Vascular endothelial growth factor A, secreted in response to transforming growth factor-β1 under hypoxic conditions, induces autocrine effects on migration of prostate cancer cells.

Abstract

Hypoxia and transforming growth factor-β1 (TGF-β1) increase vascular endothelial growth factor A (VEGFA) expression in a number of malignancies. This effect of hypoxia and TGF-β1 might be responsible for tumor progression and metastasis of advanced prostate cancer. In the present study, TGF-β1 was shown to induce VEGFA(165) secretion from both normal cell lines (HPV7 and RWPE1) and prostate cancer cell lines (DU145 and PC3). Conversely, hypoxia-stimulated VEGFA(165) secretion was observed only in prostate cancer cell lines. Hypoxia induced TGF-β1 expression in PC3 prostate cancer cells, and the TGF-β type I receptor (ALK5) kinase inhibitor partially blocked hypoxia-mediated VEGFA(165) secretion. This effect of hypoxia provides a novel mechanism to increase VEGFA expression in prostate cancer cells. Although autocrine signaling of VEGFA has been implicated in prostate cancer progression and metastasis, the associated mechanism is poorly characterized. VEGFA activity is mediated via VEGF receptor (VEGFR) 1 (Flt-1) and 2 (Flk-1/KDR). Whereas VEGFR-1 mRNA was detected in normal prostate epithelial cells, VEGFR-2 mRNA and VEGFR protein were expressed only in PC3 cells. VEGFA(165) treatment induced phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) in PC3 cells but not in HPV7 cells, suggesting that the autocrine function of VEGFA may be uniquely associated with prostate cancer. Activation of VEGFR-2 by VEGFA(165) was shown to enhance migration of PC3 cells. A similar effect was also observed with endogenous VEGFA induced by TGF-β1 and hypoxia. These findings illustrate that an autocrine loop of VEGFA via VEGFR-2 is critical for the tumorigenic effects of TGF-β1 and hypoxia on metastatic prostate cancers.

Full text

Page 1

ORIGINAL ARTICLE
VascularendothelialgrowthfactorA,secretedinresponse
to transforming growth factor-b1 under hypoxic
conditions, induces autocrine effects on migration of
prostate cancer cells
Eric Darrington*, Miao Zhong*, Bao-Han Vo and Shafiq A Khan
;
Hypoxia and transforming growth factor-b1 (TGF-b1) increase vascular endothelial growth factor A (VEGFA) expression in a number of
malignancies. This effect of hypoxia and TGF-b1 might be responsible for tumor progression and metastasis of advanced prostate
cancer. In the present study, TGF-b1 was shown to induce VEGFA165secretion from both normal cell lines (HPV7 and RWPE1) and
prostatecancercelllines(DU145andPC3).Conversely,hypoxia-stimulatedVEGFA165secretionwasobservedonlyinprostatecancer
cell lines. Hypoxia induced TGF-b1 expression in PC3 prostate cancer cells, and the TGF-b type 1 receptor (ALK5) kinase inhibitor
partially blocked hypoxia-mediated VEGFA165secretion. This effect of hypoxia provides a novel mechanism to increase VEGFA
expression in prostate cancer cells. Although autocrine signaling of VEGFA has been implicated in prostate cancer progression and
metastasis, the associated mechanism is poorly characterized. VEGFA activity is mediated via VEGF receptor (VEGFR) 1 (Flt-1) and 2
(Flk-1/KDR). Whereas VEGFR-1 mRNA was detected in normal prostate epithelial cells, VEGFR-2 mRNA and protein were expressed
onlyinPC3cells.VEGFA165treatmentinducedphosphorylationofextracellularsignal-regulatedkinase1/2(ERK1/2)inPC3cellsbut
not in HPV7 cells, suggesting that the autocrine function of VEGFA may be uniquely associated with prostate cancer. Activation of
VEGFR-2 by VEGFA165was shown to enhance migration of PC3 cells. A similar effect was also observed with endogenous VEGFA
induced by TGF-b1 and hypoxia. These findings illustrate that an autocrine loop of VEGFA via VEGFR-2 is critical for the tumorigenic
effects of TGF-b1 and hypoxia on metastatic prostate cancers.
Asian Journal of Andrology advance online publication, ** ** 2012; doi:10.1038/aja.2011.197
Keywords: cell migration; hypoxia; prostate cancer; TGF-b1; VEGFA
INTRODUCTION
Vascular endothelial growth factor A (VEGFA) belongs to a family of
angiogenic growth factors.1To date, at least four VEGFA isoforms
(VEGFA121,165,189,206)havebeenidentified.1VEGFA165isconsidered
the predominant VEGFA isoform because it mimics the full spectrum
of VEGFA functions.1,2The bioactivities of VEGFA are mediated by
two different types of receptor tyrosine kinases, VEGF receptor 1
(VEGFR-1, Flt-1) and VEGFR-2 (Flk-1/KDR).3,4Neuropilin-1 is
another membrane protein that does not have any intrinsic
kinase activity but binds to VEGFA165with high affinity.2VEGFA
has been shown to be overexpressed in solid tumors of different ori-
gins.1In addition to the paracrine role in endothelial cells to induce
tumor neovascularization, autocrine effects of VEGFA in tumor pro-
gression and metastasis have recently been reported in a number of
malignancies.5
Hypoxia is a general event that occurs concomitant with tumor
growth.1Hypoxia stabilizes the hypoxia-inducible factor-1 (HIF-1)
complex, which causes an increase in VEGFA gene expression.6The
HIF-bindingelementhasbeenidentifiedinthepromoterregionofthe
human VEGFA gene, along with the Smad-binding elements in the
proximal region.7,8Transforming growth factor-b (TGF-b) signaling
plays an important role in tumor angiogenesis.9TGF-b1 signaling has
been shown in concert with HIF-1a to regulate VEGFA expression.7,8
HypoxiaalsoincreasesTGF-b1expressioninosteoblastandhepatoma
cells.10,11Hence, TGF-b1 signaling may constitute a positive feedback
loop to reinforce the effect of hypoxia on VEGFA expression.
A consistent increase in VEGFA expression has been observed in
primary tumor specimens as well as serum samples from prostate
cancer patients.12,13Anti-VEGFA treatment has proven to be effective
anti-cancertherapytopreventprostatecancerprogression.14Whereas
the paracrine role of VEGFA to induce tumor neovascularization has
been extensively characterized, very little is known about its autocrine
effects on prostate cancer growth and metastasis. A functional
VEGFR-1 has been identified in a tumorigenic derivative of rat pro-
state epithelial cell line.15Currently, data on VEGFR-2 expression in
prostate cancer cells are still controversial.16,17
Asian Journal of Andrologyaja2011197.3d12/3/12 15:40:35
*These authors contributed equally to this work.
Correspondence: Dr S A Khan, (skhan@cau.edu)
Received: 8 September 2011; Revised: 18 November 2011; Accepted: 20 December 2011
Center for Cancer Research and Therapeutic Development, Clark Atlanta University, Atlanta, GA 30314, USA
Asian Journal of Andrology (2012), 1–7
? 2012 AJA, SIMM & SJTU. All rights reserved 1008-682X/12 $32.00
www.nature.com/aja

