The heat shock protein-90 co-chaperone, Cyclophilin 40, promotes ALK-positive, anaplastic large cell lymphoma viability and its expression is regulated by the NPM-ALK oncoprotein.

Abstract

Anaplastic lymphoma kinase-positive, anaplastic large cell lymphoma (ALK+ ALCL) is a T cell lymphoma defined by the presence of chromosomal translocations involving the ALK tyrosine kinase gene. These translocations generate fusion proteins (e.g. NPM-ALK) with constitutive tyrosine kinase activity, which activate numerous signalling pathways important for ALK+ ALCL pathogenesis. The molecular chaperone heat shock protein-90 (Hsp90) plays a critical role in allowing NPM-ALK and other signalling proteins to function in this lymphoma. Co-chaperone proteins are important for helping Hsp90 fold proteins and for directing Hsp90 to specific clients; however the importance of co-chaperone proteins in ALK+ ALCL has not been investigated. Our preliminary findings suggested that expression of the immunophilin co-chaperone, Cyclophilin 40 (Cyp40), is up-regulated in ALK+ ALCL by JunB, a transcription factor activated by NPM-ALK signalling. In this study we examined the regulation of the immunophilin family of co-chaperones by NPM-ALK and JunB, and investigated whether the immunophilin co-chaperones promote the viability of ALK+ ALCL cell lines.
NPM-ALK and JunB were knocked-down in ALK+ ALCL cell lines with siRNA, and the effect on the expression of the three immunophilin co-chaperones: Cyp40, FK506-binding protein (FKBP) 51, and FKBP52 examined. Furthermore, the effect of knock-down of the immunophilin co-chaperones, either individually or in combination, on the viability of ALK+ ALCL cell lines and NPM-ALK levels and activity was also examined.
We found that NPM-ALK promoted the transcription of Cyp40 and FKBP52, but only Cyp40 transcription was promoted by JunB. We also observed reduced viability of ALK+ ALCL cell lines treated with Cyp40 siRNA, but not with siRNAs directed against FKBP52 or FKBP51. Finally, we demonstrate that the decrease in the viability of ALK+ ALCL cell lines treated with Cyp40 siRNA does not appear to be due to a decrease in NPM-ALK levels or the ability of this oncoprotein to signal.
This is the first study demonstrating that the expression of immunophilin family co-chaperones is promoted by an oncogenic tyrosine kinase. Moreover, this is the first report establishing an important role for Cyp40 in lymphoma.

