Development of a PCR-based SNP marker system for effective selection of kernel length and kernel elongation in rice

Abstract

Kernel length in rice (Oryza sativa L.) is controlled by various quantitative trait loci of which GS3 is the most important, being responsible for 80–90% of the variation in kernel length. A mutation in the second exon of this
gene has been reported to be associated with maximum variations in the kernel length. We have developed a simple PCR-based
marker system named DRR-GL which targets the functional nucleotide polymorphism at GS3. This marker system has the advantages that it is easy to use, saves time and cost, and is amenable for large-scale marker-assisted
selection for the trait of kernel length. Validation of this marker in a segregating population and 152 rice varieties, which
includes 30 elite basmati varieties, reveals its effective co-segregation and association with the traits of kernel length
as well as kernel elongation after cooking. We recommend utilization of this simple, low-cost marker system in breeding programs
targeted at improvement of key rice grain quality traits, kernel length and kernel elongation.

KeywordsKernel length-Kernel elongation-
Oryza sativa
-
GS3
-Basmati

Full text

Page 1

SHORT COMMUNICATION
Development of a PCR-based SNP marker system
for effective selection of kernel length and kernel
elongation in rice
G. Ramkumar•A. K. P. Sivaranjani•Manish K. Pandey•K. Sakthivel•
N. Shobha Rani•I. Sudarshan•G. S. V. Prasad•C. N. Neeraja•
R. M. Sundaram•B. C. Viraktamath•M. S. Madhav
Received: 24 May 2010/Accepted: 30 July 2010/Published online: 17 August 2010
? Springer Science+Business Media B.V. 2010
Abstract
controlled by various quantitative trait loci of which
GS3 is the most important, being responsible for
80–90% of the variation in kernel length. A mutation
in the second exon of this gene has been reported to
be associated with maximum variations in the kernel
length. We have developed a simple PCR-based
marker system named DRR-GL which targets the
functional nucleotide polymorphism at GS3. This
marker system has the advantages that it is easy to
use, saves time and cost, and is amenable for large-
scale marker-assisted selection for the trait of kernel
length. Validation of this marker in a segregating
population and 152 rice varieties, which includes
30 elite basmati varieties, reveals its effective
Kernel length in rice (Oryza sativa L.) is
co-segregation and association with the traits of
kernel length as well as kernel elongation after
cooking. We recommend utilization of this simple,
low-cost marker system in breeding programs tar-
geted at improvement of key rice grain quality traits,
kernel length and kernel elongation.
Keywords
Oryza sativa ? GS3 ? Basmati
Kernel length ? Kernel elongation ?
Grain kernel length (KL) is an important agronomic
and grain quality trait in breeding of rice (Oryza
sativa L.), influencing seed weight and ultimately the
crop yield (Luo et al. 2004). Rice kernel length and
shape are the major determining factors of the
physical appearance of the rice grain and have
significant influence on the milling and cooking
quality (Fan et al. 2009). Consumer preferences for
rice kernel length vary not only within a country, but
also in different parts of the world. In most of the
Asian countries such as India, Pakistan, China,
Thailand and USA the long slender grain type is
preferred, whereas the short grain type is preferred in
Japan and Sri Lanka (Unnevehr et al. 1992). Incor-
poration of preferred grain traits in a variety attracts
rice consumers and leads to high market value.
Basmati rice constitutes a unique group par excel-
lence in grain and cooking quality features such as
long slender grain with extra kernel elongation after
cooking (KE) and distinct aroma, on account of
Electronic supplementary material
of this article (doi:10.1007/s11032-010-9492-3) contains
supplementary material, which is available to authorized users.
The online version
G. Ramkumar ? A. K. P. Sivaranjani ? K. Sakthivel ?
C. N. Neeraja ? R. M. Sundaram ? B. C. Viraktamath ?
M. S. Madhav (&)
Biotechnology Lab, Crop Improvement Section,
Directorate of Rice Research, Rajendranagar,
Hyderabad 500030, India
e-mail: sheshu_24@yahoo.com; sheshu24@gmail.com
M. K. Pandey ? N. Shobha Rani ? I. Sudarshan ?
G. S. V. Prasad
Plant Breeding, Crop Improvement Section, Directorate
of Rice Research, Rajendranagar,
Hyderabad 500030, India
123
Mol Breeding (2010) 26:735–740
DOI 10.1007/s11032-010-9492-3

