATGGCCTTCTGGGTGGCGGT.
The eGFP ORF was PCR-amplified using peGFP-N1 (Clon-
tech)asthetemplatewiththeprimersCAGAAGGCCATGGT-
GAGCAAGGGCGAGand
CATGC. The reaction products were gel-purified and used as
the template in PCR overlap extension reactions. The reaction
products were cloned into pcDNATM3.1/V5-His-TOPO?, and
clonesencodingtheC-terminallyGFP-taggedWTandnac1Gfr
were designated pcDNA-DmGFR-WT-GFP and pcDNA-
DmGFR-nac-GFP, respectively. The fused ORFs were excised
fromtheseplasmidsusingBamHIandNotIandclonedintothe
BglII-NotI sites of pAcp(?)IE1TV3 (37), yielding pAcp(?)
IE1TV3-DmGFR-WT-GFP and pAcp(?)IE1TV3-DmGFR-
nac-GFP, respectively.
Transfer plasmids were used to produce recombinant
baculoviruses by a standard allelic transplacement method
(38, 39) with BestBac viral DNA (Expression Systems) as the
target for homologous recombination. All recombinant
baculoviruses were plaque-purified once, amplified in Sf9
cells, and titered by plaque assay on Sf9 cells, as described
previously (39). Autographa californica nucleopolyhedrovi-
rus strain E2 served as a negative control for some of the
experiments included in this study.
Transient Expression in CDG-IIc (LAD-II) Cells, Lectin
Blotting—Primary fibroblast cells from a CDG-IIc (LAD-II)
patientweremaintainedessentiallyasdescribed(40)in?-min-
imum essential medium supplemented with 15% FBS in 5%
CO2at 37 °C. For transfections, cells were seeded in a 75-cm2
culture flask; grown to confluence; and transfected with
pcDNA, pcDNA-DmGFR-WT, or pcDNA-DmGFR-nac using
LipofectamineTM2000 (Invitrogen). Briefly, cells were trans-
fectedusing30?gofDNAand75?loftransfectionreagentfor
3 h using serum-free ?-minimum essential medium according
to the manufacturer’s protocol. Cells were subsequently incu-
bated for 24 h in ?-minimum essential medium with 15% FBS,
afterwhichcellswerecollectedbytrypsinization,washedtwice
in PBS, and lysed in 500 ?l of lysis buffer (20 mM Tris-HCl, pH
7.4, 1.0% Nonidet P-40, 150 mM NaCl, 0.5 mM PMSF, 1 mM
EDTA,oneCompleteMiniTMproteaseinhibitormixturetablet
(Roche Applied Science)/10 ml of buffer). After vigorous vor-
texing,thelysatewascentrifugedfor10minat13,000?g,after
which the supernatant was collected and assayed for soluble
protein concentration using a commercial BCA assay (Pierce).
CHO cell lysates were prepared as described above from
CHO cells cultured as described before (41). Aliquots con-
taining 50 ?g of total protein were separated by SDS-PAGE
(42) and transferred to an Immobilon-P PVDF membrane
(Millipore). The membrane was blocked, probed, and devel-
oped essentially as described before (43), except that biotin-
conjugated Aleuria aurantia lectin (Vector Laboratories)
was used as the probe.
Subcellular Localization—Sf9 and Drosophila S2 cells were
transfectedwithexpressionplasmidsencodingRFP-taggedS.fru-
giperda MGAT1 (44) and GFP-tagged WT or nac1mutant GFR
proteins (pAcP(?)DmGFR-WT-GFP or pAcP(?)DmGFR-nac-
GFP), plated on concanavalin A-coated dishes, and photo-
graphed essentially as described before (44). An Olympus
FSX100 microscope was used at ?80 magnification, and the
CTACTTGTACAGCTCGTC-
DrosophilaNeurallyAlteredCarbohydrateMutant
29600 JOURNALOFBIOLOGICALCHEMISTRY VOLUME287•NUMBER35•AUGUST24,2012
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 3

manufacturer’s FSX-BSW version 03.01 software was used for
image capture at 1360 ? 1024 pixels. Images were processed
withPhotoshopCS3toreducebackgroundandtoprovidesim-
ilar signal intensities for the red and green channels.
GDP-fucose Transport Assays—Fifty ml of Sf9 cells were
seeded at a density of 5 ? 105cells/ml in complete TNM-FH
medium,grownovernightto1?106cells/ml,andinfectedwith
theappropriateviralstockatamultiplicityofinfectionofabout
2 plaque-forming units/cell. After 22 h, infected cells were pel-
letedat500?gfor5min,resuspendedin25mlofice-coldPBS
(pH7.4),andrepelleted.Thepelletwasresuspendedin6.5mlof
lysis buffer (250 mM sucrose, 5 mM imidazole, 0.5 mM mercap-
toethanol, pH 7.0, one Complete MiniTMprotease inhibitor
mixture tablet (Roche Applied Science)/10 ml of buffer). The
cells were subsequently homogenized on ice in a Dounce
homogenizer with pestle A, after which nuclei and remaining
intact cells were pelleted at 4 °C at 1000 ? g for 10 min. The
crude microsomal preparation was then layered onto a sucrose
cushion(1.3 Msucrose,5mMimidazole,0.1mMEDTA,pH7.0),
coveredwithsucroseoverlay(125mMsucrose,5mMimidazole,
0.1 mM EDTA, pH 7.0), and then centrifuged in a Beckman
SW28 rotor at 100,000 ? gavfor 40 min at 4 °C. Subsequently,
themicrosomalbandwasharvested,dilutedwithsucroseover-
lay, and recentrifuged in an SW28 rotor at 110,000 ? gavfor 20
min at 4 °C. The microsomal pellet was resuspended in 600 ?l
ofSTMbuffer(250mMsucrose,10mMTris-HCl,1mMMgCl2,
1mMDDT,pH7.5),dividedintoaliquots,andstoredat?80 °C
for up to 1 week. To determine total protein concentrations,
aliquotswerethawedonice,brieflyvortexed,andsolubilizedby
the addition of an equal volume of water containing 1.0% (v/v)
Nonidet P-40. These mixtures were then centrifuged at
13,000 ? g for 10 min, and the concentrations of solubilized
protein in the supernatants were determined using a commer-
cial BCA assay (Pierce).
For transport assays, aliquots of the microsomal prepara-
tions were thawed on ice and thoroughly vortexed, and trans-
portassaymixtureswerepreparedbyadding10?lofthemicro-
somal preparation to 80 ?l of STM buffer, cooling the mixture
in an ethanol-ice bath (approximately ?5 °C), and then adding
10 ?l of STM buffer containing 30 nCi of [3H]GDP-fucose,
(Fucose-2-3H(N), PerkinElmer Life Sciences; 15–35 Ci/mmol).
The mixture was briefly vortexed and quickly returned to the
ethanol-ice bath. The mixture was then transferred to a water
bath at 18, 25, or 32 °C for precisely 1 min, returned to the
ethanol-ice bath, and quenched by the addition of 900 ?l of
ice-cold STM buffer. The mixtures were then filtered through
water-wetted 0.45-?m mixed cellulose ester filters (Type HA;
Millipore) using a 1225 Sampling Manifold (Millipore). The
diskswerewashedthreetimeswith5mlofice-coldSTMbuffer,
air-dried, placed in 7 ml of Ultima Gold F scintillation mixture
(Packard Instrument Co.), and counted for 10 min in a model
LS-6500 liquid scintillation spectrometer (Beckman Coulter).
Background counts were determined by counting an unused
filterasdescribedabove.Allsampleswereassayedatleastthree
timesintriplicate(n?9).Rawcountswerecorrectedforback-
ground and normalized to 30 ?g of soluble protein content.
Significant differences were determined by one-way analysis of
variance using Microsoft? Excel.
Mass Spectrometry and HPLC—For nac1and WT Canton S
flies, pepsin glycopeptides were enriched, and N-glycans were
released with peptide-N-glycosidase A prior to pyridylamina-
tion and RP-HPLC, MALDI-TOF MS or ESI-MS analysis (45).