Full text

Page 1

RESEARCH ARTICLEOpen Access
The heat shock protein-90 co-chaperone,
Cyclophilin 40, promotes ALK-positive, anaplastic
large cell lymphoma viability and its expression is
regulated by the NPM-ALK oncoprotein
Joel D Pearson1, Zubair Mohammed1, Julinor T C Bacani2, Raymond Lai2and Robert J Ingham1*
Abstract
Background: Anaplastic lymphoma kinase-positive, anaplastic large cell lymphoma (ALK+ ALCL) is a T cell
lymphoma defined by the presence of chromosomal translocations involving the ALK tyrosine kinase gene. These
translocations generate fusion proteins (e.g. NPM-ALK) with constitutive tyrosine kinase activity, which activate
numerous signalling pathways important for ALK+ ALCL pathogenesis. The molecular chaperone heat shock
protein-90 (Hsp90) plays a critical role in allowing NPM-ALK and other signalling proteins to function in this
lymphoma. Co-chaperone proteins are important for helping Hsp90 fold proteins and for directing Hsp90 to
specific clients; however the importance of co-chaperone proteins in ALK+ ALCL has not been investigated. Our
preliminary findings suggested that expression of the immunophilin co-chaperone, Cyclophilin 40 (Cyp40), is
up-regulated in ALK+ ALCL by JunB, a transcription factor activated by NPM-ALK signalling. In this study we
examined the regulation of the immunophilin family of co-chaperones by NPM-ALK and JunB, and investigated
whether the immunophilin co-chaperones promote the viability of ALK+ ALCL cell lines.
Methods: NPM-ALK and JunB were knocked-down in ALK+ ALCL cell lines with siRNA, and the effect on the
expression of the three immunophilin co-chaperones: Cyp40, FK506-binding protein (FKBP) 51, and FKBP52
examined. Furthermore, the effect of knock-down of the immunophilin co-chaperones, either individually or in
combination, on the viability of ALK+ ALCL cell lines and NPM-ALK levels and activity was also examined.
Results: We found that NPM-ALK promoted the transcription of Cyp40 and FKBP52, but only Cyp40 transcription was
promoted by JunB. We also observed reduced viability of ALK+ ALCL cell lines treated with Cyp40 siRNA, but not with
siRNAs directed against FKBP52 or FKBP51. Finally, we demonstrate that the decrease in the viability of ALK+ ALCL cell
lines treated with Cyp40 siRNA does not appear to be due to a decrease in NPM-ALK levels or the ability of this
oncoprotein to signal.
Conclusions: This is the first study demonstrating that the expression of immunophilin family co-chaperones is
promoted by an oncogenic tyrosine kinase. Moreover, this is the first report establishing an important role for Cyp40 in
lymphoma.
* Correspondence: ringham@ualberta.ca
1Department of Medical Microbiology and Immunology, University of
Alberta, Edmonton T6G 2E1, Canada
Full list of author information is available at the end of the article
© 2012 Pearson et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Pearson et al. BMC Cancer 2012, 12:229
http://www.biomedcentral.com/1471-2407/12/229