Page 2

which it commands high prices (IARI 1980; Shobha
Rani 1992). These unique features are considered to
play a major role in marketability and consumer
acceptability. Among all the grain quality traits, KL
and KE are considered to be important. The Ministry
of Commerce, Government of India, has set a
minimum standard for grain length of A-grade
basmati rice of 7.0 mm (notification no. 67, 23 Jan,
2003).
The trait of kernel length is controlled by quanti-
tative trait loci (QTL) (McKenzie and Rutger 1983)
and various studies carried out across different genetic
backgrounds and environments have identified a QTL
with major effect for kernel length in the vicinity of
the centromeric region of chromosome 3 (Huang et al.
1997; Redona and Mackill 1998; Tan et al. 2000; Xing
et al. 2001; Aluko et al. 2004; Li et al. 2004a; Wan
et al. 2005). This QTL, later named GS3, located in
the pericentromeric region of chromosome 3 is
reported to be responsible for 80–90% of the variation
in kernel length. Later, the locus was also resolved as
a minor QTL for grain width and thickness (Fan et al.
2006). GS3 contains 5 exons, and encodes for a
transmembrane protein. Sequence comparison of
short- and long-grain genotypes revealed that exon 2
of GS3 has a single nucleotide polymorphism (SNP),
which alters the grain phenotype. This SNP changes a
cysteine codon (TGC) to a termination codon (TGA)
at the protein level. The dominant C allele codes for
functional protein (containing 232 amino acids),
which favors the short grain. Another allele, wherein
A is present instead of C, is a recessive allele, and
produces the abortive protein (containing only 178
amino acids), which leads to the loss of a putative
PEBP-like domain, a transmembrane region, a puta-
tive TNFR/NGFR family cysteine-rich domain and a
VWFC module, and finally results in long grain (Fan
et al. 2006). GS3 has a negative effect on the grain
size, i.e. it favors the short grain, because this grain
type is frequently associated with larger number of
seeds per plant, more rapid maturity and wider
geographic distribution (Li et al. 2004a).
Based on the SNP in the second exon of the gene, a
CAPS marker (SF28) was developed by Fan et al.
(2009), but use of this marker requires additional steps
like restriction digestion after PCR, and use of
polyacrylamide denaturing gels for fragment separa-
tion, followed by silver staining, which makes
this marker laborious and costly for regular use in
marker-assisted selection (MAS). The simplest way to
develop PCR-based SNP markers is through targeting
the functional SNPs by designing PCR primers such
that a forward or reverse primer has a specific
deoxynucleotide triphosphate (dNTP) at the 30end
(Collard et al. 2008). PCR amplification is successful
for the appropriate primer template combination and
fails when the specific 30base in the primer is not
complementary to the template (Hayashi et al. 2004).
Through the simultaneous amplification of both
alleles at a given locus by a nested-primer system or
by multiplex PCR, co-dominant allele-specific mark-
ers can be developed. Because of their advantages,
development of simple PCR-based marker(s) for
important traits is essential for routine screening and
MAS to improve rice quality. Hence, in this study, we
attempted to develop a simple PCR-based marker
targeting the functional SNP of GS3, which can be
resolved in simple agarose gels and hence could be
better adapted for routine MAS programs, involving
extensive breeding material.
The plant material used in this study included a F2
mapping population derived from the cross between
ASG 1025, a short-grain genotype having low KE
(KL = 3.83 mm, KE = 8.00 mm) and Pusa 1401-97-
7-1-5, a long-grain genotype having high KE
(KL = 7.6 mm, KE = 17.7 mm). This mapping pop-
ulation was utilized to validate the newly developed
marker. Ten randomly chosen grains of fully milled
paddy from each F2 plant were lined up length-wise; a
vernier caliper was used to measure average kernel
length of grain for each plant and data were recorded.
The genotypes which showed a kernel length of 6 mm
or less were classified as short-grain genotypes and
genotypes which showed a kernel length of more than
6 mm were noted as long-grain genotypes (Virakta-
math et al. 2007). KE was measured manually after
the milled rice kernels were cooked by the excess
water method (Tian et al. 2005) and the genotypes or
individuals which showed less than 11 mm KE were
classified as low KE and the genotypes or individuals
which showed 11 mm or greater KE were classified as
high KE (AICRIP 1998). In addition to this mapping
population, 122 different rice varieties (Electronic
Supplementary Material Table 1) and 30 important
basmati varieties (Electronic Supplementary Material
Table 2) were selected randomly from the Directorate
of Rice Research germplasm collection and analyzed
to validate the utility of the newly developed marker.
736Mol Breeding (2010) 26:735–740
123