Page 2

In the present study, we examined the effects of TGF-b1 on VEGFA
secretion under normal and hypoxic conditions in normal and
prostate cancer cell lines. We also examined the effect of VEGFA165
on migration and proliferation of PC3 cells. The potential influence
of hypoxia on TGF-b1 expression and the resulting autocrine
effect on VEGFA165secretion were also investigated in PC3 cells.
Our data support that VEGFA is a critical autocrine regulator for
the tumorigenic effects of hypoxia and TGF-b1 in metastatic prostate
cancer cells.
MATERIALS AND METHODS
Reagents
RecombinanthumanVEGFA165wasobtainedfromPeprotech(Rocky
Hill, NJ, USA). Soluble VEGFR-2 was obtained from Prospec (East
Brunswick, NJ, USA). Ki8751 and SB431542 were obtainedfrom Tocris
(Park Elisville, MO, USA). QuantiGlo human VEGF immunoassay
kit, Quantikine human TGF-b1 immunoassay kit, and recombinant
human TGF-b1 were obtained from R&D Systems (Minneapolis,
MN, USA). All primers were purchased from IDT (San Jose, CA,
USA). Dc protein assay kit was obtained from Bio-Rad (Hercules,
CA, USA). Cell culture reagents were obtained from Mediatech Inc.
(Manassas, VA, USA).
Cell culture and cell treatments
Immortalized prostate luminal epithelial cell lines (RWPE1 and
HPV7),andprostatecancercelllines(DU145andPC3)wereobtained
from American Type Culture Collection (ATCC, Rockville, MD,
USA). RWPE1 and HPV7 cell lines were maintained in Keratinocyte
growth medium supplemented with 0.05 mg ml21bovine pituitary
extracts and 5 ng ml21epidermal growth factor (EGF; Invitrogen,
Carlsbad, CA, USA). DU145 and PC3 cell lines were maintained in
Eagle’s minimum essential medium supplemented with 5% fetal
bovine serum.
Cells were seeded at a density of 1.53105/well in six-well culture
plates for 2 days. The next day, cells were treated as described in the
figure legends in culture medium containing 0.2% bovine serum albu-
min(Sigma, StLouis, MO, USA). Hypoxiawas achievedwith a Billups-
Rothlesburg chamber (ACME manufacturing, Inc., Springfield, OR,
USA) filled with premixed 94% N2, 5% CO2and 1% O2.
Enzyme-linked immunoassay (ELISA)
After treatments, conditioned media (CM) and cell lysates from
RWPE1, HPV7, DU145 and PC3 cell lines were harvested.18
Concentrations of VEGFA165protein were measured with an ELISA
kit according to the instruction provided by the manufacturer. Media
incubated without cells and the cell lysis buffer were used as controls.
Protein concentrations in cell lysates were measured as described
previously.18
CM and cell lysates were collected from PC3 cells treated with or
without hypoxia. Levels of TGF-b1 were measured with an ELISA kit
according to the instruction provided by the manufacturer.
Western blot
Total cell membranes from HPV7, DU145 and PC3 cell lines were
prepared as described previously.19Total cell proteins (30 mg) of
human umbilical vein endothelial cells were used as a positive control
for VEGFR-2. The membrane proteins (60 mg) were separated
on 7% sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS–PAGE) gels and transferred onto polyvinylidene fluoride
membranes. VEGFR-2 was detected with anti-VEGFR-2 antibody
(1:1000;CellSignaling,Danvers,MA,USA).Anti-a-tubulinantibody
(1:1000; Sigma) was used to detect a-tubulin as a sample loading
control. To examine phosphorylation of extracellular signal-regulated
kinase1/2(ERK1/2),totalcellproteins(30mg)wereseparatedon10%
SDS–PAGE gels. Anti-phospho-ERK1/2 antibody (1:2000; Cell
Signaling) and anti-ERK1/2 antibody (1:5000; Promega, Madison,
WI, USA) were used. Anti-phospho-Smad3 antibody (1:1000; Cell
Signaling) and anti-Smad2/3 antibody (1:1000; Cell Signaling) were
usedtodetectTGF-bsignalinginPC3samplestreatedwithorwithout
hypoxia. The signal was detected by ECL (Thermo Scientific,
Rockford, IL, USA).
RNA extraction, cDNA synthesis, PCR and quantitative real-time
PCR
The primers for TGF-b1, VEGFA, VEGFR-1, VERFR-2 and L19 were
designed as described previously18and listed in Table 1. Total RNAs
from RWPE1,HPV7,DU145andPC3celllines werereversetranscribed
as described previously.18PCR was performed as previously described.18
Real-time PCR was performed in the Bio-Rad icycler thermal
cycler.18Calculations were performed using the DDCtmethod.18
Cell migration assay
Conditioned media and diluted VEGFA165were used to examine the
effects of endogenous and exogenous VEGFA on in vitro migration of
PC3cells.The assay was performed using24-well transwellinserts(8mm;
BD Biosciences
) as described previously.18Data were expressed as migra-
tion index defined as: the average number of cells per field for test
substance/the average number of cells per field for the medium control.
<
Asian Journal of Andrologyaja2011197.3d12/3/12 15:40:36
Table 1 Primers for RT-PCR and quantitative PCR of the indicated genes
Genes Gene IDPrimersSequences (59–39)LocationProduct size (bp)
TGF-b1260655621 TGFb1F
TGFb1R
VEGFA-F
VEGFA-R
VEGFR1F
VEGFR1R
VEGFR2F
VEGFR2R
L19-F
L19-R
TCGATTTTGACGTCACTGGAGTTGT
GGGGTGGCCATGAGGAGCAGG
CAAGACAAGAAAATCCCTGTGG
GCTTGTCACATCTGCAAGTACG
CCTTGAACACAGCTCAAGCA
CCCAGATTATGCGTTTTCCA
GCTTTGGCCCAATAATCAGA
ACACGACTCCATGTTGGTCA
GAAATCGCCAATGCCAACTC
TCTTAGACCTGCGAGCCTCA
1473-93
1673-53
1448-69
1603-1582
563-582
844-825
486-505
712-693
306-325
711-692
201
VEGFA284172452156
VEGFR-1229892268 282
VEGFR-22655411227
L19 68216257 406
Abbreviations:RT-PCR,reversetranscriptionPCR;TGF-b1,transforminggrowthfactor-b1;VEGFA,vascularendothelialgrowthfactorA;VEGFR,vascularendothelialgrowth
factor receptor.
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
2
Asian Journal of Andrology