As a first step, linear MALDI-TOF mass spectra of unlabeled
N-glycans were obtained prior to pyridylamination using a
Thermo Bioanalysis Dynamo mass spectrometer in linear
modewith2,5-dihydroxybenzoicacidasmatrix.ForESI-MSof
the pyridylaminated glycans with a Micromass Q-TOF Ultima
Global mass spectrometer, the [M ? H]?ions were calculated
by applying the MassLynx MaxEnt3 software to the raw multi-
ply charged ion data. For reverse phase HPLC analysis of pyri-
dylaminatedN-glycans,anODSHypersilcolumn(250?4mm)
with a gradient of 0.3% methanol/min was used with an oligo-
hexose series (3–11 glucose units) as a calibration standard;
elution times in terms of glucose units can be compared with
previous data on WT fly N-glycans (24). Individual RP-HPLC
fractions were also analyzed by MALDI-TOF MS and MS/MS
using a Bruker AutoflexTMspeed instrument in reflectron
mode and 6-aza-2-thiothymine as matrix.
Drosophila Transgenesis and Rescue—All Drosophila strains
(OreR, w1118, elav-GAL4 inserted on the X chromosome, nac1,
andbalancerstocks)wereobtainedfromtheBloomingtonDro-
sophila Stock Center. The full WT Canton S Gfr ORF was iso-
latedbyPCRusingtheprimersGGAATTCCGAAATGTACA-
AGAATCTG and GGGGTACCTCAGGCCTTCTGGGTGG.
The amplimer was purified and cut with EcoRI and KpnI and
ligated into the same sites of the pUAST transgenesis plasmid
(46). Transgenic stocks carrying UAS-Gfr elements on all three
chromosomes were generated by injection of pUAST-Gfr into
precellularized embryos using standard methods (46).
Drosophila Embryo Anti-HRP Staining—Embryos were
dechorionated, fixed, devitellinized, stained with antibodies,
and staged according to standard methods (47, 48). Antibody
dilutions were 1:5000 for rabbit anti-HRP (Jackson Immunore-
search) and 1:2000 for peroxidase-conjugated secondary anti-
bodies(JacksonImmunoresearch).Allembryoswereprocessed
identicallyandinparallel(sameantibodydilutions,samedevel-
opment time, same day) to facilitate objective comparison of
HRP epitope levels in all genotypes.
RESULTS
Gfr Gene Sequence in the nac1Mutant—The sequence of a
PCR amplimer from a genomic region that includes the Gfr
transcript revealed that the Gfr gene in the nac1mutant has a
singlemutationconsistingofacytosinetothymidinetransition
at position 86 (C86T) of the ORF. This mutation was indepen-
dently identified in the Jarvis and Wilson laboratories in nac1
stocks obtained at different times and from different sources.
Thenac1C86Ttransitionresultsinthesubstitutionofaleucine
for a serine residue at position 29 (S29L) in the predicted GFR
amino acid sequence. The WT serine residue is fully conserved
among all known and putative GDP-fucose transporters
throughout the animal kingdom (Fig. 1B) and is located in the
first predicted transmembrane region (Fig. 1C). Because pro-
duction of the HRP epitope requires GDP-fucose in the Golgi
apparatus, where it serves as the donor substrate, these obser-
vations were consistent with the idea that nac1flies might have
DrosophilaNeurallyAlteredCarbohydrateMutant
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29601
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 4

a defective Golgi GDP-fucose transporter. Thus, we examined
theimpactofthenac1S29LmutationontheGDP-fucosetrans-
port function of the mutant Gfr gene product.
GDP-fucose Transport by the nac1Mutant GFR Product—
Our transport assays measured the amount of GDP-fucose
transported into microsomes, analogous to previously de-
scribed nucleotide sugar transport assays employing Golgi-en-
riched microsomes from cells expressing heterologous NSTs
(35, 49). Baculovirus expression vectors were used to express
the WT and nac1mutant GFRs in Sf9 insect cells, and then
Golgi-enriched microsomes were isolated from those cells and
used for GDP-fucose transport assays. Microsomes from cells
infected with the empty baculovirus vector were used as back-
ground controls, and each assay was performed at different
temperatures to determine if there were any temperature-de-
pendentdifferencesthatcouldexplainnac1cold-sensitivephe-
notypes (34). As compared with the background controls,
microsomes containing WT GFR imported more and those
containing the nac1mutant GFR imported less GDP-fucose at
all temperatures examined (Fig. 2A). Increasing the assay tem-
perature from 18 to 25 °C did not produce a statistically signif-
icant increase in GDP-fucose import in either the background
controls or WT GFR samples. However, this temperature shift
significantly increased GDP-fucose import in the nac1GFR
samples. These experiments were extended by performing
additionalassaysat32 °Ctodetermineifthenac1mutanttrans-
porter gained even more function at this higher temperature.
Indeed, GDP-fucose import with background control, WT
GFR, and nac1GFR microsomes was increased further at 32 °C
(Fig.2A).Aswiththeprevioustemperatureshift,theincreasein
GDP-fucose import activity was highest in the nac1GFR sam-
ples, confirming that the nac1mutant GFR is more cold-sensi-
tive than WT GFR, which potentially contributes to the cold-
sensitive nac1phenotypes (34).
We also assessed the function of nac1GFR in vivo by using
cells from a CDG-IIc (LAD-II) patient (40). These cells cannot
produce fucosylated N-glycans because they have a defective
GFR,buttheirfucosylation-negativephenotypecanberescued
by transfection with a WT human GFR gene (28, 30, 31). Thus,
we transfected CDG-IIc (LAD-II) cells with plasmids encoding
theWTornac1DrosophilaGfrgenes,preparedtotalcelllysates
and CHO cell lysates as a positive control, and probed them
with fucose-specific A. aurantia lectin (50). A. aurantia lectin
bound strongly to multiple proteins in the CHO cell lysate but
not to any proteins in the empty vector-transfected CDG-IIc
(LAD-II) cell lysate, as expected (Fig. 2B). A. aurantia lectin
also bound to multiple proteins in the WT Gfr-transfected
CDG-IIc(LAD-II)celllysatebutnottoanyproteinsinthenac1
Gfr-transfected CDG-IIc (LAD-II) cell lysate (Fig. 2B). The
higher level of A. aurantia lectin binding observed with the
CHO cell lysate as compared with the WT Gfr-transfected
CDG-IIc (LAD-II) cell lysate probably reflects cell toxicity as-
sociated with the transfection because we observed significant
cell death at later time points. Alternatively, it might reflect the
inefficiencies inherent in the transfection process or the differ-
ences between the CHO and LAD-II cell types. Regardless,
these results showed that the nac1Gfr gene failed to rescue the
fucosylation-negative phenotype in CDG-IIc (LAD-II) cells,
indicating that the nac1mutant gene product is defective in
vivo.
The nac1Mutant GFR Localizes to the Golgi Apparatus—
GDP-fucose transporters typically localize to the Golgi appara-
tus(28,40).Hence,thetransportdefectobservedwiththe nac1
mutant gene product could have resulted from a direct impact
of the mutation on its biochemical function or an indirect
impact on its intracellular trafficking. To distinguish between
these possibilities, we expressed GFP-tagged forms of the WT
and nac1GFRs in Drosophila S2 cells as well as in Sf9 cells,
which had been used for the in vitro GDP-fucose transport
assays.WeusedRFP-taggedinsectN-acetylglucosaminyltrans-
ferase I (MGAT1) as a Golgi marker because this enzyme acts
immediately upstream of HRP epitope synthesis by producing
the FucTA acceptor substrate (44, 51–53). The red and green
fluorescence patterns observed in these experiments each had
punctate, cytoplasmic distributions typical of the multiple
Golgi apparatuses found in lepidopteran insect cells (Fig. 2C)
FIGURE 1. Production of the HRP epitope and the Drosophila nac1GFR
mutation. A, GDP-fucose is produced in the cytoplasm and transported
into the Golgi lumen by the GFR transporter in exchange for GMP. FucTA
uses GDP-fucose in the Golgi lumen to produce the HRP epitope consist-
ing of core ?1,3-fucosylated N-glycans. Squares, N-acetylglucosamine; cir-
cles, mannose; triangles, fucose. B, amino acid sequence comparison of
known and predicted GDP-fucose transporters. The arrow indicates the
conserved serine residue that is mutated to a leucine in Drosophila nac1
GFR. Amino acid residue numbering is according to the Drosophila gene
product. GenBankTMaccession numbers are as follows: Drosophila,
NP_649782.1; mosquito, XP_312562.2; honeybee, XP_623632.1; flour
beetle,XP_967192.1;human,NP_001138737.1;
BAE16173.1; zebrafish: NP_001008590.1; sea urchin, XP_798515.1; nema-
tode, XP_002637574.1. C, Ser-29 is located in the middle of the first pre-
dicted transmembrane domain of Drosophila GFR.