Page 3

In order to design a molecular marker targeting the
functional nucleotide polymorphism, the genomic
sequence of the GS3 gene was obtained from
GenBank (accession number DQ355996). A pair of
primers targeting each C and A allele of GS3 and one
pair of external primers were designed using the
software tools FastPCR (Kalendar 2009) and Primer 3
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.
www.cgi) and synthesized (IDT, USA). In this marker
assay, two primer pairs have to be multiplexed in a
single PCR reaction to get a co-dominant type of
amplification pattern. This multiplex marker assay
consists of two external primers (External Forward
Primer—EFP and External Reverse Primer—ERP)
flanking the SNP and one internal primer targeting the
C allele (Internal Reverse Short Primer—IRSP), while
the other internal primer targets the A allele (Internal
Forward Long Primer—IFLP). The external primers
EFP/ERP amplify a region of 365 bp as a common
fragment in both dominant and recessive alleles, while
the allele-specific primer pairs, EFP/IRSP and ERP/
IFLP, amplify regions of 147 and 262 bp, respectively
(Fig. 1). We have named this marker system DRR-
GL. The primers have been designed in such a way
that each allele-specific primer produces a PCR
product size of 100 bp more or less than that of any
other and hence PCR amplicons can be separated in a
lesser amount of agarose gels (i.e. cheaper gels). To
achieve this, two sets of internal primers targeting the
specific SNP were designed and, among them, DRR-
GL produced the desired amplification pattern.
Leaves of 20-day-old seedlings were collected and
used for DNA isolation. Genomic DNA was extracted
by a modified potassium acetate method of Della-
porta et al. (1983). PCR was performed in a 15 ll
reaction with 109 PCR buffer with 1.5 mM MgCl2,
2.5 mM dNTPs, the aforementioned four primers,
1 U high fidelity Taq DNA polymerase (MBI
Fermentas, Lithuania) and 15–20 ng of template
DNA. The PCR cycling condition followed was: a
4 min initial denaturation at 94?C followed by 30
cycles of denaturation for 30 s at 94?C, 60 s anneal-
ing and elongation at 69?C, concluding with a final
extension of 72?C for 7 min, in an Eppendorf thermal
cycler (USA). The resultant PCR products were
separated in 1% agarose gel (Amresco, USA), stained
with ethidium bromide and visualized under a UV
transilluminator (Alpha Innotech, USA). The ampli-
fied fragments were scored as C allele, A allele and
heterozygous. The primer pairs and their sequences
are listed in Table 1. The annealing temperature for
the primer pairs was adjusted through gradient PCR
to avoid non-specific allele amplification.
To check the accuracy and reliability of marker-
based genotyping, the marker was checked in 200
individuals constituting the F2 mapping population
developed as mentioned earlier. With respect to our
marker DRR-GL, the C allele-specific fragment
co-segregated with kernel length of 6 mm or less
(short grain), while the A allele-specific band
co-segregated with kernel length of more than
6.4 mm in the population. Out of the 200 individuals
genotyped with this marker, 48 were observed to be
homozygous short-grain type, 98 samples were of
heterozygous short-grain type and the remaining 54
were observed to be of homozygous long-grain type
(Fig. 2), and there was a near-perfect match between
phenotype data and genotype data derived from
marker analysis with only two recombinants. To
validate the utility of DRR-GL in various genotypes,
we analyzed 152 rice varieties with different kernel
C
A
IRSP
ERP
EFP
IFLP
C/A in exon II of GS3
C allele amplicon (147bp)
A allele amplicon (262 bp)
Common amplicon (365 bp)
Fig. 1 Schematic illustration of the development of PCR-
based marker DRR-GL targeting a SNP at the second exon of
GS3 locus. This multiplex marker assay consists of two
external primers (EFP and ERP) flanking the SNP and one
internal primer targeting the C allele (IRSP) while the other
internal primer targets the A allele (IFLP). The external
primers EFP/ERP amplify a region of 365 bp as a common
fragment in both dominant and recessive alleles, while the
allele-specific primer pairs, EFP/IRSP and ERP/IFLP, amplify
regions of 147 and 262 bp respectively
Table 1 List of primers of DRR-GL marker system
S. no.Primer namePrimer sequence
1EFPaggctaaacacatgcccatctc
2ERPcccaacgttcagaaattaaatgtgctg
3IRSPaacagcaggctggcttactctctg
4IFLPacgctgcctccagatgctga
Mol Breeding (2010) 26:735–740737
123