Page 2

Background
Anaplastic lymphoma kinase-positive, anaplastic large cell
lymphoma (ALK+ ALCL) is an aggressive non-Hodgkin
lymphoma of T/null cell immunophenotype [1-3]. This
lymphoma primarily presents in children, adolescents, and
young adults where it accounts for 10–20% of childhood
non-Hodgkin lymphomas [1]. ALK+ ALCL is characterized
by the presence of chromosomal translocations involving
the ALK gene, which encodes for a receptor tyrosine
kinase belonging to the insulin receptor super-family.
These translocations result in the expression of ALK
fusion proteins that are critical for the pathogenesis
of ALK+ ALCL [2,3]. Moreover, ALK fusion proteins
have been implicated in the pathogenesis of a subset
of non-small cell lung carcinomas (ALK+ NSCLC)
[4-7] andinflammatory
(ALK+ IMT) [8-10]. In ALK+ ALCL several different
ALK translocations have been described [2,3]; how-
ever, the most common (~80%) is the t(2;5)(p23;q35)
translocation involving the
gene which generates the NPM-ALK oncogene [1-3].
NPM-ALK consists of the N-terminal region of NPM
and the C-terminal kinase and intracellular domains of
ALK [11,12]. The NPM portion of this fusion protein
possesses a dimerization domain required for the tyro-
sine kinase activity and transforming ability of NPM-
ALK [13,14]. The activity of the NPM-ALK oncoprotein
is also critically dependent on the molecular chaperone,
heat shock protein-90 (Hsp90) [15-18]. Hsp90 is a ubi-
quitously expressed protein that assists in the proper
folding and activity of numerous cellular proteins
[19,20]. Hsp90 promotes the stability of NPM-ALK
[15-18], as treatment of cell lines with the Hsp90 inhibi-
tor, 17-Allylamino-Demethoxygeldanamycin (17-AAG),
resulted in the proteasomal degradation of NPM-ALK
[17]. The treatment of ALK+ ALCL cell lines with 17-
AAG resulted in cell cycle arrest and the induction of
apoptosis [15,18]; however, these effects are likely due to
more than just decreased NPM-ALK levels. Hsp90 in-
hibition also decreased levels of the pro-survival serine/
threonine kinase Akt, the cell cycle-associated proteins
cyclin D1, cyclin-dependent kinase 4 (cdk4), and cdk6,
as well as several other proteins in ALK+ ALCL
[15,18,21]. The treatment of ALK+ ALCL cell lines with
17-AAG resulted in decreased phosphorylation of the
serine/threonine kinase Erk without affecting Erk levels
[15]. Moreover, the treatment of ALK+ NSCLC with
Hsp90 inhibitors resulted in Erk dephosphorylation as
well as the degradation of Akt and the EML4-ALK onco-
protein in these tumours [22-24].
Hsp90 inhibitors are also effective at inhibiting EML4-
ALK-driven tumourigenesis in vivo in the mouse [22,23],
and the treatment of three ALK+ NSCLC patients with
the Hsp90 inhibitor, IPI-504, resulted in a partial
myofibroblastictumours
nucleophosmin (NPM)
response in two of the patients and stable disease in the