Chinesehamster,
DrosophilaNeurallyAlteredCarbohydrateMutant
29602 JOURNALOFBIOLOGICALCHEMISTRYVOLUME287•NUMBER35•AUGUST24,2012
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 5

(54, 55). Furthermore, there was a close overlap between the
GFR and MGAT1 fluorescence patterns in all cases, indicating
thatthesetwoproteinsresideinthesamesubcellularcompart-
ment.Thesimilarityinthefluorescencepatternsobservedwith
theWTandnac1mutantGFRsandtheircloseoverlapwiththe
Golgimarkerindicatedthatthenac1mutationdoesnotimpact
the intracellular trafficking of GFR, which was consistent with
the presence of only a single amino acid substitution in the
mutant protein. These data also indicated that this mutation
does not dramatically reduce GFR stability, although it is pos-
sible that the mutant protein was stabilized by being fused to
GFP.
Core ?1,3- and ?1,6-Fucosylation Are Both Reduced in nac1
Flies—Golgi-localized GDP-fucose is required as the donor
substrate for both core ?1,3- and ?1,6-fucosylation. Thus, one
might expect a functional knock-out of the Gfr gene to reduce
both types of core fucosylation in nac1flies. To test this expec-
tation, we determined the relative levels of core fucosylated
N-glycans in WT and nac1flies using ESI-MS. The results
showed that 21 and 10% of the N-glycans from WT (Fig. 3A)
and nac1mutant (Fig. 3B) adult flies, respectively, were mono-
fucosylated glycans with the structure Hex3HexNAc2Fuc. Sim-
ilarly, the prevalence of monofucosylated N-glycans with the
structure Hex2HexNAc2Fuc was 5% in WT but only 1.4% in
FIGURE 2. WT, but not nac1GFR can transport GDP-fucose in vitro and in vivo, and both are Golgi-localized. A, [3H]GDP-fucose import activity of
Golgi-enriched microsomes from Sf9 cells infected with baculovirus vectors encoding WT GFR, nac1GFR, or no exogenous transporter (?) at 18, 25, or 32 °C.
Background import at 18 °C (1.5 fmol of GDP-fucose/?g of total protein/min) is set at 100% (?). Error bars, 95% confidence interval. p values for different
samplesatthesametemperatureswereall?0.01.*,p?0.05;**,p?0.01.B,A. aurantialectin(AAL)blotofCHOcellsorCDG-IIc(LAD-II)cellstransfectedwith
expression plasmids encoding WT GFR, nac1GFR, or nothing (?). C, subcellular distribution of WT and nac1GFR in Sf9 and Drosophila S2 cells. Columns,
phase-contrast, GFP-tagged GFR, RFP-tagged MGAT1 (insect Golgi marker), GFP and RFP merge, and overlay. Scale bar, 10 ?m.
DrosophilaNeurallyAlteredCarbohydrateMutant
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29603
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 6

nac1mutant adults (Fig. 3B). Low levels of difucosylated N-gly-
cansbearingboththeHRPepitopeandcore?1,6-linkedfucose
residues also were detected in WT but not in nac1mutant flies
(Fig. 3, C and D). We further assessed the levels of monofuco-
sylatedN-glycansinnac1mutantandWTfliesbyreversephase
HPLC (Fig. 3E) and MALDI-TOF (Fig. 3, F and G); analysis of
individual RP-HPLC fractions by MALDI-TOF MS revealed
only trace amounts of the difucosylated glycans Hex2–3
HexNAc2Fuc2in nac1(co-eluting with Hex3HexNAc2) as com-
pared with WT flies (data not shown). The results obtained
usingbothoftheseanalyticalmethodsconfirmedthatnac1flies
have lower levels of monofucosylated N-glycans. Thus, three
independent methods indicated that the nac1mutation
reducedboth?1,3-and?1,6-linkedcorefucosylation,aswould
beexpectedfromthelossofGFRfunction.Inaddition,allthree
methods also revealed a relative increase in the levels of the
non-fucosylated N-glycan Hex3HexNAc2corresponding to the
decreased levels of fucosylated N-glycans, further confirming
the lack of fucosylation.
WT Gfr Expression Rescues the Neural HRP Epitope in nac1
Embryos—Immunohistochemistry with an anti-HRP antibody
confirmed that HRP epitope expression in the ventral nerve
FIGURE 3. Core di-, ?1,3-, and ?1,6-fucosylated N-glycan levels are strongly reduced in nac1flies. Peptide-N-glycosidase A-released N-glycans from WT
Canton S (A, C, E, and F) and nac1adults (B, D, E, and G) were subjected to analysis by ESI-MS (A–D), RP-HPLC (E), and MALDI-TOF MS (F and G). F, fucose; G,
glucose;M,mannose;N,N-acetylhexosamine.Redtriangles,fucose;greencircles,mannose;bluesquares,N-acetylglucosamine.ThelateelutiontimeofM3N2F
(E)indicatesthatitisacore?1,6-fucosylatedglycan,anditsreducedrelativeintensityinnac1fliesisshownbyallthreemethods,MALDI-TOFMSanalysis(not
shown) of individual RP-HPLC fractions indicated trace levels of difucosylated glycans co-eluting with M3N2 in nac1flies. The exploded views of the ESI-MS
spectra(CandD;m/z1265–1335)aresettothesameioncount(yaxis;1.5?105)andshowthealmostcompleteabsenceinnac1fliesofthedifucosylatedHRP
epitope MMF3F6glycan in its [M ? H]?and [M ? Na]?forms.
DrosophilaNeurallyAlteredCarbohydrateMutant
29604 JOURNALOFBIOLOGICALCHEMISTRYVOLUME287•NUMBER35•AUGUST24,2012
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 7

cord was much lower in nac1than in WT embryos (Fig. 4, A, B,
E, and F), as shown previously (21, 33). In order to determine if
the Gfr C86T mutation was solely responsible for this change,
we generated transgenic Drosophila stocks designed to express
the WT Gfr coding sequence in nac1embryos using the GAL4/
UAS system (46). A second chromosome UAS-Gfr transgenic
strain and an X chromosome elav-GAL4 driver strain were
both crossed into the third chromosome nac1background,
resulting in stocks that were homozygous for nac1and either
theUAS-Gfrorelav-GAL4element.Thesestockswerecrossed
to generate embryo collections, which were then stained with
theanti-HRPantibodytoassesswhethertransgenicGfrexpres-
sion could rescue the nac1core ?1,3-fucosylation defect. As
expected for the neural specificity of the elav-GAL4 element
(56), expression of the HRP-epitope was rescued in differenti-
ating neurons of elav-GAL4; UAS-Gfr; nac1/nac1progeny (Fig.
4,CandD).Thus,reducedHRPepitopeexpressioninnac1flies
is due solely to a defect in their Gfr gene.
Staining with anti-HRP antibody could be detected in late
stage 10 rescued embryos, which is substantially earlier than in
wild-type embryos, where staining first appeared in early stage
12. This is consistent with the time course of elav expression
(56), suggesting that Gfr expression at least partially limits core
?1,3-fucosylation in Drosophila. Surprisingly, elav-driven
expression of Gfr resulted in embryonic lethality at mid-em-
bryogenesis. This is probably a result of our use of the very
strong elav-GAL4 driver, which typically provides highly effi-
cient expression of UAS-transgenes in the embryonic nervous
system.
