Article

The burden of drinking water-associated cryptosporidiosis in China: The large contribution of the immunodeficient population identified by quantitative microbial risk assessment

State Key Laboratory of Environmental Aquatic Chemistry, Research Centre for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China.
Water Research (Impact Factor: 5.32). 05/2012; 46(13):4272-80. DOI: 10.1016/j.watres.2012.05.012
Source: PubMed

ABSTRACT A comprehensive quantitative microbial risk assessment (QMRA) of Cryptosporidium infection, considering pathogen removal efficiency, different exposure pathways and different susceptible subpopulations, was performed based on the result of a survey of source water from 66 waterworks in 33 major cities across China. The Cryptosporidium concentrations in source water were 0-6 oocysts/10 L, with a mean value of 0.7 oocysts/10 L. The annual diarrhea morbidity caused by Cryptosporidium in drinking water was estimated to be 2701 (95% confidence interval (CI): 138-9381) cases per 100,000 immunodeficient persons and 148 (95% CI: 1-603) cases per 100,000 immunocompetent persons, giving an overall rate of 149.0 (95% CI: 1.3-606.4) cases per 100,000 population. The cryptosporidiosis burden associated with drinking water treated with the conventional process was calculated to be 8.31 × 10(-6) (95% CI: 0.34-30.93 × 10(-6)) disability-adjusted life years (DALYs) per person per year, which was higher than the reference risk level suggested by the World Health Organization (WHO), but lower than that suggested by the United States Environmental Protection Agency (USEPA). Sixty-six percent of the total health burden due to cryptosporidiosis that occurred in the immunodeficient subpopulation, and 90% of the total DALYs was attributed to adults aged 15-59 years. The sensitivity analysis highlighted the great importance of stability of the treatment process and the importance of watershed protection. The results of this study will be useful in better evaluating and reducing the burden of Cryptosporidium infection.