Page 4

lengths (Supplementary Table 1) which includes 30
important basmati varieties (Supplementary Table 2).
While analyzing the rice varieties, Jeeraga samba and
Basmati 370 were used as positive controls for short
and long kernel length respectively. The marker
system DRR-GL was observed to unambiguously
identify all the basmati samples as long-grain ones
(Fig. 3), whereas in non-basmati samples we found
some exceptions (Supplementary Table 1). The
minor exceptions in some genotypes may be due to
the other minor QTLs acting as modifiers (Wan et al.
2006; Li et al. 2004b), causing variation in the kernel
size in these exceptional genotypes.
The kernel length of rice grain will expand by
absorbing water during soaking and cooking. Kernel
length elongation after cooking is one of the impor-
tant characters of rice grain, especially for basmati
varieties, and breeders usually give high importance
to this trait due to the consumer preference for
varieties with high KE (Abbas 2000; Sakila et al.
1999). Development of a tightly linked molecular
marker for this trait will be helpful for selection of the
target genotypes. However, the RFLP markers,
RZ562 and RZ323, earlier reported to be linked to
KE (Ahn et al. 1993) are 14.6 cM distant from the
trait locus on chromosome 8 and hence using these
markers is impractical for large-scale, routine MAS.
Another reported SSR marker, RM44, located on
chromosome 8 (Biswas et al. 2004) could not
distinguish the different rice genotypes based on
their KE values. Since then, not much progress has
been observed in development of markers for KE for
use in the breeding programs. As the parents of the F2
population used in our study possess KE values in
opposite extremes, we also validated the marker
DRR-GL for its linkage with the trait of KE.
Interestingly, the marker was observed to co-segre-
gate near-perfectly with the KE trait. The C allele co-
segregated with low KE (less than 11.0 mm) and the
A allele co-segregated with high KE (11.0 mm and
above). The marker genotypic data and phenotypic
data matched very well with each other and only two
recombinants were observed in the mapping popula-
tion. Interestingly, the two genotypes which showed
recombination for KL also showed recombination for
KE. The results of our study indicate that GS3 also
has a role in controlling KE. Li et al. (2004b) also
reported the single QTL for KE and KL on chromo-
some 3 where GS3 was mapped. There are other
reports indicated the presence of QTL for KE on
M P1 P2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1819 20 21 22 M
M 23 24 25 26 27 28 29 30 31 32 33 34 35 36* 37 38 39 40 41 42 43 44 45 46 47 48 49 50
S L S H L H SL H L HL H L HH S S H L H S H L
L S H LS H S S H H H H H L H H H H S H H S L H H H H H
a
b
365 bp
262 bp
147 b
p
Fig. 2 a and b DRR-GL amplification pattern in F2 popula-
tion: F2 mapping population derived from the cross between
ASG 1025 (short-grain type having low KE) and Pusa 1401-
97-7-1-5 (long-grain type having high KE) was utilized to
validate the DRR-GL marker system. The amplified fragments
were scored as C allele, A allele and heterozygous. While
analyzing the rice varieties, Jeeraga samba and Basmati 370
were used as positive controls for short and long kernel length
respectively. M 100-bp ladder; P1 ASG 1025; P2 Pusa 1401-
97-7-1-5; 1–50 F2 population samples; S Short grain; L Long
grain; Asterisk recombination
365 bp
262 bp
147 bp
M 123456789 10 11 12 13 14 15 16 17 18 19 20 21 22 M
SLSSS SSSS SS SLL LLLLLLLL
Fig. 3 Amplification pattern of DRR-GL in basmati and non-
basmati samples: thirty important basmati rice varieties were
analyzed to check the accuracy of the DRR-GL marker system.
The amplified fragments were scored as C allele, A allele and
heterozygous. While analyzing the rice varieties, Jeeraga
samba and Basmati 370 were used as positive controls for
short and long kernel length respectively. M 100-bp ladder;
1 Jeeraga samba; 2 Basmati 370; 3–12 short-grain non-basmati
samples; 13–22 long-grain basmati samples; S Short grain;
L Long grain
738Mol Breeding (2010) 26:735–740
123