In the course of generating UAS-Gfr transgenic stocks, we
identified a line that exhibited partially rescued HRP epitope
expression in the ventral nerve cord and peripheral nervous
system of nac1mutant embryos without crossing to a GAL4
driver line (data not shown). This leaky expression line (UAS-
Gfrvk2)washomozygousviableandfertileinbothnac1andWT
backgrounds, suggesting a significantly lower Gfr expression
level than was obtained by crossing UAS-Gfr lines to the elav-
GAL4 driver line. Interestingly, the UAS-Gfrvk2leaky expres-
sion line rescued temperature-sensitive lethality associated
withthenac1mutant;only6%ofnac1/nac1adultssurvivedafter
a shift to 18 °C, whereas 82% of UAS-Gfrvk2/UAS-Gfrvk2; nac1/
nac1adults survived and reproduced at 18 °C. Thus, whereas
overexpression of Gfr proved to be embryonic lethal, moderate
expression was well tolerated and rescued both HRP epitope
expression and developmental arrest defects associated with
the nac1mutation.
Ser-29 Is Conserved in Other GDP-sugar Transporters—Fi-
nally,wecomparedtheaminoacidsequencesoftheDrosophila
GFR and other known Golgi nucleotide sugar transporters
(NSTs) to more generally assess the potential functional rele-
vanceofSer-29(Fig.5).Wefoundthatplant,fungal,protozoan,
and animal GDP-sugar transporters have clear homology to an
aminoacidsequenceintheN-terminalregionoftheDrosophila
GFR.SeveralfungalGolgiGDP-mannosetransporters(57–62);
a Leishmania Golgi GDP-mannose, -fucose, and -arabinose
transporter (63, 64); and the Arabidopsis and Volvox Golgi
GDP-mannose transporters (65–67) are clearly similar to Dro-
sophila GFR in this region, and each has a serine residue in
positionscorrespondingtoDrosophilaGFRSer-29.Othermul-
tisubstrate transporters that also could transport a GDP-sugar,
including human HFRC1 (68), Drosophila FRC (69), human
UGTrel7 (70), and nematode SQV-7 (71), are similar to Dro-
sophila GFR as well, and each has a serine residue at a position
corresponding to Drosophila GFR Ser-29. In contrast to these
GDP-sugar transporters, other Golgi NSTs, including the
human UDP-galactose (72), CMP-sialic acid (73), UDP-N-
acetylglucosamine(74),andUDP-xylosetransporters(75),lack
significant homology to GFR. Of these, the human UDP-galac-
tose and UDP-N-acetylglucosamine transporters have a serine
residue at a position corresponding to Drosophila GFR Ser-29.
However,theseserineresiduesarenotconservedinthehomol-
ogous transporters from most other species, indicating that,
unlike Drosophila GFR Ser-29, they are probably not essential
for functionality. Based on these data, we suggest that a serine
residue at a position corresponding to Drosophila GFR Ser-29
in Golgi NSTs that also have similarity to an amino acid
sequence in the first transmembrane domain of Drosophila
GFR might predict GDP-sugar transport capacity.
FIGURE4.ReducedHRPepitopeexpressioninnac1homozygousembryosisrescuedbytransgenicexpressionofWTGfr.A,C,andE,lateralview.B,D,and
F, ventral view. All embryos are late stage 12 to early stage 13. In nac1/nac1embryos (A and B), HRP epitope expression is reduced in comparison with WT
embryos (E and F). A WT Gfr transgene driven by the neuron-specific elav promoter rescues neural HRP epitope expression (C and D). Scale bar, 70 ?m.
DrosophilaNeurallyAlteredCarbohydrateMutant
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29605
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 8

DISCUSSION
CDGs are a diverse group of heritable diseases caused by
mutations in genes involved in glycosylation. The study of
CDGs has been facilitated by the availability of animal models
because much of the glycosylation machinery is evolutionarily
conserved (76, 77). Since the description of the nac1mutant in
1988byKatzetal.(33),Drosophilahasbecomeestablishedasa
model organism for the study of human genetic disorders,
including CDGs (78, 79). However, the genetic defect underly-
ing the nac1mutation had not yet been elucidated.
In this study, we identified a single nucleotide transition
(C86T) that produces a leucine for serine substitution at posi-
tion 29 of the Golgi GDP-fucose transporter encoded by the
nac1Gfr gene. The mutagen originally used to isolate the nac1
mutant was ethyl methane sulfonate (33). Mechanistically,
ethyl methane sulfonate is expected to produce G/C to A/T
transitions (80, 81), and this expectation has been confirmed in
mutagenesis studies (82–84). Thus, the C86T transition in the
nac1Gfr gene is fully consistent with the use of ethyl methane
sulfonate mutagenesis in producing the nac1strain.
There are three currently known missense mutations in the
human GDP-fucose transporter that cause CDG-IIc (LAD-II)
(T308R, R147C, and Y337C) (30, 85). In each case, these muta-
tionsalteraresidueanalogoustoDrosophilaGFRSer-29,which
is fully conserved among animal GDP-fucose transporters and
is located in a predicted transmembrane helix. Like these
human GFR missense mutations, the nac1S29L mutation also
abolishes GDP-fucose transport function in vitro and in vivo.
Serine residues corresponding to Drosophila GFR S29 are con-
servedinGDP-sugartransportersfromawidevarietyofspecies
butnotinothertypesofNSTs.Thus,wespeculatethataserine
residue at a position corresponding to Drosophila GFR Ser-29
might predict GDP-sugar transporting capacity in Golgi NSTs
thatarealsootherwisesimilartoDrosophilaGFR.Interestingly,
the first transmembrane domains of human HFRC1 and
UGTrel7, like that of Drosophila FRC, are similar to GFR, and
each has a conserved serine corresponding to GFR Ser-29,
unlike any other human or Drosophila Golgi NSTs. Thus, it is
possible that the low level of fucosylation in nac1flies is due to
GDP-fucose transport by the Drosophila FRC gene product.
Similarly, it is possible that the alternative GDP-fucose trans-
port activity observed in CDG-IIc (LAD-II) cells supplemented
withfucoseisduetothissamefunctionofthehumanHFRC1or
UGTrel7 gene products.
For our in vitro GDP transport assays, we used microsomes
from Sf9 cells (86), which have endogenous Golgi GDP-fucose
transport activity because these cells typically produce ?1,6
core fucosylated N-glycans (87). Despite the presence of this
endogenous activity, we were able to demonstrate a ?6-fold
increaseintransportactivityinmicrosomesfromcellsinfected
with a baculovirus encoding WT GFR, as compared with back-
ground controls. Surprisingly, microsomes from cells infected
withabaculovirusencodingthenac1GFRsampleshadreduced
GDP-fucose import activity compared with the controls, indi-
cating a possible dominant negative effect. Considering that
GFR dimerization might be necessary to produce a functional
transporter(29),co-expressionofthenac1GFRcouldhavepro-
duced a subpopulation of heterodimers consisting of endoge-
nous transporter molecules and recombinant nac1GFR mole-
cules, which were less functional than the endogenous
transporter homodimers. A similar dominant negative pheno-
type in which co-expression of a mutant transporter negatively
affects transport has been observed with the yeast Golgi GDP-
mannose transporter (88), which also functions as a homo-
dimer. Alternatively, it is possible that overexpression of the
nac1GFR altered the subcellular distribution of the endoge-
nous transporter, thereby reducing the number of transporter
molecules in those microsomal preparations.
Non-functional,mutantNSTsthatfailtoexittheERtypically
have frameshift mutations that eliminate one or more trans-
membrane domains and the C-terminal domain. Two such
mutations have been identified in the human GDP-fucose
transporter (40, 89). On the other hand, point mutations that
changesingleaminoacidstypicallydonotaltertheGolgilocal-
ization of NSTs, including the GDP-fucose transporter (31, 40,
90). Like the inactivating missense mutations in human GFR,
the nac1S29L mutation did not affect subcellular distribution
because both WT and nac1GFR were Golgi-localized.