other [25]. Importantly, Hsp90 inhibitors are effective
against tumour cells expressing ALK fusion proteins that
possess mutations that render them resistant to the ALK
inhibitor, Crizotinib [24,26]. Thus, Hsp90 inhibitors may
be useful in treating patients that develop resistance to
ALK inhibitors.
One aspect of Hsp90 biology that is largely unstudied
in ALK-expressing tumours is the role of Hsp90 co-
chaperones. Many functions of Hsp90 are dependent on
its association with co-chaperone proteins [19,20]. Co-
chaperones mediate various aspects of Hsp90 function,
including the association of Hsp90 with client proteins
and the regulation of Hsp90 ATPase activity [19,20].
Cyclophilin 40 (Cyp40), FK506-binding protein (FKBP)
51, and FKBP52 are members of the immunophilin fam-
ily of Hsp90 co-chaperones. This family is best charac-
terized for its association with Hsp90-steroid hormone
receptor complexes containing client proteins such as
the glucocorticoid, estrogen, progesterone, and androgen
receptors [27-30]. The individual immunophilin family
members show some preference for specific hormone
receptors, and they can both antagonize and promote
the transcription mediated by these receptors. For ex-
ample, FKBP51 inhibits the transcriptional activity of the
glucocorticoid receptor [31-33], while FKBP52 is import-
ant for promoting the transcriptional activity of this re-
ceptor [32-35].In addition
receptors, immunophilin
found to complex with the Lck [36] and Fes [37] tyro-
sine kinases. As well, the expression and activity of ecto-
pically expressed v-Src oncoprotein in Saccharomyces
cerevisiae is dependent on the Cyp40 homolog, Cpr7
[38]. Immunophilin co-chaperones are important in can-
cer, as Cyp40 and FKBP51 have been shown to promote
the proliferation of androgen-dependent and androgen-
independent prostate cancer cell lines [39].
We identified Cyp40 in a mass spectrometry screen
designed to identify proteins regulated by the JunB tran-
scription factor in ALK+ ALCL (R.J.I and J.D.P; unpub-
lished observation). JunB is an AP-1 family transcription
factor that is highly expressed in ALK+ ALCL [40-42],
and has been shown to promote the proliferation of the
Karpas 299 ALK+ ALCL cell line [43]. This transcription
factor also promotes the expression of CD30 [44,45] and
the cytotoxic protein, Granzyme B [46], in ALK+ ALCL,
which are phenotypic characteristics of this lymphoma
[1,47]. Since co-chaperone proteins are important for
Hsp90 function, and Hsp90 activity is critical in ALK+
ALCL, we were intrigued by our observation that JunB
might promote the expression of Cyp40 in ALK+ ALCL.
In this study, we examined whether the expression of
the immunophilin co-chaperones was regulated by onco-
genic signalling in ALK+ ALCL. We also investigated
to steroidhormone
haveco-chaperonesbeen
Pearson et al. BMC Cancer 2012, 12:229
http://www.biomedcentral.com/1471-2407/12/229
Page 2 of 14