Page 5

chromosomes 2, 6 8 and 11 (Tian et al. 2005; Ge
et al. 2005; Ahn et al. 1993) which perhaps act as
modifiers. A positive correlation between KL and KE
has been reported earlier by Khatun et al. (2003); this
is likely due to the fact that kernel elongation is
measured as a proportion of kernel length, and the
elongation of the rice kernel after cooking is roughly
proportional to KL (Li et al. 2004b). However, in our
study, we noticed that a few genotypes have long KL,
but show exceptionally low kernel elongation, and
vice versa (Supplementary Table 1). In those excep-
tional genotypes, this marker (DRR-GL) may not be
appropriate for genotyping.
In a recent report it is mentioned that the C–A
mutation of GS3 was observed only in O. sativa and
absent in other Oryza species (Takano-kai et al.
2009), indicating that the mutation associated with
the long-grain type must have arisen very recently in
the process of rice domestication. This mutation has
led to the development of molecular markers for the
important locus GS3. The marker developed in this
study, DRR-GL, is cost-effective, consumes less time
and is simple compared to the reported CAPS marker.
This marker system was validated with different rice
varieties and important basmati samples for its
reliability and was observed to co-segregate to the
extent of 99% with variations of KL and KE in the F2
population. We assume that a few plants did not
display co-segregation in our study because of the
influence of minor QTL, which are reported to be
located on chromosomes 2, 7, 8, 10 and 11 of rice
(Tan et al. 2000; Xing et al. 2001; Aluko et al. 2004;
Wan et al. 2005; Jain et al. 2006; Amarawathi et al.
2008; Bai et al. 2010). As long slender grain is a
defining character for most of the basmati rice
varieties, the DRR-GL marker system will be very
useful for screening basmati samples for that trait.
This marker system can also be used for high-
throughput screening of samples by using recent
technologies like MultiNA (Shimadzu, Japan) where
gel electrophoresis can be avoided. It is well proven
that KL is directly linked with grain weight and hence
with crop yield. Our study reveals that this GS3 locus
is also tightly linked with KE. Hence, by using this
marker to select this locus, one can improve the rice
grain quality (KL and KE) as well as quantity (grain
weight and crop yield). We recommend this func-
tional and simpler marker, DRR-GL, for routine and
large-scale genotyping and selection of targeted plant