Page 3

Statistical analysis
Data from multiple independent experiments are expressed as
mean6SEM. Paired t-test and ANOVA and Duncan’s modified mul-
tiple range test were used to examine significance between different
treatments. P,0.05 was considered statistically significant.
RESULTS
VEGFA165is differentially regulated by TGF-b1 and hypoxia in
normal and prostate cancer cells
Quantitative real-time PCR was used to determine basal levels of
VEGFA mRNA in normal prostate epithelial cell lines (RWPE1 and
HPV7),aswellasinDU145andPC3prostatecancercelllines.VEGFA
mRNA levels were comparable between the normal prostate epithelial
cell lines (data not shown). However, VEGFA mRNA levels were two-
fold higher in PC3 and 25-fold higher in DU145 cell lines, when
compared to RWPE1 cells (data not shown).
VEGFA165is the predominant active VEGFA isoform. Conditioned
media and cell lysates were harvested from the four cell lines; the
concentrations of VEGFA165were quantified with ELISA. The levels
ofVEGFA165were6.13,4.81,7.33and2.43pgmg21proteininthecell
lysates from RWPE1, HPV7, DU145 and PC3 cells, respectively
(Figure 1a). The conditioned media contained the majority of
VEGFA165protein. As shown in Figure 1b, DU145 secreted at least
10 times higher levels of VEGFA165than RWPE1 and HPV7 cells
(4493, 153 and 412 pg mg21protein for DU145, RWPE1 and HPV7
cells, respectively). PC3 cells secreted the least amount of VEGFA165
(19 pg mg21protein).
The four cell lines were treated with 10 ng ml21of TGF-b1 under
normal and hypoxic conditions. As shown in Figure 1c, TGF-b1 sti-
mulated VEGFA165secretion in both RWPE1 (threefold over control)
and HPV7 (2.4-fold over control) cell lines; no additive effect of TGF-
b1 was observed under hypoxia in either cell line. However, TGF-b1
induced less than twofold increases in VEGFA165secretion in DU145
andPC3celllines,whichwereenhancedtomorethanthreefoldunder
hypoxic conditions.
TGF-b1 is an autocrine regulator of hypoxia-mediated VEGFA165
secretion in prostate cancer cells.
TGF-b1 mRNA and protein levels were increased in PC3 cells after
exposure to hypoxia (Figure 2a and b). Hypoxia induced the phos-
phorylation of Smad3 in PC3 cells (Figure 2c), consistent with the
involvementofTGF-b1signalingintheeffectsofhypoxia.TGF-b1has
been shown to induce VEGFA secretion via a Smad3-dependent
mechanism.20Pretreatment with SB431542, a TGF-b receptor I
(TGFbR-I, ALK5) inhibitor,21reduced basal VEGFA165secretion in
PC3cells(Figure2d).TGF-b1(1ngml21)induceda1.4-foldincrease
in VEGFA165secretion, which was completely blocked by SB431542
(Figure 2d). Hypoxia induced a more than twofold increase in
VEGFA165 secretion, which was partially blocked by SB431542
(Figure 2d). Hypoxia plus TGF-b1 treatment induced a fourfold
increase in VEGFA165secretion; however, the combined effect of hyp-
oxia and TGF-b1 was reduced by SB431542 to a level that is similar to
the treatment of hypoxia plus SB431542 (Figure 2d).
VEGFR-2 is involved in VEGFA functions in PC3 cells
VEGFR-1andVEGFR-2mRNAweredeterminedbyreversetranscrip-
tion(RT)
-PCRinRWPE1,HPV7,DU145andPC3celllines.Asshown
inFigure3a,VEGFR-1mRNAwasdetectedinthenormalprostatecell
lines. VEGFR-2 was expressed only in the prostate cancer cell lines.
TotalcellmembraneswerepreparedfromHPV7,DU145andPC3cell
=
Asian Journal of Andrologyaja2011197.3d 12/3/12 15:40:37
Figure 1 Differential regulation ofVEGFA165secretion by TGF-b1and hypoxia in
human prostate cell lines. Normal cell line (RWPE1 and HPV7) and prostate
cancer cell lines (DU145 and PC3) were treated with or without TGF-b1 (10 ng
ml21)in normoxic andhypoxic conditionsfor7h.Concentrationsof VEGFA165in
cell lysates and CM were quantified by ELISA. Basal levels of (a) cell associated
and (b) secreted VEGF165in RWPE1, HPV7, DU145 and PC3 cell lines, and (c)
fold changes over basal levels of secreted VEGFA165for TGF-b1- and hypoxia-
induced VEGFA165secretion in the four cell lines. Data are expressed as