ESI-MS, RP-HPLC, and MALDI-TOF analyses demon-
strated that nac1flies have reduced levels of core ?1,3-fucosy-
lated and only trace levels of core ?1,6-/?1,3-difucosylated
N-glycans, which is consistent with the original observation
that nac1flies have significantly reduced levels of the HRP
epitope. We also discovered that these flies had reduced levels
ofcore?1,6-fucosylatedN-glycans,whichisconsistentwiththe
requirement of a Golgi GDP-fucose transporter for both core
?1,6- and ?1,3-fucosylation. The residual levels of monofuco-
sylated N-glycans indicate that nac1flies are still able to trans-
port some GDP-fucose into the Golgi. This suggests the pres-
ence of an alternative, functionally redundant GDP-fucose
transport mechanism, a notion that is supported by the results
of another study, in which faint anti-HRP and A. aurantia lec-
FIGURE 5. Drosophila GFR Ser-29 is conserved in other GDP-sugar trans-
porters. Shown is an alignment of Drosophila GFR with other characterized
GDP-sugar transporters from Leishmania donovani (GDP-SugarT) (64), Sac-
charomyces cerevisiae (yeast GDP-ManT) (59), Pichia pastoris (Pichia GDP-
ManT) (57), Candida albicans (C. albicans GDP-ManT) (62), Candida glabrata
(C. glabrata GDP-ManT) (61), Cryptococcus neoformans (Cryptococcus GDP-
ManT-1 and -2) (58), Aspergillus nidulans (Aspergillus GMT-1 and -2) (60), Vol-
vox carteri (Volvox GDP-ManT) (67), and Arabidopsis thaliana (Arabidopsis
GONST-1 and -2) (65, 66) and similar NSTs of Caenorhabditis elegans (nema-
todeSQV-7)(71),Drosophilamelanogaster(DrosophilaFRC)(69),andhumans
(human FRC1 and hUGTrel7) (68, 70).
DrosophilaNeurallyAlteredCarbohydrateMutant
29606 JOURNALOFBIOLOGICALCHEMISTRY VOLUME287•NUMBER35•AUGUST24,2012
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 9

tinstainingcouldstillbedetectedinflieswithalargedeletionin
the Gfr gene (91). This redundant transport mechanism is not
provided by the ER-localized GDP-fucose transporter encoded
by the Efr gene because flies lacking Gfr alone or both Gfr and
Efr have comparable amounts of residual core fucosylated
N-glycans (91). Similarly, humans also have an alternative but
less efficient Golgi GDP-fucose import mechanism because
dietaryfucosesupplementationcanrestoreN-glycancorefuco-
sylation in CDG-IIc (LAD-II) patients that are homozygous for
a completely non-functional Golgi GDP-fucose transporter
(40, 89). The precise nature of the redundant GDP-fucose
transport mechanism remains to be determined in both
humans and flies; however, its low affinity and non-saturable
character suggests that it is not provided by another specific
GDP-fucose transporter (92, 93).
Interestingly, nac1embryos rescued with elav-driven WT
Gfr expressed the HRP epitope at earlier developmental stages
than WT embryos, suggesting that N-glycan fucosylation is at
leastpartiallylimitedbytransportofGDP-fucoseintotheGolgi
apparatus. The notion that Gfr expression limits fucosylation in
vivoiscorroboratedbythedemonstrationthatincreasedN-glycan
fucosylationincancercellscorrelateswithincreasedGFRexpres-
sion, and that fucosylation can be increased directly by overex-
pressing GFR (94). A surprising observation was that elav-driven
WT Gfr overexpression triggered embryonic lethality. This is
probablyapleiotropicphenotypearisingfromtheincreasedavail-
ability of GDP-fucose in the Golgi apparatus for a variety of
N-linked and O-linked fucosylation reactions. Intriguingly, the
nac1phenotypes and the embryonic lethality observed in elav-
GAL4; UAS-Gfr rescued nac1flies suggest that it is biologically
necessarytomaintainproteinfucosylationwithinacertainrange.
Furthermore, the relation between Gfr expression levels, embry-
oniclethality,andHRPepitopeproductionsuggeststhatGfrispart
of the regulatory system that maintains Golgi GDP-fucose levels
withinaphysiologicallyacceptablerange.
Finally, the observation that transgenic WT Gfr expression
can restore HRP epitope production in nac1flies indicates that
the Gfr C86T transition is the only genetic defect responsible
for the neurally altered carbohydrate phenotype. Hence, the
defectiveGolgiGDP-fucosetransporterandtheresultingfuco-
sylation deficit in nac1flies are analogous to human CDG-IIc
(LAD-II). Coupled with our observation that the nac1mutant
GFRismorecold-sensitivethanitsWTcounterpart,wesuggest
that the nac1fly is a useful model of human CDG-IIc (LAD-II)
that could be effectively exploited in a variety of creative ways,
such as by using its cold-sensitive phenotypes to titrate N-gly-
coprotein core fucosylation.
Acknowledgments—We thank Dr. M. Wild (Max Planck Institute for
Molecular Biomedicine, Münster, Germany) and Dr. P. Robinson
(Royal Hospital for Sick Children, Glasgow, UK) for providing the
CDG-IIc cell line, D. Kerner for assistance with glycan preparations,
and Dr. F. Altmann for access to mass spectrometers.
REFERENCES
1. Freeze, H. H., Eklund, E. A., Ng, B. G., and Patterson, M. C. (2012) Neu-
rology of inherited glycosylation disorders. Lancet Neurol. 11, 453–466
2. Morava, E., Lefeber, D. J., and Wevers, R. A. (2011) Protein glysosylation
and congenital disorders of glycosylation. in Post-translational Modifica-
tions in Health and Disease (Vidal, C. J., ed) pp. 97–117, Springer, New
York
3. Jaeken,J.(2010)Congenitaldisordersofglycosylation.Ann.N.Y.Acad.Sci.
1214, 190–198
4. Fukuda, M. N., Papayannopoulou, T., Gordon-Smith, E. C., Rochant, H.,
and Testa, U. (1984) Defect in glycosylation of erythrocyte membrane
proteins in congenital dyserythropoietic anemia type II (HEMPAS). Br. J.
Haematol. 56, 55–68
5. Jaeken, J., van Eijk, H. G., van der Heul, C., Corbeel, L., Eeckels, R., and
Eggermont, E. (1984) Sialic acid-deficient serum and cerebrospinal fluid
transferrininanewlyrecognizedgeneticsyndrome.Clin.Chim.Acta144,
245–247
6. Bach, G., Bargal, R., and Cantz, M. (1979) I-cell disease. Deficiency of
extracellularhydrolasephosphorylation.Biochem.Biophys.Res.Commun.
91, 976–981
7. Hasilik,A.,andNeufeld,E.F.(1980)Biosynthesisoflysosomalenzymesin
fibroblasts. Phosphorylation of mannose residues. J. Biol. Chem. 255,
4946–4950
8. Fukuda, M. N., Dell, A., and Scartezzini, P. (1987) Primary defect of con-
genital dyserythropoietic anemia type II. Failure in glycosylation of eryth-
rocytelactosaminoglycanproteinscausedbyloweredN-acetylglucosami-
nyltransferase II. J. Biol. Chem. 262, 7195–7206
9. Van Schaftingen, E., and Jaeken, J. (1995) Phosphomannomutase defi-
ciency is a cause of carbohydrate-deficient glycoprotein syndrome type I.
FEBS Lett. 377, 318–320
10. Reitman,M.L.,Varki,A.,andKornfeld,S.(1981)Fibroblastsfrompatients
with I-cell disease and pseudo-Hurler polydystrophy are deficient in uri-
dine 5?-diphosphate-N-acetylglucosamine:glycoprotein N-acetylgluco-
saminylphosphotransferase activity. J. Clin. Invest. 67, 1574–1579
11. Hasilik, A., Waheed, A., and von Figura, K. (1981) Enzymatic phosphoryl-
ationoflysosomalenzymesinthepresenceofUDP-N-acetylglucosamine.