materials at the seedling stage itself.
Acknowledgments
ment of Biotechnology, Government of India, for providing
funds for carrying out the research work.
The authors are grateful to the Depart-
References
Abbas ST (2000) Development of rachana basmati—a new
fine, aromatic rice variety—through biotechnological
tools. Sci Vis (Pakistan) 5:74–84
Ahn SN, Bollich CN, McClung AM, Tanksley SD (1993)
RFLP analysis of genomic regions associated with cooked
kernel elongation in rice. Theor Appl Genet 87:27–32
AICRIP (1998) Proceedings of 33rd annual rice group meeting
of all India coordinated rice improvement project
(AICRIP), PAU, Ludhiana, 15–18 April 1998
Aluko G, Martinez C, Tohme J, Castano C, Bergman C, Oard
HJ (2004) QTL mapping of grain quality traits from the
interspecific cross Oryza sativa 9 O. glaberrima. Theor
Appl Genet 109:630–639
Amarawathi Y, Singh R, Singh AK, Singh VP, Mohapatra T,
Sharma TR, Singh NK (2008) Mapping of quantitative
trait loci for basmati quality traits in rice (Oryza sativa
L.). Mol Breed 21:49–65
Bai X, Luo L, Yan W, Kovi MR, Zhan W, Xing Y (2010)
Genetic dissection of rice grain shape using a recombinant
inbred line population derived from two contrasting par-
ents and fine mapping a pleiotropic quantitative trait locus
qGL7. BMC Genet 11:16
Biswas S, Dey N, Ray CT, Dey SR, De M, Prasad M, Ghose
TK (2004) Identification of major QTL for cooked kernel
elongation on chromosome 8 of rice (O. sativa L.). In:
Proceedings of symposium on comparative and functional
genomics, Hyderabad, India, p 31
Collard BCY, Vera Cruz CM, McNally KL, Virk PS, Mackill
DJ (2008) Rice molecular breeding laboratories in the
genomics era: current status and future considerations. Int
J Plant Genomics 2008:524847
Dellaporta SL, Wood J, Hick JB (1983) A plant DNA mini-
preparation: version II. Plant Mol Biol Rep 1:19–21. doi:
10.1007/BF02712670
Fan C, Xing YZ, Mao HL, Lu TT, Han B, Xu CG, Li XH,
Zhang QF (2006) GS3, a major QTL for grain length and
weight and minor QTL for grain width and thickness in
rice, encodes a putative transmembrane protein. Theor
Appl Genet 112:1164–1171
Fan C, Yu S, Wand C, Xing Y (2009) A causal C–A mutation
in the second exon of GS3 highly associated with rice
grain length and validated as a functional marker. Theor
Appl Genet 118:465–472
Ge XJ, Xing YZ, Xu CG, He YQ (2005) QTL analysis of
cooked rice grain elongation, volume expansion, and
water absorption using a recombinant inbred population.
Plant Breed 124:121–126
Mol Breeding (2010) 26:735–740739
123