mean6SEM (n53),and were analyzed by ANOVA and Duncan’s modified range
tests. Significant differences between groups in a given category (P,0.05) are
designated with different lowercase letters. P,0.05 for t-test. CM, conditioned
media; ELISA, enzyme-linked immunoassay; TGF-b1, transforming growth fac-
tor-b1; VEGFA, vascular endothelial growth factor A.
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
3
Asian Journal of Andrology

Page 4

lines, and were analyzed for VEGFR-2 expression by western blot.
Total cell lysate from human umbilical vein endothelial cells was used
as a positive control. Western blot for a-tubulin were performed for
sample-loadingcontrol.AsshowninFigure3b,VEGFR-2proteinwas
not detectable in HPV7 cells, consistent with the absence of VEGFR-2
mRNA in this cell line. Although VEGFR-2 mRNA was expressed in
bothDU145andPC3celllines,VEGFR-2proteinwasdetectedonlyin
PC3 cells (Figure 3b). TGF-b1 (1 ng ml21) induced ERK1/2 phos-
phorylation in both HPV7 and PC3 cell lines. VEGFA165induced
ERK1/2 phosphorylation only in PC3 cells (Figure 3c). Activated
VEGFR-1 has been shown to induce ERK1/2 phosphorylation in epi-
dermal tumors.5Hence, VEGFA signaling is absent in HPV7 cells,
despite the fact that VEGFR-1 mRNA is expressed in this cell line.
Effects of exogenous VEGFA165on cell proliferation and migration
were assessed. As shown in Figure 4a, VEGFA165induced a 1.8-fold
increaseincellmigrationatadoseof0.2ngml21whencomparedwith
thecontrolgroup.ThemaximalresponsewasobservedwhenPC3cells
weretreatedwith1ngml21VEGFA165.TheeffectofVEGFA165oncell
migration was completely blocked by pretreatment with 10 nmol l21
Ki8751, a specific VEGFR-2 tyrosine kinase inhibitor (Figure 4b).
VEGFA165had no effect on the proliferation of PC3 cells, as deter-
mined by3H-thymidine incorporation and MTT assays (data not
shown).
Toinvestigate whetherTGF-b1andhypoxiainduceprostatecancer
cell migration via endogenous VEGFA, CM were collected from
PC3 cells treated with TGF-b1 (1 ng ml21), hypoxia, or hypoxia plus
Asian Journal of Andrology aja2011197.3d12/3/12 15:40:44
Figure2 AutocrineactionofTGF-b1onhypoxia-inducedVEGFA165secretioninPC3cells.PC3cellswereexposedtohypoxiafordifferenttimes.TGF-b1mRNAlevels
were detected by RT-PCR. L19 gene expression was used as a control. (a) Density of TGF-b1 and L19 bands were quantified with ImageQuantTL software (GE
Healthcare
).Foldchangesoverthecontrolgroupwerecalculated.Similarresults werereplicatedinthreeindependentexperiments.(b)PC3cellsweretreatedwithor
without hypoxia for 6 h. Concentrations of TGF-b1 were quantitated with an immunoassay kit in samples of cell lysates, and were normalized with total protein
concentrations (P,0.001). (c) After hypoxic treatments, PC3 cells were collected in cell lysis buffer. Samples (35 mg protein per lane) were separated on 10% SDS–
PAGE and then transferred on PVDF membrane. Phosphorylation of Smad3 was analyzed with anti-phospho-Smad3 antibody. Total Smad2/3 was used as a loading
control. Band density was quantified and fold changes over 1-h hypoxia were calculated. (d) PC3 cells were pretreated with ALK4/5 inhibitor SB431542 for 30 min,
followed by treatments with TGF-b1 and hypoxia for 7 h. VEGFA165in CM were determined by ELISA. Data were calculated as fold changes over the basal level of
secreted VEGFA165. Data are expressed as mean6SEM (b: n56; d: n53). ANOVA and Duncan’s modified range tests were used. Significant differences between
groups in a given category (P,0.05) are designated with different lowercase letters. CM, conditioned media; ELISA, enzyme-linked immunoassay; PVDF, polyviny-
lidene fluoride; RT-PCR, reverse transcription PCR; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; TGF-b1, transforming growth factor-b1;
VEGFA, vascular endothelial growth factor A.
>
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
4
Asian Journal of Andrology