Page 3

whether the immunophilin co-chaperone proteins were
important for the viability of ALK+ ALCL cell lines. We
found that NPM-ALK induced the transcription of two
immunophilin familyco-chaperones,
FKBP52, but that only Cyp40 transcription was pro-
moted by JunB. In addition, knocking-down the expres-
sion of Cyp40, but not FKBP51 or FKBP52, reduced the
viability of ALK+ ALCL cell lines. However, knock-down
of the immunophilin proteins did not appear to regulate
NPM-ALK stability or activation. In conclusion, we
demonstrate that some members of the immunophilin
family of Hsp90 co-chaperone proteins are targets of
NPM-ALK signalling, and that Cyp40 plays an important
role(s) in ALK+ ALCL that is not shared by other immu-
nophilin family co-chaperones.
Cyp40and
Methods
Reagents and cDNA constructs
The monoclonal antibodies (mAbs) against JunB (C-11
and 204C4a), FKBP51, FKPB52, STAT3, phospho-STAT3
(Tyr 705), Myc, and β-actin were from Santa Cruz Bio-
technology (Santa Cruz, CA). The Cyp40 polyclonal
antibody was also from Santa Cruz Biotechnology. The
anti-JunB (C-11) mAb was used for western blotting,
while the anti-JunB (204C4a) mAb was used in EMSA
experiments. The anti-tubulin mAb was from Calbio-
chem (San Diego, CA), the anti-ALK mAb from Dako
(Burlington, ON, Canada), and the anti-phosphotyrosine
mAb (4G10) was from Millipore (Billerica, MA). Anti-
phospho-ALK (Tyr 338, 342, and 343 of NPM-ALK) and
anti-Akt antibodies were purchased from Cell Signalling
Technology (Danvers. MA). Short interfering RNA
(siRNA) oligonucleotides were purchased from Dharma-
con RNAi Technologies (Lafayette, CO). The NPM-ALK
inhibitor, Crizotinib, was generously provided by Pfizer
[7,48,49]. To generate the human Cyp40 promoter–
driven luciferase reporter construct, we PCR amplified
the Cyp40 proximal promoter (−691 to +62 relative to
the transcriptional start site) from the Karpas 299 cell
line and cloned it into the pGL2 basic luciferase vector
(Promega; Madison, WI). The AP-1 consensus sequence
in the Cyp40 promoter was mutated from TGATTCA to
TAACTAA to generate the AP-1 mutant construct. The
Myc-tagged JunB construct was generated by adding a
double myc tag to the 5′ end of the human JunB cDNA.
This was then cloned into the pcDNA 3.1A eukaryotic
expression vector (Invitrogen; Burlington, ON, Canada).
Cell lines and electroporations
The Karpas 299 and SUP-M2 ALK+ ALCL cell lines
were cultured in RPMI 1640 supplemented with 10%
heat-inactivated FBS, 2 mM L-glutamine, 1 mM sodium
pyruvate, and 50 μM 2-mercaptoethanol. For transfec-
tions involving siRNAs, 4×106cells were transfected by
electroporation with 100 nM pooled siRNA as previously
described [50]. Cells were then incubated for 48 h at 37°
C prior to analysis. For luciferase reporter assays, 1×107
cells were transfected with 10 μg of the indicated pGL2
luciferase construct and 1 μg of a constitutively expressed
Renilla luciferase construct (to control for transfection ef-
ficiency). In luciferase experiments involving siRNAs,
cells were also transfected with 100 nM pooled control
(non-targeting) or JunB siRNA. For luciferase assays per-
formed on Karpas 299 cells over-expressing JunB, cells
were transfected with the luciferase constructs as
described above and 5 μg of Myc-tagged JunB or empty
vector. Cells were then incubated for 24 h at 37°C prior
to analysis of luciferase activity (see below).
Cell lysis, immunoprecipitations, and western blotting
Cells were lysed in Nonidet P-40 lysis buffer [50] contain-
ing protease inhibitor cocktail (Sigma-Aldrich; Missis-
sauga, ON, Canada), 1 mM phenylmethylsulfonylfluoride,
and 1 mM sodium orthovanadate. Lysates were cleared
of detergent-insoluble material by centrifugation at
~20,000g for 10 min. The protein concentration of
cleared lysates was determined using the BCA Protein
Assay kit (Thermo Scientific; Waltham, MA). Anti-ALK
immunoprecipitations were performed by incubating
cleared lysates with 0.5 μg of the anti-ALK antibody and
Protein A-Sepharose beads (Sigma-Aldrich) for 1–2 h at
4°C on a nutator. Beads were subsequently washed with
lysis buffer and bound proteins eluted by boiling in SDS-
PAGE sample buffer. Cell lysates or immunoprecipitates
were resolved on SDS-PAGE gels and transferred to
nitrocellulose membranes. Western blots were visualized
using SuperSignal West Pico Chemiluminescent Sub-
strate (Thermo Scientific) and band intensities quantified
using a LI-COR Odyssey Infrared Imager (LI-COR Bios-
ciences; Lincoln, NE). Expression of the quantified pro-
teins were normalized to tubulin levels and expressed
relative to control (non-targeting) siRNA-treated cells.
The number of independent replicates for each experi-
ment are indicated in the figure legends. To reprobe
blots, membranes were stripped in 0.1% TBST, pH 2
prior to incubation with the new primary antibody.
Quantitative RT-PCR (qRT-PCR)
After collection using the RNeasy mini kit (Qiagen; Mis-
sissauga, ON), total RNA was digested with DNase I to
remove potential DNA contamination, and then reverse
transcribed to cDNA using the Superscript II Reverse
Transcriptase System (Invitrogen;
Canada). qRT-PCR was performed using PerfeCTa SYBR
Green FastMix (Quanta Biosciences; Gaithersburg, MD)
on an Eppendorf Mastercycler realplex4thermal cycler.
Cyp40 and FKBP52 mRNA levels were then determined
using the ΔΔ-CT method [51] with β-actin as the
Burlington,ON,
Pearson et al. BMC Cancer 2012, 12:229
http://www.biomedcentral.com/1471-2407/12/229
Page 3 of 14