0 Bookmarks
 · 
177 Views
  • [Show abstract] [Hide abstract]
    ABSTRACT: The Three Gorges Reservoir (TGR), formed by China's Yangtze Three Gorges Project, is the largest lake in the world, but there is too little information available about fecal contamination and waterborne pathogen impacts on this aquatic ecosystem. During two successive 1-year study periods (July 2009 to July 2011), the water quality in Wanzhou watershed of the TGR was tested with regard to the presence of fecal indicators and pathogens. According to Chinese and World Health Organization water quality standards, water quality in the mainstream was good but poor in backwater areas. Salmonella, Enterohemorrhagic Escherichia coli (EHEC), Giardia and Cryptosporidium were detected in the watershed. Prevalence and concentrations of the pathogens in the mainstream were lower than those in backwater areas. The estimated risk of infection with Salmonella, EHEC, Cryptosporidium, and Giardia per exposure event ranged from 2.9 x 10(-7) to 1.68 x 10(-5), 7.04 x 10(-10) to 2.36 x 10(-7), 5.39 x 10(-6) to 1.25 x 10(-4) and 0 to 1.2 x 10(-3), respectively, for occupational divers and recreational swimmers exposed to the waters. The estimated risk of infection at exposure to the 95% upper confidence limit concentrations of Salmonella, Cryptosporidium and Giardia may be up to 2.62 x 10(-5), 2.55 x 10(-4) and 2.86 x 10(-3), respectively. This study provides useful information for the residents, health care workers and managers to improve the safety of surface water and reduce the risk of fecal contamination in the TGR.
    Journal of Environmental Sciences 09/2013; 25(9):1913-24. DOI:10.1016/S1001-0742(12)60241-1 · 1.92 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Copyright © 2013 Yin et al. This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Introduction Cryptosporidium spp. causes the diarrheal illness called cryptosporidiosis that may be fatal in the immunocompromised. More attention has been focused on the epidemiology and detection of Cryptosporidium in China including studies on infection in humans, animal populations and environmental water. Cryptosporidium has been an essential indicator in Standards for Drinking Water Quality (GB5749-2006) in China from 1 July 2008. Domestic animals play an active role in family life, particularly dogs and cats involving continuous close contact with humans. In China, it was reported that the cities of Shanghai, Beijing, Guangzhou, Chongqing and Wuhan have been recognized as 'Pet City', and it was estimated that there are at least 150 million pet dogs around the country [1]. It is important to raise awareness that domestic animals may harbor zoonotic parasites such as Cryptosporidium asymptomatically. Infection of Cryptosporidium in dogs and cats has been reported in some countries, including the host-adapted and zoonotic Cryptosporidium canis infected in dogs from Japan [2] and Canada [3], Cryptosporidium parvum in dogs from Germany [4] and Costa Rica [5], and in cats from other countries [4, 5]. The host-adapted and zoonotic Cryptosporidium felis has been reported in cats from USA [6] as well as a report of a mixed infection in a cat involving Cryptosporidium muris and Cryptosporidium felis [7]. However, little relative information is known about the prevalence of Cryptosporidium in domestic animals in China. This study was aimed to estimate the prevalence of Cryptosporidium among the pet dogs and cats and other animals in a zoo of Shanghai, China. The Study Eighty-four fecal samples were collected from 19 caged dogs, 11 kennel cats from a pet hospital and 54 other animals (Table 1), as well as 8 wastewater samples from drainage channels from a zoo. Genomic DNA was extracted from feces using the QIAamp DNA Stool Mini Kit (Qiagen, Valencia, USA) following the manufacturer's instruction of Protocol, and DNA was stored at -20°C before it was used in PCR amplification reactions. Nested PCR was used to amplify an approximately 840 base pair (bp) long fragment of the SSU rRNA gene using two sets of oligonucleotide primers: F1: TTCTAGAGCTAATACATGCG and R1: CCCATTTCCTTCGAAACAGGA for primary PCR and F2: GGAAGGGTTGTATTTATTAGATAAAG and R2: CTCATAAGGTGCTGAAGGAGTAfor secondary PCR[8]. Amplification reactions were carried out in 25 µl volumes consisting of 12.5 µl Taq Green Master Mix (2X), 1 µl of each primer (10X), 9.5 µl nuclease-free water and 1 µl DNA. Reaction conditions were comprised of a hot start at 94°C for 1 min followed by 35 cycles at 94°C for 10 s, 55°C for 30 s and 72°C for 1 min and a final extension at 72°C for 10 min.
    The Journal of Infection in Developing Countries 12/2013; 7(12):1020-1022. DOI:10.3855/jidc.3540 · 1.27 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Disability adjusted life year (DALY) has been widely used since 1990s for evaluating global and/or regional burden of diseases. As many environmental pollutants are hazardous to human health, DALY is also recognized as an indicator to quantify the health impact of environmental pollution related to disease burden. Based on literature reviews, this article aims to give an overview of the applicable methodologies and research directions for using DALY as a tool for quantitative assessment of environmental pollution. With an introduction of the methodological framework of DALY, the requirements on data collection and manipulation for quantifying disease burdens are summarized. Regarding environmental pollutants hazardous to human beings, health effect/risk evaluation is indispensable for transforming pollution data into disease data through exposure and dose–response analyses which need careful selection of models and determination of parameters. Following the methodological discussions, real cases are analyzed with attention paid to chemical pollutants and pathogens usually encountered in environmental pollution. It can be seen from existing studies that DALY is advantageous over conventional environmental impact assessment for quantification and comparison of the risks resulted from environmental pollution. However, further studies are still required to standardize the methods of health effect evaluation regarding varied pollutants under varied circumstances before DALY calculation.
    Science of The Total Environment 04/2015; 511. DOI:10.1016/j.scitotenv.2014.11.048 · 3.16 Impact Factor

Full-text

Download
80 Downloads
Available from
May 29, 2014