Page 5

TGF-b1 for 7 h. Soluble VEGFR-2 (17 ng ml21) and Ki8751were used
toblockVEGFAsignaling.22,23WhereasTGF-b1-andhypoxia-treated
conditioned media were shown to induce 1.5-fold increases in migra-
tion of PC3 cells, the conditioned media from the cells treated with
hypoxia plus TGF-b1 increased migration of PC3 cells by twofold
(Figure 4c). These effects of conditioned media were blocked by sol-
uble VEGFR-2 and Ki8751.
DISCUSSION
Hypoxia, TGF-b1 and VEGF are important factors of the tumor
microenvironment that regulate cancer progression and metastasis.
Hypoxia occurs concomitant with tumor growth.1It is interesting
to note that a hypoxic phenotype has been observed in the tumor
specimens from prostate cancer patients with poor prognosis.24
TGF-b1 is a growth factor that is overexpressed in prostate cancer.25
The general function of TGF-b1 is to inhibit cell proliferation and to
induce apoptosis. However, when the malignant tissue progresses to
the advanced stages it acquires the ability to escape the tumor-sup-
pressing activities of TGF-b1, and to convert TGF-b1 into a tumori-
genic growth factor.26VEGF family members, including VEGFA and
VEGFC, have been shown to play important roles in prostate cancer
progression.14,27VEGFC binds to VEGFR-3 (Flt-4) on lymphatic
endothelial cells, and the VEGFC/VEGFR-3 signaling is specific for
lymphoangiogenesis.28
TGF-b1 inhibits lymphagiogenesis.29
addition, hypoxia does not regulate VEGFC mRNA expression.30
Therefore, the VEGFC/VEGFR-3-dependent pathway is unlikely
associated with the tumorigenic effects of hypoxia and TGF-b1. On
the other hand, hypoxia and TGF-b1 regulate VEGFA gene express-
ion,7,8which may account for the tumorigenic potential of both
stimuli.
There is limited information about the effect of hypoxia and TGF-
b1 on VEGFA secretion in advanced prostate cancer. DU145 and PC3
prostate cancer cell lines are representative cell models of castration
resistant prostate cancer. RWPE1 and HPV7 are immortalized pro-
state luminal epithelial cell lines. VEGFA165protein was detectable in
both conditioned media and cell lysates from all cell lines examined.
The majority of VEGFA165was in the secreted form. TGF-b1 induced
VEGFA165secretion in both normal and prostate cancer cell lines;
however,theeffectofhypoxiawasonlyobservedintheprostatecancer
cell lines. These data support that VEGFA contributes to the effect of
hypoxiaandTGF-b1inprostatecancercells.Intheprostatecancercell
lines, TGF-b1 and hypoxia exerted an additive effect on VEGFA165
secretion, which is presumably mediated by different intracellular
mechanisms.7Because hypoxia increases TGF-b1 expression in osteo-
blastandhepatomacells,10,11itisalsoconceivablethatTGF-b1signal-
ing might constitute a positive feedback loop to reinforce the effect of
hypoxia on VEGFA165secretion in prostate cancer. In addition, an
autocrine effect of TGF-b1 has been reported to increase VEGFA
secretion in DU145 and PC3 cell lines during the preparation of this
manuscript.20Inthepresentstudy,hypoxiaincreasedlevelsofTGF-b1
mRNA and protein in PC3 cells. The involvement of TGF-b signaling
in the effects of hypoxia was supported by the induction of Smad3
phosphorylation in PC3 cells. Furthermore, the ALK4/5 inhibitor
(SB431542) partially inhibited the effect of hypoxia on VEGFA165
secretion in PC3 cells. Therefore, an autocrine TGF-b1 signaling
mechanism appears to be involved in hypoxia-mediated VEGFA165
secretion.
Although PC3 cells are a model for a more metastatic prostate
cancer.18,31DU145 was shown to secrete 10 times more VEGFA165
than normal prostate epithelial cells, and PC3 cells produced the least
amount of VEGFA165. In line with our observation, VEGFA165has
previously been shown to be three times higher in DU145 than
PC3M (a derivative of PC3) cells.31Nevertheless, the PC3M-derived
tumorbearsmoreaggressivephenotypeandhigherangiogenesiscapa-
city than the one originated from DU145 cells in mouse xenografts.31
In
Asian Journal of Andrologyaja2011197.3d12/3/12 15:40:55
Figure3 ExpressionprofilesofVEGFRsinprostatecelllines.(a)LevelsofmRNA
inHPV7,RWPE1,PC3andDU145celllinesweredeterminedbyRT-PCR.Similar
results were replicated in three independent experiments. (b)Membraneprotein
fractions(,60mg)ofHPV7,DU145andPC3cellsandtotalcellproteins(,30mg)
of HUVECs were used for western blot to detect expression of VEGFR-2 protein
with anti-VEGFR2 antibody. Similar results were observed with two independent
membrane preparations. (c) PC3 and HPV7 cell lines were treated with TGF-b1
for7horVEGFA165for10min.PhosphorylatedandtotalERK1/2weredetectedin
samples(30ml)withanti-phospho-ERK1/2(1:2000)andanti-ERK1/2(1:5000)
antibodies, respectively. Band density was quantified, and fold changes over
control groups were calculated. Similar results were replicated in two independ-
ent experiments. ERK1/2, extracellular signal-regulated kinase 1/2; HUVEC,
human umbilical vein endothelial cell; RT-PCR, reverse transcription PCR;
TGF-b1, transforming growth factor-b1; VEGFA, vascular endothelial growth fac-
tor A; VEGFR, vascular endothelial growth factor receptor.
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
5
Asian Journal of Andrology