Page 4

housekeeping gene. The following primers were used:
Cyp40 forward - TCGAGTCTTCTTTGACGTGGA,
reverse - CAGTCGTGTGTCCAATGCCTT; FKBP52
forward - TGCTGAAGGTCATCAAGAGAGAG, re-
verse - ATGGTGGCTATGGCAATGTC; actin forward -
AGAAAATCTGGCACCACACC, reverse - TAGCA-
CAGCCTGGATAGCAA. Results are displayed relative
to control siRNA-transfected cells and represent the
mean and standard deviation of three independent
experiments.
Luciferase assays
Luciferase assays were performed on a BMG Labtech
Plate Reader using the Dual-Glo Luciferase Assay Sys-
tem (Promega) and the protocol provided by the manu-
facturer. Cyp40 promoter-driven firefly luciferase and
constitutive Renilla luciferase activity were determined
in triplicate for each sample. The level of firefly activity
was normalized to Renilla activity and triplicate mea-
surements were averaged. Three independent replicates
were performed for each experiment.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were collected from Karpas 299 cells
using the ProteoJET cytoplasmic and nuclear protein ex-
traction kit (Fermentas; Burlington, ON, CA). EMSAs
were performed with the LightShift chemiluminescent
EMSA kit (Thermo Scientific) using a biotinylated probe
corresponding to a 20 nucleotide sequence surrounding
the AP-1 site of the Cyp40 promoter (TTGTACTGATT-
CATGTCTTT). The unlabeled AP-1 mutant competitor
contained the same mutation as described for the lucifer-
ase reporter construct (see above). Binding reactions
were performed with 7.5 μg of nuclear protein extract,
100 fmol of the Cyp40 promoter probe, and a 50-fold
molar excess of an unlabeled Cyp40 promoter as a com-
petitor. For super-shift experiments, 1 μg of the indicated
antibody was pre-incubated with the reaction mixture for
15 min on ice prior to addition of the biotinylated probe.
MTS viability assays
After transfection with the indicated siRNAs, cells were
resuspended to 4×104cells/ml and incubated at 37°C
for 48 h. The number of viable cells in each sample was
determined in triplicate using the CellTiter 96 AQueous
Non-Radioactive Cell Proliferation Assay (MTS assay)
(Promega). Triplicate measurements were then averaged
and the percentage of viable cells determined relative to
cells transfected with control siRNA. Each experiment
was performed in quadruplicate.
Statistical analysis
Statistical analysis was performed using paired, one-
tailed t-test in all cases, except the comparison of
viability with Cyp40 siRNA to combined siRNA in which
an unpaired, one-tailed t-test was performed.
Results
JunB promotes Cyp40, but not FKBP51 or FKBP52,
expression in ALK+ ALCL cell lines
To confirm our mass spectrometry findings showing
that JunB promotes the expression of Cyp40 in ALK+
ALCL, we performed western blotting experiments. Des-
pite incomplete JunB knock-down, we observed a de-
crease in Cyp40 protein expression after knock-down of
JunB with siRNA in both the Karpas 299 and SUP-M2
ALK+ ALCL cell lines (Figure 1A). Since Cyp40 belongs
to the immunophilin family of Hsp90 co-chaperone pro-
teins, which includes FKBP51 and FKBP52, we also
examined whether JunB promotes the expression of
these proteins. However, we found that JunB knock-
down did not influence FKBP51 or FKBP52 protein ex-
pression in ALK+ ALCL cell lines (Figure 1B and C).
We next examined Cyp40 mRNA levels after treat-
ment of cells with JunB siRNA, and found that knock-
down of JunB resulted in decreased levels of Cyp40
mRNAin both Karpas
(Figure 2A). We also generated a luciferase reporter con-
struct where expression of firefly luciferase is under con-
trol of the human Cyp40 promoter. When transfected
into Karpas 299 cells this construct exhibited strong
luciferase activity, which was reduced when cells were
co-transfected with JunB siRNA (Figure 2B). In addition,
over-expression of Myc-tagged JunB was found to pro-
mote transcription from this luciferase promoter con-
struct, further demonstrating
transcription of Cyp40 (Figure 2C). The Cyp40 promoter
contains a consensus sequence for AP-1 family tran-
scription factors [52] that could be recognized by JunB.
Mutation of this site resulted in reduced luciferase activ-
ity (Figure 2D), demonstrating this site is important for
Cyp40 transcription. To examine whether JunB can bind
thisAP-1 sitewe performed
(Figure 2E). We found that a protein(s) expressed by
Karpas 299 cells bound to a biotinylated probe corre-
sponding to the AP-1 site in the Cyp40 promoter. We
further found that JunB was a major component of the
probe/protein complex(es) bound to this AP-1 site, as
inclusion of an anti-JunB antibody in the binding reac-
tion resulted in an almost complete super-shift of the
probe/protein complex. Taken together, our results
argue that JunB functions as a direct transcriptional acti-
vator of Cyp40 in ALK+ ALCL.
299and SUP-M2cells
that JunB promotes
EMSA experiments
NPM-ALK promotes Cyp40 and FKBP52, but not FKBP51,
expression
The NPM-ALK oncoprotein drives much of the signal-
ling underlying the pathogenesis of ALK+ ALCL [2,3],
Pearson et al. BMC Cancer 2012, 12:229
http://www.biomedcentral.com/1471-2407/12/229
Page 4 of 14