Absence of the activity in I-cell fibroblasts. Biochem. Biophys. Res. Com-
mun. 98, 761–767
12. Schwarz, K., Iolascon, A., Verissimo, F., Trede, N. S., Horsley, W., Chen,
W., Paw, B. H., Hopfner, K. P., Holzmann, K., Russo, R., Esposito, M. R.,
Spano,D.,DeFalco,L.,Heinrich,K.,Joggerst,B.,Rojewski,M.T.,Perrotta,
S., Denecke, J., Pannicke, U., Delaunay, J., Pepperkok, R., and Heimpel, H.
(2009) Mutations affecting the secretory COPII coat component SEC23B
cause congenital dyserythropoietic anemia type II. Nat. Genet. 41,
936–940
13. Matthijs,G.,Schollen,E.,Pardon,E.,Veiga-Da-Cunha,M.,Jaeken,J.,Cas-
siman, J. J., and Van Schaftingen, E. (1997) Mutations in PMM2, a phos-
phomannomutasegeneonchromosome16p13,incarbohydrate-deficient
glycoprotein type I syndrome (Jaeken syndrome). Nat. Genet. 16, 88–92
14. Tiede, S., Storch, S., Lübke, T., Henrissat, B., Bargal, R., Raas-Rothschild,
A., and Braulke, T. (2005) Mucolipidosis II is caused by mutations in
GNPTA encoding the ?/? GlcNAc-1-phosphotransferase. Nat. Med. 11,
1109–1112
15. Kudo,M.,Brem,M.S.,andCanfield,W.M.(2006)MucolipidosisII(I-Cell
disease) and mucolipidosis IIIA (classical pseudo-Hurler polydystrophy)
arecausedbymutationsintheGlcNAc-phosphotransferase?/?-subunits
precursor gene. Am. J. Hum. Genet. 78, 451–463
16. Kubelka, V., Altmann, F., Staudacher, E., Tretter, V., Ma ¨rz, L., Hård, K.,
Kamerling, J. P., and Vliegenthart, J. F. (1993) Primary structures of the
N-linked carbohydrate chains from honeybee venom phospholipase A2.
Eur. J. Biochem. 213, 1193–1204
17. Prenner,C.,Mach,L.,Glossl,J.,andMärz,L.(1992)Theantigenicityofthe
carbohydratemoietyofaninsectglycoprotein,honey-bee(Apismellifera)
venomphospholipaseA2.Theroleof?1,3-fucosylationoftheasparagine-
bound N-acetylglucosamine. Biochem. J. 284, 377–380
18. Tretter, V., Altmann, F., Kubelka, V., März, L., and Becker, W. M. (1993)
Fucose?1,3-linkedtothecoreregionofglycoproteinN-glycanscreatesan
important epitope for IgE from honeybee venom allergic individuals. Int.
Arch. Allergy Immunol. 102, 259–266
19. Paschinger,K.,Rendic ´,D.,andWilson,I.B.(2009)Revealingtheanti-HRP
epitope in Drosophila and Caenorhabditis. Glycoconj. J. 26, 385–395
20. Wilson, I. B., Harthill, J. E., Mullin, N. P., Ashford, D. A., and Altmann, F.
DrosophilaNeurallyAlteredCarbohydrateMutant
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29607
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 10

(1998) Core ?1,3-fucose is a key part of the epitope recognized by anti-
bodiesreactingagainstplantN-linkedoligosaccharidesandispresentina
wide variety of plant extracts. Glycobiology 8, 651–661
21. Jan, L. Y., and Jan, Y. N. (1982) Antibodies to horseradish peroxidase as
specific neuronal markers in Drosophila and in grasshopper embryos.
Proc. Natl. Acad. Sci. U.S.A. 79, 2700–2704
22. Kurosaka, A., Yano, A., Itoh, N., Kuroda, Y., Nakagawa, T., and Kawasaki,
T.(1991)Thestructureofaneuralspecificcarbohydrateepitopeofhorse-
radish peroxidase recognized by anti-horseradish peroxidase antiserum.
J. Biol. Chem. 266, 4168–4172
23. Snow, P. M., Patel, N. H., Harrelson, A. L., and Goodman, C. S. (1987)
Neural specific carbohydrate moiety shared by many surface glycopro-
teins in Drosophila and grasshopper embryos. J. Neurosci. 7, 4137–4144
24. Fabini,G.,Freilinger,A.,Altmann,F.,andWilson,I.B.(2001)Identificationof
core ?1,3-fucosylated glycans and cloning of the requisite fucosyltransferase
cDNA from Drosophila melanogaster. Potential basis of the neural anti-
horseradishperoxidaseepitope.J.Biol.Chem.276,28058–28067
25. Rendic, D., Linder, A., Paschinger, K., Borth, N., Wilson, I. B., and Fabini,
G. (2006) Modulation of neural carbohydrate epitope expression in Dro-
sophila melanogaster cells. J. Biol. Chem. 281, 3343–3353
26. Rendic ´,D.,Sharrow,M.,Katoh,T.,Overcarsh,B.,Nguyen,K.,Kapurch,J.,
Aoki, K., Wilson, I. B., and Tiemeyer, M. (2010) Neural specific ?3-fuco-
sylation of N-linked glycans in the Drosophila embryo requires fucosyl-
transferase A and influences developmental signaling associated with O-
glycosylation. Glycobiology 20, 1353–1365
27. Roos,C.,Kolmer,M.,Mattila,P.,andRenkonen,R.(2002)Compositionof
Drosophilamelanogasterproteomeinvolvedinfucosylatedglycanmetab-
olism. J. Biol. Chem. 277, 3168–3175
28. Lühn,K.,Laskowska,A.,Pielage,J.,Kla ¨mbt,C.,Ipe,U.,Vestweber,D.,and
Wild, M. K. (2004) Identification and molecular cloning of a functional
GDP-fucose transporter in Drosophila melanogaster. Exp. Cell Res. 301,
242–250
29. Puglielli, L., and Hirschberg, C. B. (1999) Reconstitution, identification,
andpurificationoftheratliverGolgimembraneGDP-fucosetransporter.