Page 6

Although VEGFA expression correlates with high Gleason grade pro-
state cancer specimens,32increased expression of VEGFA alone is not
sufficient to promote prostate cancer progression. Autocrine VEGFA
signaling involving neuropilin-1 has been implicated in the process of
epithelial to mesenchymal transition in PC3 cells.32Neuropilin-1 has
been shown to facilitate VEGFA signaling through interaction with
VEGFR-2.2In the current study, VEGFR-2 protein was detected in
PC3butnot in DU145celllines.These datasupport acomplementary
role of VEGFR-2 to promote prostate cancer progression.
ERK1/2 phosphorylation is a common phenomenon following
activation of receptor tyrosine kinases.33Treatment with VEGFA165
induced ERK1/2 phosphorylation in PC3 cells but not in HPV7 cells.
These data supports an acquisition of autocrine VEGFA signaling
involving VEGFR-2 in PC3 prostate cancer cells. VEGFA induces cell
proliferation in epidermal tumors, which has been shown to be
mediatedby VEGFR-1.5In thepresentstudy,VEGFA165didnotaffect
the proliferation of PC3 cells. On the other hand, VEGFA165was
shown to induce the migration of PC3 cells. This effect of VEGFA165
was completely blocked by pretreatment with the VEGFR-2 kinase
inhibitor (Ki8751). In addition, conditioned media collected from
hypoxia- and TGF-b1-treated cells were shown to induce migration
of PC3 cells, and these effects were completely blocked by soluble
VEGFR-2andKi8751.Hence,VEGFA/VEGFR-2-dependentsignaling
may contribute to the tumorigenic effect of hypoxia and TGF-b1 to
promote the metastasis of prostate cancer cells. A similar VEGFA/
VEGFR-2 autocrine loop has previously been implicated in migration
of LNCaP cells and its metastatic derivative C4-2 cell line.16
In summary, hypoxia and TGF-b1 increase VEGFA secretion in
prostate cell lines. Hypoxia also increases TGF-b1 expression in PC3
prostate cancer cells, which constitutes an autocrine mechanism to
enhance the effects of hypoxia on VEGFA expression. This crosstalk
Asian Journal of Andrologyaja2011197.3d12/3/12 15:41:02
Figure 4 VEGFA induces PC3 cell migration via VEGFR-2 activation. PC3 cells
(33105per transwell insert) were (a) treated with different concentrations of
recombinantVEGFA165for5hor(b)pretreatedwiththeVEGFR-2kinaseinhibitor
Ki8751 for 30 min before treatment with VEGF165. (c) CM from TGF-b1, hypoxia,
or hypoxia plus TGF-b1-treated PC3 cells were used to induce migration of PC3
cells intheabsence/presenceofsolubleVEGFR-2orKi8751.Dataarepresented
as mean6SEM (a and b: n54; c: n53), and were analyzed by ANOVA and
Duncan’s modified range test. Significant differences between groups in a given
category (P,0.05) are designated with different lowercase letters. CM, condi-
tionedmedia;TGF-b1,transforminggrowthfactor-b1;VEGFA,vascularendothe-
lial growth factor A; VEGFR, vascular endothelial growth factor receptor.
Figure 5 A diagram illustratinghow hypoxia and TGF-b1 become tumorigenic in
advanced prostate cancer cells to increase tumor metastasis. PC3 prostate can-
cer cell line expresses VEGFR-2 protein that enables an autocrine VEGFA signal-
ing in PC3 cells. The autocrine VEGFA/VEGFR-2 mechanism is important for cell
migration in response to different stimuli, such as hypoxia and TGF-b1. In addi-
tion to directly induce VEGFA expression, hypoxia triggers an autocrine TGF-b1
signaling to increase VEGFA expression in prostate cancer cells. TGF-b1, trans-
forming growth factor-b1; VEGFA, vascular endothelial growth factor A; VEGFR,
vascular endothelial growth factor receptor.
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
6
Asian Journal of Andrology