Page 5

including the elevated expression of JunB [43,44,46].
Therefore, we next examined whether NPM-ALK pro-
motes expression of the immunophilin co-chaperones in
ALK+ ALCL. We found that knock-down of NPM-ALK
in Karpas 299 and SUP-M2 cells resulted in significantly
reduced Cyp40 protein levels (Figure 3A). NPM-ALK
knock-down also resulted in a substantial reduction in
JunB levels, that was comparable to the reduction in
JunB observed after JunB siRNA treatment (compare
Figure 3A and Figure 1). Knock-down of NPM-ALK also
resulted in decreased FKBP52 expression, but had no ef-
fect on the expression of FKBP51 (Figures 3B and C, re-
spectively). Using quantitative RT-PCR, we found that
knock-down of NPM-ALK reduced Cyp40 (Figure 3D)
and FKBP52 (Figure 3E) mRNA expression in ALK+
ALCL cell lines. These findings show that both Cyp40
and FKBP52 are transcriptional targets of NPM-ALK
signalling in ALK+ ALCL.
To further examine the regulation of the immunophi-
lin co-chaperones by NPM-ALK, we treated ALK+
ALCL cell lines with the ALK inhibitor, Crizotinib,
which has been shown to be useful in treating patients
with ALK+ ALCL [53] and EML4-ALK+ NSCLC
[7,54,55]. Treatment of Karpas 299 and SUP-M2 cells
with Crizotinib resulted in a dose- (Figure 4A) and time-
dependent (Figure 4B) decrease in NPM-ALK phosphor-
ylation on tyrosines 338, 342, and 343. These phosphor-
ylation sites are located within the activation loop of
the kinase domain, and their phosphorylation correlates
with NPM-ALK activation [56,57]. Furthermore, we
observed a dose- and time-dependent decrease in
Cyp40 and FKBP52 protein expression in both Karpas
299 and SUP-M2 cells after Crizotinib treatment
(Figure 4C and D). In contrast, Crizotinib treatment
did not decrease FKBP51 expression in either cell line;
however it did result in a modest, but reproducible,
A
Karpas 299
control
43kDa
siRNA:
JunB
anti-Cyp40 blot
anti-JunB blot
55kDa
43kDa
anti-tubulin blot
100
100
77
85
0
20
40
60
80
100
120
control siRNA
JunB siRNA
Relative Cyp40
protein level (%)
Karpas 299 SUP-M2
p = 0.003
p = 0.002
B
100
100
103
113
0
20
40
60
80
100
120
control siRNA
JunB siRNA
Relative FKBP51
protein level (%)
Karpas 299 SUP-M2
N.S.
N.S.
C
100
100
97
94
0
20
40
60
80
100
120
control siRNA
JunB siRNA
Relative FKBP52
protein level (%)
Karpas 299 SUP-M2
N.S.
N.S.
SUP-M2
control
siRNA:
43kDa
JunB
anti-Cyp40 blot
anti-JunB blot
55kDa
43kDa
anti-tubulin blot
Karpas 299
control
55kDa
siRNA:
JunB
anti-FKBP51 blot
anti-JunB blot
43kDa
anti-tubulin blot
55kDa
SUP-M2
control
siRNA:
55kDa
JunB
anti-FKBP51 blot
anti-JunB blot
55kDa
43kDa
anti-tubulin blot
Karpas 299
control
siRNA:
JunB
anti-FKBP52 blot
55kDa
anti-JunB blot
43kDa
anti-tubulin blot
55kDa
SUP-M2
control
siRNA:
JunB
anti-FKBP52 blot
55kDa
anti-JunB blot
55kDa
43kDa
anti-tubulin blot
Figure 1 JunB promotes Cyp40, but not FKBP51 or FKBP52, protein expression in ALK+ ALCL. Western blot analysis (left) and
quantification (right) of Cyp40 (A), FKBP51 (B), and FKBP52 (C) levels in lysates collected from Karpas 299 and SUP-M2 cells treated with pooled
control (non-targeting) or JunB siRNA. Quantification represents the mean and standard deviation of five (Cyp40) or four (FKBP51 and FKBP52)
independent experiments. p values were obtained using paired, one-tailed t-tests. N.S. indicates a p value >0.05.
Pearson et al. BMC Cancer 2012, 12:229
http://www.biomedcentral.com/1471-2407/12/229
Page 5 of 14