J. Biol. Chem. 274, 35596–35600
30. Lübke, T., Marquardt, T., Etzioni, A., Hartmann, E., von Figura, K., and
Körner, C. (2001) Complementation cloning identifies CDG-IIc, a new
type of congenital disorder of glycosylation, as a GDP-fucose transporter
deficiency. Nat. Genet. 28, 73–76
31. Lühn, K., Wild, M. K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber,
D.(2001)ThegenedefectiveinleukocyteadhesiondeficiencyIIencodesa
putative GDP-fucose transporter. Nat. Genet. 28, 69–72
32. Jaeken,J.,Hennet,T.,Matthijs,G.,andFreeze,H.H.(2009)CDGnomen-
clature. Time for a change! Biochim. Biophys. Acta 1792, 825–826
33. Katz, F., Moats, W., and Jan, Y. N. (1988) A carbohydrate epitope ex-
presseduniquelyonthecellsurfaceofDrosophilaneuronsisalteredinthe
mutant nac (neurally altered carbohydrate). EMBO J. 7, 3471–3477
34. Whitlock, K. E. (1993) Development of Drosophila wing sensory neurons
in mutants with missing or modified cell surface molecules. Development
117, 1251–1260
35. Ishikawa, H. O., Higashi, S., Ayukawa, T., Sasamura, T., Kitagawa, M.,
Harigaya, K., Aoki, K., Ishida, N., Sanai, Y., and Matsuno, K. (2005) Notch
deficiency implicated in the pathogenesis of congenital disorder of glyco-
sylation IIc. Proc. Natl. Acad. Sci. U.S.A. 102, 18532–18537
36. Laird, P. W., Zijderveld, A., Linders, K., Rudnicki, M. A., Jaenisch, R., and
Berns,A.(1991)SimplifiedmammalianDNAisolationprocedure.Nucleic
Acids Res. 19, 4293
37. Jarvis, D. L., Weinkauf, C., and Guarino, L. A. (1996) Immediate-early
baculovirusvectorsforforeigngeneexpressionintransformedorinfected
insect cells. Protein Expr. Purif. 8, 191–203
38. O’Reilly,D.R.,Miller,L.K.,andLuckow,V.A.(1992)BaculovirusExpres-
sion Vectors, pp. 139–179, W.H. Freeman and Co., New York
39. Summers, M. D., and Smith, G. E. (1987) A Manual of Methods for Bacu-
lovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Ex-
periment Station Bulletin 1555, College Station, TX
40. Helmus, Y., Denecke, J., Yakubenia, S., Robinson, P., Lühn, K., Watson,
D. L., McGrogan, P. J., Vestweber, D., Marquardt, T., and Wild, M. K.
(2006) Leukocyte adhesion deficiency II patients with a dual defect of the
GDP-fucose transporter. Blood 107, 3959–3966
41. Aumiller, J. J., and Jarvis, D. L. (2002) Expression and functional charac-
terization of a nucleotide sugar transporter from Drosophila melano-
gaster.Relevancetoproteinglycosylationininsectcellexpressionsystems.
Protein Expr. Purif. 26, 438–448
42. Laemmli,U.K.(1970)Cleavageofstructuralproteinsduringtheassembly
of the head of bacteriophage T4. Nature 227, 680–685
43. Geisler, C., and Jarvis, D. L. (2011) Effective glycoanalysis with Maackia
amurensis lectins requires a clear understanding of their binding specific-
ities. Glycobiology 21, 988–993
44. Geisler, C., and Jarvis, D. L. (2012) Substrate specificities and intracellular
distributions of three N-glycan-processing enzymes functioning at a key
branch point in the insect N-glycosylation pathway. J. Biol. Chem. 287,
7084–7097
45. Pöltl, G., Kerner, D., Paschinger, K., and Wilson, I. B. (2007) N-Glycans of
the porcine nematode parasite Ascaris suum are modified with phospho-
rylcholine and core fucose residues. FEBS J. 274, 714–726
46. Brand, A. H., and Perrimon, N. (1993) Targeted gene expression as a
means of altering cell fates and generating dominant phenotypes. Devel-
opment 118, 401–415
47. Campos-Ortega, J. A., and Hartenstein, V. (1985) The Embryonic Devel-
opment of Drosophila melanogaster, Springer Verlag, Berlin
48. Patel,N.H.(1994)Imagingneuronalsubsetsandothercelltypesinwhole-
mount Drosophila embryos and larvae using antibody probes. Methods
Cell Biol. 44, 445–487
49. Berninsone, P., Eckhardt, M., Gerardy-Schahn, R., and Hirschberg, C. B.
(1997) Functional expression of the murine Golgi CMP-sialic acid trans-
porter in Saccharomyces cerevisiae. J. Biol. Chem. 272, 12616–12619
50. Kochibe, N., and Furukawa, K. (1980) Purification and properties of a
novelfucose-specifichemagglutininofAleuriaaurantia.Biochemistry19,
2841–2846
51. Altmann, F., Kornfeld, G., Dalik, T., Staudacher, E., and Glössl, J. (1993)
Processingofasparagine-linkedoligosaccharidesininsectcells.N-Acetyl-
glucosaminyltransferase I and II activities in cultured lepidopteran cells.
Glycobiology 3, 619–625
52. Rabouille,C.,Hui,N.,Hunte,F.,Kieckbusch,R.,Berger,E.G.,Warren,G.,
and Nilsson, T. (1995) Mapping the distribution of Golgi enzymes in-
volved in the construction of complex oligosaccharides. J. Cell Sci. 108,
1617–1627
53. Sarkar,M.,andSchachter,H.(2001)CloningandexpressionofDrosophila
melanogaster UDP-GlcNAc:?-3-D-mannoside ?1,2-N-acetylglucosami-
nyltransferase I. Biol. Chem. 382, 209–217
54. Kawar,Z.,andJarvis,D.L.(2001)Biosynthesisandsubcellularlocalization
of a lepidopteran insect ?1,2-mannosidase. Insect Biochem. Mol. Biol. 31,
289–297
55. Vadaie,N.,andJarvis,D.L.(2004)Molecularcloningandfunctionalchar-
acterization of a lepidopteran insect ?4-N-acetylgalactosaminyltrans-
ferase with broad substrate specificity, a functional role in glycoprotein
biosynthesis, and a potential functional role in glycolipid biosynthesis.
J. Biol. Chem. 279, 33501–33518
56. Robinow, S., and White, K. (1988) The locus elav of Drosophila melano-
gaster is expressed in neurons at all developmental stages. Dev. Biol. 126,
294–303
57. Arakawa,K.,Abe,M.,Noda,Y.,Adachi,H.,andYoda,K.(2006)Molecular
cloning and characterization of a Pichia pastoris ortholog of the yeast
Golgi GDP-mannose transporter gene. J. Gen. Appl. Microbiol. 52,
137–145
58. Cottrell, T. R., Griffith, C. L., Liu, H., Nenninger, A. A., and Doering, T. L.
(2007) The pathogenic fungus Cryptococcus neoformans expresses two
functional GDP-mannose transporters with distinct expression patterns
and roles in capsule synthesis. Eukaryot. Cell 6, 776–785
59. Dean, N., Zhang, Y. B., and Poster, J. B. (1997) The VRG4 gene is required
for GDP-mannose transport into the lumen of the Golgi in the yeast,
Saccharomyces cerevisiae. J. Biol. Chem. 272, 31908–31914
60. Jackson-Hayes, L., Hill, T. W., Loprete, D. M., Fay, L. M., Gordon, B. S.,
Nkashama,S.A.,Patel,R.K.,andSartain,C.V.(2008)TwoGDP-mannose
transporters contribute to hyphal form and cell wall integrity in Aspergil-
lus nidulans. Microbiology 154, 2037–2047
DrosophilaNeurallyAlteredCarbohydrateMutant
29608 JOURNALOFBIOLOGICALCHEMISTRY VOLUME287•NUMBER35•AUGUST24,2012
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from

Page 11

61. Nishikawa,A.,Mendez,B.,Jigami,Y.,andDean,N.(2002)Identificationof
a Candida glabrata homologue of the S. cerevisiae VRG4 gene, encoding
the Golgi GDP-mannose transporter. Yeast 19, 691–698
62. Nishikawa, A., Poster, J. B., Jigami, Y., and Dean, N. (2002) Molecular and
phenotypic analysis of CaVRG4, encoding an essential Golgi apparatus
GDP-mannose transporter. J. Bacteriol. 184, 29–42
63. Hong, K., Ma, D., Beverley, S. M., and Turco, S. J. (2000) The Leishmania
GDP-mannose transporter is an autonomous, multispecific, hexameric
complex of LPG2 subunits. Biochemistry 39, 2013–2022
64. Ma, D., Russell, D. G., Beverley, S. M., and Turco, S. J. (1997) Golgi GDP-
mannose uptake requires Leishmania LPG2. A member of a eukaryotic
family of putative nucleotide sugar transporters. J. Biol. Chem. 272,
3799–3805
65. Baldwin,T.C.,Handford,M.G.,Yuseff,M.I.,Orellana,A.,andDupree,P.
(2001) Identification and characterization of GONST1, a Golgi-localized
GDP-mannose transporter in Arabidopsis. Plant Cell 13, 2283–2295
66. Handford, M. G., Sicilia, F., Brandizzi, F., Chung, J. H., and Dupree, P.
(2004) Arabidopsis thaliana expresses multiple Golgi-localized nucleo-
tide sugar transporters related to GONST1. Mol. Genet. Genomics 272,
397–410
67. Ueki, N., and Nishii, I. (2009) Controlled enlargement of the glycoprotein
vesicle surrounding a Volvox embryo requires the InvB nucleotide sugar
transporter and is required for normal morphogenesis. Plant Cell 21,
1166–1181
68. Suda,T.,Kamiyama,S.,Suzuki,M.,Kikuchi,N.,Nakayama,K.,Narimatsu,
H., Jigami, Y., Aoki, T., and Nishihara, S. (2004) Molecular cloning and
characterization of a human multisubstrate specific nucleotide sugar
transporter homologous to Drosophila fringe connection. J. Biol. Chem.