Page 6

Hayashi K, Hashimoto N, Daigen M, Ashikawa I (2004)
Development of PCR-based SNP markers for rice blast
resistance genes at the Piz locus. Theor Appl Genet
108:1212–1220
Huang N, Parco A, Mew T, Magpantay G, McCouch S,
Guiderdoni E, Xu JC, Subudhi P, Angeles ER, Khush GS
(1997) RFLP mapping of isozymes, RAPD, and QTLs for
grain shape, brown planthopper resistance in a doubled-
haploid rice population. Mol Breed 3:105–113
Indian Agricultural Research Institute (IARI) (1980) High
yielding basmati rice: problems, progress and prospects.
IARI Tech Res Bull 30:46
Jain N, Jain S, Saini N, Jain RK (2006) SSR analysis of
chromosome 8 regions associated with aroma and cooked
kernel elongation in Basmati rice. Euphytica 152:259–273
Kalendar R (2009) FastPCR software for PCR primer and
probe design and repeat search. www.biocenter.helsinki.
fi/bi/programs/fastpcr.htm
Khatun MM, Ali MH, Cruz QDD (2003) Correlation studies on
grain physicochemical characteristics of aromatic rice.
Pak J Biol Sci 6:511–513
Li J, Thomson M, McCouch SR (2004a) Fine mapping of a
grain-weight quantitative trait locus in the pericentro-
metric region of rice chromosome 3. Genetics 168:
2187–2195
Li J, Xiao J, Grandillo S, Jiang L, Wan Y, Deng Q, Yuan L,
McCouch SR (2004b) QTL detection for rice grain quality
traits using an interspecific backcross population derived
from cultivated Asian (O. sativa L.) and African
(O. glaberrima S.) rice. Genome 47:697–704
Luo YK, Zhu ZW, Chen N, Duan BW, Zhang LP (2004) Grain
types and related quality characteristics of rice in China.
Chin J Rice Sci 18:135–139
McKenzie KS, Rutger JN (1983) Genetic analysis of amylose
content, alkali spreading score, and grain dimensions in
rice. Crop Sci 23:306–313
Redona ED, Mackill DJ (1998) Quantitative trait locus analysis
for rice panicle and grain characteristics. Theor Appl
Genet 96:957–963
Sakila M, Ibrahim SM, Anandakumar CR, Backiyarani S,
Bsatian D (1999) Grain quality characteristics of aromatic
and nonaromatic rice cultivars. Int Rice Res Notes
24:17–18
Shobha Rani N (1992) Research efforts to develop scented
quality rices for increased productivity and export pur-
poses. In: Paper presented at the seminar for the awardees
of ‘‘Outstanding young women in rice science’’. IRRI,
Las Banos, Philippines, 21–25 April
Takano-Kai N, Jiang H, Kubo T, Sweeney M, Matsumoto T,
Kanamori H,Padhukasahasram
Yoshimura A, Doi K, McCouch S (2009) Evolutionary
history of GS3, a gene conferring grain length in rice.
Genetics 182:1323–1334
TanYF,XingYZ,LiJX,YuSB,XuCG,ZhangQ(2000)Genetic
bases of appearance quality of rice grains in Shanyou 63, an
elite rice hybrid. Theor Appl Genet 101:823–829
Tian R, Jiang GH, Shen LH, Wang LQ, He YQ (2005) Map-
ping quantitative trait loci underlying the cooking and
eating quality of rice using a DH population. Mol Breed
15:117–124
Unnevehr LJ, Du VB, Juliano BO (1992) Consumer demand
for rice grain quality. International Rice Research Insti-
tute, and International Development Research Center,
Manila, Ottawa
Viraktamath BC, Shobha Rani N, Singh M, Meera SN, Prasad
GSV (2007) Laboratory manual on rice grain quality:
physico-chemical and molecular procedures, quality
control of basmati rice, Directorate of Rice Research,
Rajendranagar, Hyderabad. 25–30 July 2007, p 5
Wan XY, Wan JM, Weng JF, Jiang L, Bi JC, Wang CM, Zhai
HQ (2005) Stability of QTLs for rice grain dimension and
endosperm chalkiness characteristics across eight envi-
ronments. Theor Appl Genet 110:1334–1346
Wan XY, Wan JM, Jiang L, Wang JK, Zhai HQ, Weng JF,
Wang HL, Lei CL, Wang JL, Zhang X, Cheng ZJ, Guo
XP (2006) QTL analysis for rice grain length and fine
mapping of an identified QTL with stable and major
effects. Theor Appl Genet 112:1258–1270
Xing YZ, Tan YF, Xu CG, Hua JP, Sun XL (2001) Mapping
quantitative trait loci for grain appearance traits of rice
using a recombinant inbred line population. Acta Bot Sin
43:840–845
B,BustamanteC,
740 Mol Breeding (2010) 26:735–740
123