Page 7

between TGF-b1 and hypoxia is novel and distinct from the estab-
lished intracellular crosstalk to regulate VEGFA gene expression.7The
presentstudyalsosuggeststhatVEGFA/VEGFR-2autocrinelooppar-
tially accounts for the tumorigenic effects of TGF-b1 and hypoxia in
prostate cancer progression.
AUTHOR CONTRIBUTIONS
BHV analyzed different treatments on Smad-3 phosphorylation
(Figure 2c), and detected a-tubulin (Figure 3b). She also made the
cartoon of Figure 5. ED and MZ performed the rest of experiments.
MZ performed data statistical analysis. MZ and SK wrote the manu-
script. SK provided laboratory resources.
COMPETING FINANCIAL INTERESTS
Therearenoprofessionalaffiliationsthatwouldbiasthispresentation.
ACKNOWLEDGMENTS
This work is supported by NIH (RCMI 5G12RR003062 and NIMHD
1P20MD002285) and Georgia Research Alliance.
1Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med
2003; 9: 669–76.
Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Neuropilin-1 is expressed
by endothelialandtumorcellsasanisoform-specificreceptorforvascularendothelial
growth factor. Cell 1998; 92: 735–45.
de Vries C, Escobedo JA, Ueno H, Houck K, Ferrara N et al. The fms-like tyrosine
kinase, a receptor for vascular endothelial growth factor. Science 1992; 255: 989–
91.
Terman BI, Dougher-Vermazen M, Carrion ME, Dimitrov D, Armellino DC et al.
Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell
growth factor. Biochem Biophys Res Commun 1992; 187: 1579–86.
LichtenbergerBM,TanPK,NiederleithnerH,FerraraN,PetzelbauerPetal.Autocrine
VEGF signaling synergizes with EGFR in tumor cells to promote epithelial cancer
development. Cell 2010; 140: 268–79.
Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL et al. Hypoxia-inducible
factor-1 modulates gene expression in solid tumors and influences both angiogenesis
and tumor growth. Proc Natl Acad Sci U S A 1997; 94: 8104–9.
Dunn LK, Mohammad KS, Fournier PG, McKenna CR, Davis HW et al. Hypoxia and
TGF-beta drive breast cancer bone metastases through parallel signaling pathways in
tumor cells and the bone microenvironment. PLoS One 2009; 4: e6896.
Sanchez-Elsner T, Botella LM, Velasco B, Corbi A, Attisano L et al. Synergistic
cooperation between hypoxia and transforming growth factor-beta pathways on
human vascular endothelial growth factor gene expression. J Biol Chem 2001; 276:
38527–35.
Cunha SI, Pardali E, Thorikay M, Anderberg C, Hawinkels L et al. Genetic and
pharmacological targeting of activin receptor-like kinase 1 impairs tumor growth
and angiogenesis. J Exp Med 2010; 207: 85–100.
Patel B, Khaliq A, Jarvis-Evans J, McLeod D, Mackness M et al. Oxygen regulation of
TGF-beta 1 mRNA in human hepatoma (Hep G2) cells. Biochem Mol Biol Int 1994;
34: 639–44.
Warren SM, Steinbrech DS, Mehrara BJ, Saadeh PB, Greenwald JA et al. Hypoxia
regulates osteoblast gene expression. J Surg Res 2001; 99: 147–55.
Duque JL, Loughlin KR, Adam RM, Kantoff PW, Zurakowski D et al. Plasma levels of
vascular endothelial growth factor are increased in patients with metastatic prostate
cancer. Urology 1999; 54: 523–7.
Pallares J, Rojo F, Iriarte J, Morote J, Armadans LI et al. Study of microvessel density
and the expression of the angiogenic factors VEGF, bFGF and the receptors Flt-1 and
2
3
4
5
6
7
8
9
10
11
12
13
FLK-1 in benign, premalignant and malignant prostate tissues. Histol Histopathol
2006; 21: 857–65.
Sweeney P, Karashima T, Kim SJ, Kedar D, Mian B et al. Anti-vascular endothelial
growthfactorreceptor2antibodyreducestumorigenicityandmetastasisinorthotopic
prostatecancerxenograftsviainductionofendothelialcellapoptosisandreductionof
endothelialcellmatrixmetalloproteinasetype9production.ClinCancerRes2002;8:
2714–24.
SokerS,KaeferM,JohnsonM,KlagsbrunM,AtalaAetal.Vascularendothelialgrowth
factor-mediated autocrine stimulation of prostate tumor cells coincides with
progression to a malignant phenotype. Am J Pathol 2001; 159: 651–9.
DeS,ChenJ,NarizhnevaNV,HestonW,BrainardJetal.Molecularpathwayforcancer
metastasis to bone. J Biol Chem 2003; 278: 39044–50.
Zhang S, Zhau HE, Osunkoya AO, Iqbal S, Yang X et al. Vascular endothelial growth
factor regulates myeloid cell leukemia-1 expression through neuropilin-1-dependent
activation of c-MET signaling in humanprostate cancer cells.Mol Cancer2010; 9: 9.
Zhong M, Boseman ML, Millena AC, Khan SA. Oxytocin induces the migration of