279, 26469–26474
69. Selva, E. M., Hong, K., Baeg, G. H., Beverley, S. M., Turco, S. J., Perrimon,
N., and Ha ¨cker, U. (2001) Dual role of the fringe connection gene in both
heparan sulfate and fringe-dependent signaling events. Nat. Cell Biol. 3,
809–815
70. Muraoka,M.,Kawakita,M.,andIshida,N.(2001)Molecularcharacteriza-
tion of human UDP-glucuronic acid/UDP-N-acetylgalactosamine trans-
porter,anovelnucleotidesugartransporterwithdualsubstratespecificity.
FEBS Lett. 495, 87–93
71. Berninsone,P.,Hwang,H.Y.,Zemtseva,I.,Horvitz,H.R.,andHirschberg,
C.B.(2001)SQV-7,aproteininvolvedinCaenorhabditiselegansepithelial
invagination and early embryogenesis, transports UDP-glucuronic acid,
UDP-N-acetylgalactosamine, and UDP-galactose. Proc. Natl. Acad. Sci.
U.S.A. 98, 3738–3743
72. Miura, N., Ishida, N., Hoshino, M., Yamauchi, M., Hara, T., Ayusawa, D.,
and Kawakita, M. (1996) Human UDP-galactose translocator. Molecular
cloningofacomplementaryDNAthatcomplementsthegeneticdefectof
amutantcelllinedeficientinUDP-galactosetranslocator.J.Biochem.120,
236–241
73. Ishida, N., Miura, N., Yoshioka, S., and Kawakita, M. (1996) Molecular
cloningandcharacterizationofanovelisoformofthehumanUDP-galac-
tose transporter and of related complementary DNAs belonging to the
nucleotide sugar transporter gene family. J. Biochem. 120, 1074–1078
74. Ishida, N., Yoshioka, S., Chiba, Y., Takeuchi, M., and Kawakita, M. (1999)
MolecularcloningandfunctionalexpressionofthehumanGolgiUDP-N-
acetylglucosamine transporter. J. Biochem. 126, 68–77
75. Ashikov, A., Routier, F., Fuhlrott, J., Helmus, Y., Wild, M., Gerardy-
Schahn,R.,andBakker,H.(2005)ThehumansolutecarriergeneSLC35B4
encodes a bifunctional nucleotide sugar transporter with specificity for
UDP-xylose and UDP-N-acetylglucosamine. J. Biol. Chem. 280,
27230–27235
76. Freeze, H. H., and Sharma, V. (2010) Metabolic manipulation of glycosyl-
ation disorders in humans and animal models. Semin. Cell Dev. Biol. 21,
655–662
77. Thiel,C.,andKörner,C.(2011)Mousemodelsforcongenitaldisordersof
glycosylation. J. Inherit. Metab. Dis. 34, 879–889
78. Bier, E. (2005) Drosophila, the golden bug, emerges as a tool for human
genetics. Nat. Rev. Genet. 6, 9–23
79. tenHagen,K.G.,Zhang,L.,Tian,E.,andZhang,Y.(2009)Glycobiologyon
the fly. Developmental and mechanistic insights from Drosophila. Glyco-
biology 19, 102–111
80. Krieg,D.R.(1963)Ethylmethanesulfonate-inducedreversionofbacterio-
phage T4rII mutants. Genetics 48, 561–580
81. Lawley, P. D., and Brookes, P. (1963) Further studies on the alkylation of
nucleic acids and their constituent nucleotides. Biochem. J. 89, 127–138
82. Bentley, A., MacLennan, B., Calvo, J., and Dearolf, C. R. (2000) Targeted
recovery of mutations in Drosophila. Genetics 156, 1169–1173
83. Greene, E. A., Codomo, C. A., Taylor, N. E., Henikoff, J. G., Till, B. J.,
Reynolds, S. H., Enns, L. C., Burtner, C., Johnson, J. E., Odden, A. R.,
Comai, L., and Henikoff, S. (2003) Spectrum of chemically induced muta-
tions from a large-scale reverse-genetic screen in Arabidopsis. Genetics
164, 731–740
84. Vidal, A., Abril, N., and Pueyo, C. (1995) DNA repair by Ogt alkyltrans-
feraseinfluencesEMSmutationalspecificity.Carcinogenesis16,817–821
85. Gazit, Y., Mory, A., Etzioni, A., Frydman, M., Scheuerman, O., Gershoni-
Baruch, R., and Garty, B. Z. (2010) Leukocyte adhesion deficiency type II.
Long-term follow-up and review of the literature. J. Clin. Immunol. 30,
308–313
86. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., and McCawley, P. (1977)
The establishment of two cell lines from the insect Spodoptera frugiperda
(Lepidoptera; Noctuidae). In Vitro 13, 213–217
87. Staudacher, E., Kubelka, V., and März, L. (1992) Distinct N-glycan fuco-
sylation potentials of three lepidopteran cell lines. Eur. J. Biochem. 207,
987–993
88. Gao, X. D., and Dean, N. (2000) Distinct protein domains of the yeast
Golgi GDP-mannose transporter mediate oligomer assembly and export
from the endoplasmic reticulum. J. Biol. Chem. 275, 17718–17727
89. Hidalgo, A., Ma, S., Peired, A. J., Weiss, L. A., Cunningham-Rundles, C.,
and Frenette, P. S. (2003) Insights into leukocyte adhesion deficiency type
2 from a novel mutation in the GDP-fucose transporter gene. Blood 101,
1705–1712
90. Etzioni, A., Sturla, L., Antonellis, A., Green, E. D., Gershoni-Baruch, R.,
Berninsone, P. M., Hirschberg, C. B., and Tonetti, M. (2002) Leukocyte
adhesion deficiency (LAD) type II/carbohydrate deficient glycoprotein
(CDG) IIc founder effect and genotype/phenotype correlation. Am. J.
Med. Genet. 110, 131–135
91. Ishikawa, H. O., Ayukawa, T., Nakayama, M., Higashi, S., Kamiyama, S.,
Nishihara, S., Aoki, K., Ishida, N., Sanai, Y., and Matsuno, K. (2010) Two
pathways for importing GDP-fucose into the endoplasmic reticulum lu-
men function redundantly in the O-fucosylation of Notch in Drosophila.
J. Biol. Chem. 285, 4122–4129
92. Lübke,T.,Marquardt,T.,vonFigura,K.,andKo ¨rner,C.(1999)Anewtype
of carbohydrate-deficient glycoprotein syndrome due to a decreased im-
port of GDP-fucose into the Golgi. J. Biol. Chem. 274, 25986–25989
93. Sturla, L., Puglielli, L., Tonetti, M., Berninsone, P., Hirschberg, C. B., De
Flora, A., and Etzioni, A. (2001) Impairment of the Golgi GDP-L-fucose
transport and unresponsiveness to fucose replacement therapy in LAD II
patients. Pediatr. Res. 49, 537–542
94. Moriwaki, K., Noda, K., Nakagawa, T., Asahi, M., Yoshihara, H., Tanigu-
chi, N., Hayashi, N., and Miyoshi, E. (2007) A high expression of GDP-
fucosetransporterinhepatocellularcarcinomaisakeyfactorforincreases
in fucosylation. Glycobiology 17, 1311–1320
DrosophilaNeurallyAlteredCarbohydrateMutant
AUGUST24,2012•VOLUME287•NUMBER35JOURNALOFBIOLOGICALCHEMISTRY 29609
at Univ. of Wyoming Libraries, on September 6, 2012
www.jbc.org
Downloaded from