prostate cancer cells: involvement of the Gi-coupled signaling pathway. Mol Cancer
Res 2010; 8: 1164–72.
Zhong M, Navratil AM, Clay C, Sanborn BM. Residues in the hydrophilic face of
putative helix 8 of oxytocin receptor are important for receptor function.
Biochemistry 2004; 43: 3490–8.
Chae KS, Kang MJ, Lee JH, Ryu BK, Lee MG et al. Opposite functions of HIF-alpha
isoforms in VEGF induction by TGF-beta1 under non-hypoxic conditions. Oncogene
2011; 30: 1213–28.
Laping NJ, Grygielko E, Mathur A, Butter S, Bomberger J et al. Inhibition of
transforming growth factor (TGF)-beta1-induced extracellular matrix with a novel
inhibitor of the TGF-beta type I receptor kinase activity: SB-431542. Mol
Pharmacol 2002; 62: 58–64.
Aiello LP, Pierce EA, Foley ED, Takagi H, Chen H et al. Suppression of retinal
neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF)
using soluble VEGF-receptor chimeric proteins. Proc Natl Acad Sci U S A 1995; 92:
10457–61.
Kubo K, Shimizu T, Ohyama S, Murooka H, Iwai A et al. Novel potent orally active
selective VEGFR-2tyrosine kinaseinhibitors:
relationships,andantitumor
quinolyloxy)phenyl}ureas. J Med Chem 2005; 48: 1359–66.
Nanni S, Benvenuti V, Grasselli A, Priolo C, Aiello A et al. Endothelial NOS, estrogen
receptor beta, and HIFs cooperate in the activation of a prognostic transcriptional
pattern in aggressive human prostate cancer. J Clin Invest 2009; 119: 1093–108.
Eastham JA, Truong LD, Rogers E, Kattan M, Flanders KC et al. Transforming growth
factor-beta 1: comparative immunohistochemical localization in human primary and
metastatic prostate cancer. Lab Invest 1995; 73: 628–35.
Pardali K, Moustakas A. Actions of TGF-beta as tumor suppressor and pro-metastatic
factor in human cancer. Biochim Biophys Acta 2007; 1775: 21–62.
Tuomela J, Valta M, Seppanen J, Tarkkonen K, Vaananen HK et al. Overexpression of
vascularendothelialgrowthfactorCincreasesgrowthandaltersthemetastaticpattern
of orthotopic PC-3 prostate tumors. BMC Cancer 2009; 9: 362.
Wong SY, Haack H, Crowley D, Barry M, Bronson RT et al. Tumor-secreted vascular
endothelial growth factor-C is necessary for prostate cancer lymphangiogenesis, but
lymphangiogenesis is unnecessary for lymph node metastasis. Cancer Res 2005; 65:
9789–98.
Clavin NW, Avraham T, Fernandez J, Daluvoy SV, Soares MA et al. TGF-beta1 is a
negative regulator of lymphatic regeneration during wound repair. Am J Physiol Heart
Circ Physiol 2008; 295: H2113–27.
Enholm B, Paavonen K, Ristimaki A, Kumar V, Gunji Y et al. Comparison of VEGF,
VEGF-B, VEGF-C and Ang-1 mRNA regulation by serum, growth factors, oncoproteins
and hypoxia. Oncogene 1997; 14: 2475–83.
Connolly JM, Rose DP. Angiogenesis in two human prostate cancer cell lines with
differing metastatic potential when growing as solid tumors in nude mice. J Urol
1998; 160: 932–6.
MakP,Leav I,PursellB, BaeD,YangXet al. ERbetaimpedesprostatecancerEMTby
destabilizing HIF-1alpha and inhibiting VEGF-mediated snail nuclear localization:
implications for Gleason grading. Cancer Cell 2010; 17: 319–32.
HurlbutGD,KankelMW,Artavanis-TsakonasS.NodalpointsandcomplexityofNotch-
Ras signal integration. Proc Natl Acad Sci U S A 2009; 106: 2218–23.
14
15
16
17
18
19
20
21
22
23
synthesis,
of
structure-activity
N-phenyl-N’-{4-(4- activities
24
25
26
27
28
29
30
31
32
33
Asian Journal of Andrologyaja2011197.3d12/3/12 15:41:17
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
7
Asian Journal of Andrology

Page 8

Author Queries
Journal: Asian Journal of Andrology
Paper: aja2011197
Title: Vascular endothelial growth factor A, secreted in response to transforming growth factor-b1 under hypoxic
conditions, induces autocrine effects on migration of prostate cancer cells
Query
Reference
Query
1 Please confirm the spelling of the authors’ names.
2 Please provide the location of BD Biosciences.
3Please confirm the full form of ‘RT’.
4 Please provide the location of GE Healthcare.
For AJA office use only:
Layout
DOI
Title
Authors
Addresses
First para
Display items
%
%
%
%
%
%
%
Figures/Tables/Boxes
Error bars
Colour
Text
Methods (if applicable)
Received/Accepted
AOP (if applicable)
%
%
%
%
%
%
%
References
Supp info (if applicable)
Acknowledgements
Author contribs (if applicable)
COI
Correspondence
Author corrx
%
%
%
%
%
%
%
Asian Journal of Andrologyaja2011197.3d 12/3/12 15:41:17
Autocrine effect of VEGFA on prostate cancer metastasis
E Darrington et al
8
Asian Journal of Andrology